LEIDEN, THE NETHERLANDS

Size: px
Start display at page:

Download "LEIDEN, THE NETHERLANDS"

Transcription

1 Full-length CYP2D6 diplotyping for better drug dosage and response management Henk Buermans, PhD Leiden University Medical Center Human Genetics, LGTC LEIDEN, THE NETHERLANDS

2 CYP2D6 Function Metabolism of xenobiotics (drugs) ~25% of prescription drugs are processed by CYP2D6 High expression in the Liver High variation between individuals in efficiency and amount of CYP2D6 enzyme If a drug is metabolized too quickly, it may decrease the drug's efficacy while if the drug is metabolized too slowly, toxicity may result Inactive CYP2D6 Tamoxifen 2 active Endoxifen

3 CYP2D6 Variants and protein activity Specific combinations of variants predict the phenotype 3 Poor Metabolizer Little or no CYP2D6 function *3, *4, *5, *6, *11. Intermediate Metabolizers Metabolize drugs at a rate somewhere between the poor and extensive metabolizers *9, *10, *17, *29... Extensive Metabolizer Normal CYP2D6 function *1, *2, *35... Ultrarapid Metabolizer Multiple copies of the CYP2D6 gene are expressed, and therefore greater-than-normal CYP2D6 function *1xN, *2xN...

4 CYP2D6 Variants and protein activity database ( ) 193 variants & 163 haplogroups

5 CYP2D6 Variants and protein activity CYP2D6 variant assay Haplotype per gene copy with variants Diplotype Lookup table for metabolic activity for a specific drug Tailored drug regimen per individual

6 Classical CYP2D6 genotyping methods are sub optimal Fixed features for Array platforms Limited number of variants included Limited haplogroups represented Gaedigk A, International Review of Psychiatry, October 2013; 25(5): No phasing information Most platforms only test whether a duplication is present, but do not: discriminate among duplications quantitatively determine copy number High sequence homology between CYP genes (CYP2D7 pseudogene) Costly (reagents + time) 6

7 Different technologies for CYP2D6 profiling x 5 Entire gene locus: 6,537 bases PharmGKB Roche DMET % 0.45% 0.36% Profile variants with well described association with specific haplotypes

8 PacBio RSII Long read SMRT sequencing Advantages for CYP2D6 genotyping: High Multiplexing Capacity No GC bias (at sequencing level) Long read technology spanning kilobases Sequence the complete CYP2D6 gene High accuracy consensus sequences Variant Phasing Short time to DNA sequence data 8

9 PacBio CYP2D6 Amplicon Setup Two-step Barcoding Scheme 1: locus specific amplification with M13-F and M13-R sequence tails Patient 1 Patient 2 M13-F M13-F locus1 M13-R M13-R 2: Barcoding with re-usable M13 barcode primers index1 Patient 1 M13-F index2 Patient 2 M13-F M13-R locus1 index1 Equimolar pool PacBio RSII M13-R index2

10 PacBio Data Analysis Barcoded samples (n=12) per SMRT cell Sequenced on RSII with P6/C4 Long Amplicon analysis v2 For each individual one or more Haplogroup sequences Re-orient sequences to the plus strand sequence Removal of PCR primer sequences 10

11 PacBio Data Analysis Barcoded samples (n=12) per SMRT cell Align to chr22 Hg38 with BWA MEM Sequenced on RSII with P6/C4 Variant calling with bcftools (v1.2) Long Amplicon analysis v2 LeftAlignAndTrimVariants with GATK For each individual one or more Haplogroup sequences Merge all vcf files Re-orient sequences to the plus strand sequence Removal of PCR primer sequences 11 Describe all variants in HGVS format (Ref = Hg38 genomic positions, plus strand) Call haplotypes. Use the Translation table ( feb 2016) 196 variants & 163 genotypes / haplogroups

12 PacBio CYP2D6 Haplotyping results Two haplogroup sequences Hg-1: 19 variants: 18 snp + 1 ins + 0 del Hg-2: 25 variants: 23 snp + 1 ins + 1 del Hg-1 Hg HOM HET variants for CYP2D6 *4A no activity 14 variants for CYP2D6 *41 decreased activity diplotype: CYP2D6 *4A/*41

13 PacBio CYP2D6 Haplotyping results

14 PacBio CYP2D6 Haplotyping results Gene duplication Increased subread coverage ratio PCR for deletion: Negative PCR for duplication: Positive 14 Hg1 *1A Hg2 *2A 1x product for Hg1 *2A Double yield for Hg2

15 PacBio CYP2D6 Haplotyping results One Haplogroup sequence PCR for deletion: Negative PCR for duplication: Positive Hg1 Gene duplication 15 Hg2 *2A *2A *2A

16 PacBio CYP2D6 Haplotyping results Gene Deletion events One Haplogroup sequence Hg1 Hg2 16 *2A PCR for deletion: Positive PCR for duplication: Negative Only LR-PCR product for Hg1 *5 gene deletion

17 CYP2D6 Variant Effects Total 40 samples 71 unique variants Ensembl VEP Consequences upstream_gene_variant: 48% intron_variant: 24% non_coding_transcript_variant: 13% downstream_gene_variant: 4% missense_variant: 4% synonymous_variant: 2% frameshift_variant: 2% splice_region_variant: 1% non_coding_transcript_exon_variant: 1% Others Coding Consequences missense_variant: 51% synonymous_variant: 24% frameshift_variant: 19% inframe_deletion: 5%

18 CYP2D6 Variant Effects Total 40 samples 71 unique variants NOT listed in PharmGKB database: with rsid downstream_gene_variant 2 intron_variant 4 upstream_gene_variant 4 frameshift_variant 1 missense_variant 2 Individual also had a CYP2D6 *5 gene deletion 7x G 6x G Needs re-analysis 26 No rsid PolyPhen & Sift Prediction 22:g C>T benign(0.041) & tolerated(0.22) PolyPhen & Sift Prediction 22:g C>T [rs ] benign(0.003) & tolerated(0.22) 22:g C>T [rs ] benign(0.003) % deleterious(0.05)

19 Novel CYP2D6 variants confirmed 22:g _ delTGT 22:g G>C * Reference deltgt Present in 80% of all individuals in this study Present in one individual in this study

20 Conclusion & Discussion PacBio Long Read CYP2D6 haplotyping outperforms existing technologies High multiplexing capabilities Full length vs selected variants Variant Phasing Accurate variant calls haplotype calls Gene duplications can be detected Run in parallel with PCR for Gene deletions, duplications and CYP2D6-7 fusion eventsplus Found many additional variants that had not previously been associated with the defined haplogroups Novel Variants detected & Confirmed 20

21 Acknowledgements Dept for Human Genetics / LGTC Johan den Dunnen Stefan White Guy Allard Yahya Anvar Rolf Vossen Dept. Clinical Pharmacy and Toxicology Tahar van der Straaten Paul Bank Henk-Jan Guchelaar Jesse Swen Contact: info@lgtc.nl

Detection of low-frequent mitochondrial DNA variants using SMRT sequencing

Detection of low-frequent mitochondrial DNA variants using SMRT sequencing Detection of low-frequent mitochondrial DNA variants using SMRT sequencing Marjolein J.A. Weerts SMRT Leiden 2018 June 13 Content Mitochondrial DNA & liquid biopsy in oncology Pitfalls when studying human

More information

CYP2D6 Genotype to Phenotype Standardization Project

CYP2D6 Genotype to Phenotype Standardization Project CYP2D6 Genotype to Phenotype Standardization Project Project Objectives Determine a strategy for defining CYP2D6 phenotype based on genotype using a modified Delphi method. Standardize phenotype definitions

More information

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery

CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences

More information

SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN

SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN Structural variation (SV) Variants larger than 50bps Affect

More information

Rapid genomic screening of embryos using nanopore sequencing

Rapid genomic screening of embryos using nanopore sequencing Rapid genomic screening of embryos using nanopore sequencing Daniel J Turner, PhD Senior Director of Applications Oxford Nanopore Technologies Forman EJ & Scott RT Jr Contemporary OB/GYN () 2014 Euploid

More information

Supplement to: Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC ) for CYP2D6

Supplement to: Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC ) for CYP2D6 Supplement to: Pharmacogenetics Implementation Consortium Guideline (CPIC ) for CYP2D6 and CYP2C19 Genotypes and Tricyclic Antidepressants: 2016 Update J. Kevin Hicks 1, Katrin Sangkuhl 2, Jesse J. Swen

More information

Lynch Syndrome and COLARIS Testing

Lynch Syndrome and COLARIS Testing Lynch Syndrome and COLARIS Testing Webinar Objectives Review of Lynch syndrome as a multi-gene disorder COLARIS Enhancements Technical Overview COLARIS test offerings Test development and validation process

More information

Deriving Rules and Assertions From Pharmacogenomic Knowledge Resources In Support Of Patient Drug Metabolism Efficacy Predictions!

Deriving Rules and Assertions From Pharmacogenomic Knowledge Resources In Support Of Patient Drug Metabolism Efficacy Predictions! Deriving Rules and Assertions From Pharmacogenomic Knowledge Resources In Support Of Patient Drug Metabolism Efficacy Predictions! Casey L. Overby 1,2, Beth Devine 1, Peter Tarczy-Hornoch 1, Ira Kalet

More information

Supplement to: Clinical Pharmacogenetics Implementation Consortium Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Tricyclic Antidepressants

Supplement to: Clinical Pharmacogenetics Implementation Consortium Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Tricyclic Antidepressants Supplement to: Pharmacogenetics Implementation Consortium Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Tricyclic Antidepressants J. Kevin Hicks 1, Jesse J. Swen 2, Caroline F. Thorn 3, Katrin

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies

More information

Ron van Schaik. Pharmacogenetics. London, Oct 8-9, Clinical implementation: a 7 year experience

Ron van Schaik. Pharmacogenetics. London, Oct 8-9, Clinical implementation: a 7 year experience Ron van Schaik Associate Professor Pharmacogenetics Eur Clin Chem / Advisor EMA - PGWG London, Oct 8-9, 2012 Pharmacogenetics Clinical implementation: a 7 year experience Pharmacogenetics Core Laboratory*

More information

CORE DME PANEL Highlands Parkway, Suite 100 Smyrna, GA 30082

CORE DME PANEL Highlands Parkway, Suite 100 Smyrna, GA 30082 CORE DME PANEL Castle's CORE DME panel predicts the activity levels of key - drug metabolizing enzymes in the cytochrome P450 superfamily: CYP2D6, CYP2C9, CYP2C19, CYP2B6, CYP3A4, and - CYP3A5. Apart from

More information

Accel-Amplicon Panels

Accel-Amplicon Panels Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation

More information

Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing

Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing GA N 668353 H2020 Research and Innovation Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing WP N and Title: WP2 - Towards shared European Guidelines for PGx Lead beneficiary:

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

SAMPLE REPORT MENTAL HEALTH DNA INSIGHT

SAMPLE REPORT MENTAL HEALTH DNA INSIGHT PERSONAL DETAILS DOB Jan 1, 19XX ETHNICITY Caucasian ORDERING HEALTHCARE PROFESSIONAL Glenn Braunstein.D. 6777 Nancy Ridge Drive San Diego, CA 92121 US LABORATORY INFO ACCESSION NUBER ACTIVATION CODE SPECIEN

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

Supplementary information to:

Supplementary information to: Supplementary information to: Digital Sorting of Pure Cell Populations Enables Unambiguous Genetic Analysis of Heterogeneous Formalin-Fixed Paraffin Embedded Tumors by Next Generation Sequencing Authors

More information

Introduction to LOH and Allele Specific Copy Number User Forum

Introduction to LOH and Allele Specific Copy Number User Forum Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.

More information

Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT

Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

CHAPTER IV RESULTS Microcephaly General description

CHAPTER IV RESULTS Microcephaly General description 47 CHAPTER IV RESULTS 4.1. Microcephaly 4.1.1. General description This study found that from a previous study of 527 individuals with MR, 48 (23 female and 25 male) unrelated individuals were identified

More information

FEP Medical Policy Manual

FEP Medical Policy Manual FEP Medical Policy Manual Effective Date: October 15, 2018 Related Policies: 2.04.38 Cytochrome P450 Genotype-Guided Treatment Strategy Genotype-Guided Tamoxifen Treatment Description Tamoxifen is prescribed

More information

Comprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks?

Comprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks? Comprehensive Chromosome Screening Is NextGen Likely to be the Final Best Platform and What are its Advantages and Quirks? Embryo 1 Embryo 2 combine samples for a single sequencing chip Barcode 1 CTAAGGTAAC

More information

General Discussion 4

General Discussion 4 General Discussion 4 General Discussion 115 Introduction Psychiatry is considered to be one of the first medical disciplines that will implement pharmacogenetic testing in daily clinical practice. The

More information

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these

More information

Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs

Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Joris Vermeesch, Center for Human Genetics K.U.Leuven, Belgium ESHG June 11, 2010 When and

More information

Illuminating the genetics of complex human diseases

Illuminating the genetics of complex human diseases Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.

More information

GENOME-WIDE ASSOCIATION STUDIES

GENOME-WIDE ASSOCIATION STUDIES GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Your Kailos Test. Sample ID: CL-4194-DM. Jane Doe DOB: Hello Jane,

Your Kailos Test. Sample ID: CL-4194-DM. Jane Doe DOB: Hello Jane, 1 Jane Doe DOB: 1985-01-05 Sample ID: CL-4194-DM Hello Jane, Thank you for ordering your Kailos test for antidepressants. Kailos Genetics is committed to making gene-based healthcare available to YOU.

More information

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA

More information

CYP2D6 and the oestrogen receptor

CYP2D6 and the oestrogen receptor Powered by Website address: https://www.gesundheitsindustriebw.de/en/article/news/cyp2d6-and-the-oestrogenreceptor/ CYP2D6 and the oestrogen receptor The medicinal adjuvant therapy of breast cancer is

More information

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.

Genome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl. GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant

More information

MRC-Holland MLPA. Description version 08; 30 March 2015

MRC-Holland MLPA. Description version 08; 30 March 2015 SALSA MLPA probemix P351-C1 / P352-D1 PKD1-PKD2 P351-C1 lot C1-0914: as compared to the previous version B2 lot B2-0511 one target probe has been removed and three reference probes have been replaced.

More information

INDIVIDUALIZED MEDICINE

INDIVIDUALIZED MEDICINE CENTER FOR INDIVIDUALIZED MEDICINE Precision Oncology: Current Applications of omics ACP Arizona Chapter Scientific Meeting, 2014 Arizona State University in Tempe, Arizona Alan Bryce, MD 2012 MFMER slide-1

More information

HBV. Next Generation Sequencing, data analysis and reporting. Presenter Leen-Jan van Doorn

HBV. Next Generation Sequencing, data analysis and reporting. Presenter Leen-Jan van Doorn HBV Next Generation Sequencing, data analysis and reporting Presenter Leen-Jan van Doorn HBV Forum 3 October 24 th, 2017 Marriott Marquis, Washington DC www.forumresearch.org HBV Biomarkers HBV biomarkers:

More information

Issues arising from UKNEQAS schemes. Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014

Issues arising from UKNEQAS schemes. Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014 Issues arising from UKNEQAS schemes Ottie O Brien, Northern Genetics Service, Newcastle, UK 15 th May 2014 2013 schemes There was great variation in the way HGVS nomenclature was applied Scheme would like

More information

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced. mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

Drug Metabolism Disposition

Drug Metabolism Disposition Drug Metabolism Disposition The CYP2C19 intron 2 branch point SNP is the ancestral polymorphism contributing to the poor metabolizer phenotype in livers with CYP2C19*35 and CYP2C19*2 alleles Amarjit S.

More information

CPT Codes for Pharmacogenomic Tests

CPT Codes for Pharmacogenomic Tests CPT s for Pharmacogenomic Tests The table below lists CPT codes and lab fee information for pharmacogenomic tests as established by the Centers for Medicare and Medicaid Services. It was compiled by the

More information

MRC-Holland MLPA. Description version 18; 09 September 2015

MRC-Holland MLPA. Description version 18; 09 September 2015 SALSA MLPA probemix P090-A4 BRCA2 Lot A4-0715, A4-0714, A4-0314, A4-0813, A4-0712: Compared to lot A3-0710, the 88 and 96 nt control fragments have been replaced (QDX2). This product is identical to the

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

American Psychiatric Nurses Association

American Psychiatric Nurses Association Francis J. McMahon International Society of Psychiatric Genetics Johns Hopkins University School of Medicine Dept. of Psychiatry Human Genetics Branch, National Institute of Mental Health* * views expressed

More information

Pharmacogenomics of Antidepressant Medications

Pharmacogenomics of Antidepressant Medications Research Reviews: Pharmacy and Pharmaceutical Sciences e-issn: 2320-1215 www.rroij.com Pharmacogenomics of Antidepressant Medications Amanpreet Kooner and Inder Sehgal* California Health Sciences, University

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Objectives. Clinical Problem. What if there were a way. Pharmacogenomics in Current Practice MEDICINE 12/1/2017

Objectives. Clinical Problem. What if there were a way. Pharmacogenomics in Current Practice MEDICINE 12/1/2017 Objectives Pharmacogenomics in Current Practice Trinh Pham, PharmD, BCOP Associate Clinical Professor University of Connecticut School of Pharmacy Review the concept of pharmacogenetics and pharmacogenomics

More information

Identification of genomic alterations in cervical cancer biopsies by exome sequencing

Identification of genomic alterations in cervical cancer biopsies by exome sequencing Chapter- 4 Identification of genomic alterations in cervical cancer biopsies by exome sequencing 105 4.1 INTRODUCTION Athough HPV has been identified as the prime etiological factor for cervical cancer,

More information

Pharmacogenomics in Current Practice. Trinh Pham, PharmD, BCOP Associate Clinical Professor University of Connecticut School of Pharmacy.

Pharmacogenomics in Current Practice. Trinh Pham, PharmD, BCOP Associate Clinical Professor University of Connecticut School of Pharmacy. Pharmacogenomics in Current Practice Trinh Pham, PharmD, BCOP Associate Clinical Professor University of Connecticut School of Pharmacy Objectives Review the concept of pharmacogenetics and pharmacogenomics

More information

SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A

SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes

More information

Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative

Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47

More information

Supplementary Figure 1. Estimation of tumour content

Supplementary Figure 1. Estimation of tumour content Supplementary Figure 1. Estimation of tumour content a, Approach used to estimate the tumour content in S13T1/T2, S6T1/T2, S3T1/T2 and S12T1/T2. Tissue and tumour areas were evaluated by two independent

More information

No mutations were identified.

No mutations were identified. Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123

More information

Copy Number Varia/on Detec/on. Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015

Copy Number Varia/on Detec/on. Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015 Copy Number Varia/on Detec/on Alex Mawla UCD Genome Center Bioinforma5cs Core Tuesday June 16, 2015 Today s Goals Understand the applica5on and capabili5es of using targe5ng sequencing and CNV calling

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Clinical evaluation of microarray data

Clinical evaluation of microarray data Clinical evaluation of microarray data David Amor 19 th June 2011 Single base change Microarrays 3-4Mb What is a microarray? Up to 10 6 bits of Information!! Highly multiplexed FISH hybridisations. Microarray

More information

Dihydropyrimidine Dehydrogenase (DPYD) Pharmacogenetic Competency

Dihydropyrimidine Dehydrogenase (DPYD) Pharmacogenetic Competency Dihydropyrimidine Dehydrogenase (DPYD) Pharmacogenetic Competency Updated on 6/2015 Pre-test Question # 1 A patient has a reported pharmacogenetic test result of DPYD *1/*2. What is the assigned phenotype?

More information

Rhesus D: The clinical importance of molecular typing

Rhesus D: The clinical importance of molecular typing Rhesus D: The clinical importance of molecular typing Vicky Van Sandt Apr. Sarah Mahieu Rhesus: role and structure Rh proteins: important components of the RBC membrane Rh complex in RBC membrane: RhCcEe

More information

SALSA MLPA KIT P050-B2 CAH

SALSA MLPA KIT P050-B2 CAH SALSA MLPA KIT P050-B2 CAH Lot 0510, 0909, 0408: Compared to lot 0107, extra control fragments have been added at 88, 96, 100 and 105 nt. The 274 nt probe gives a higher signal in lot 0510 compared to

More information

INDIVIDUALIZED MEDICINE

INDIVIDUALIZED MEDICINE Genomics in Oncology CENTER FOR INDIVIDUALIZED MEDICINE Alan Bryce, MD American College of Osteopathic Internists October 9-13, 2013 Renaissance Esmeralda Resort and Spa, Indian Wells, CA 2012 MFMER slide-1

More information

Andrew Parrish, Richard Caswell, Garan Jones, Christopher M. Watson, Laura A. Crinnion 3,4, Sian Ellard 1,2

Andrew Parrish, Richard Caswell, Garan Jones, Christopher M. Watson, Laura A. Crinnion 3,4, Sian Ellard 1,2 METHOD ARTICLE An enhanced method for targeted next generation sequencing copy number variant detection using ExomeDepth [version 1; referees: 1 approved, 1 approved with reservations] 1 2 1 3,4 Andrew

More information

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length

More information

Core Data Set CYP2D6 Metabolism

Core Data Set CYP2D6 Metabolism Core Data Set CYP2D6 Metabolism Oxidised metabolites seen in pre-clinical species Inhibitor Target CYP Isoform CLint (µl/min/mg protein) % Inhibition Control 12.5 - Furafylline 1A2 12.9 0 Sulfaphenoxazole

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

MRC-Holland MLPA. Description version 29;

MRC-Holland MLPA. Description version 29; SALSA MLPA KIT P003-B1 MLH1/MSH2 Lot 1209, 0109. As compared to the previous lots 0307 and 1006, one MLH1 probe (exon 19) and four MSH2 probes have been replaced. In addition, one extra MSH2 exon 1 probe,

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

Original Policy Date

Original Policy Date MP 2.04.38 Genetic Testing for Helicobacter pylori Treatment Medical Policy Section Medicine Issue 12:2013 Original Policy Date 12:2013 Last Review Status/Date Reviewed with literature search/12:2013 Return

More information

Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals

Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals Bansal et al. BMC Medicine (2017) 15:213 DOI 10.1186/s12916-017-0977-3 RESEARCH ARTICLE Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals

More information

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced.

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced. mix P241-D2 MODY mix 1 Lot D2-0716, D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent

More information

Whole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis

Whole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis HMG Advance Access published December 21, 2012 Human Molecular Genetics, 2012 1 13 doi:10.1093/hmg/dds512 Whole-genome detection of disease-associated deletions or excess homozygosity in a case control

More information

CYP21A2 Mutations Found in Congenital Adrenal Hyperplasia Patients in the California Population

CYP21A2 Mutations Found in Congenital Adrenal Hyperplasia Patients in the California Population CYP21A2 Mutations Found in Congenital Adrenal Hyperplasia Patients in the California Population Christopher N. Greene, Ph.D. Newborn Screening and Molecular Biology Branch National Center for Environmental

More information

Rare Variant Burden Tests. Biostatistics 666

Rare Variant Burden Tests. Biostatistics 666 Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Technical Bulletin No. 161

Technical Bulletin No. 161 CPAL Central Pennsylvania Alliance Laboratory Technical Bulletin No. 161 cobas 6800 HIV-1 Viral Load Assay - New Platform - June 1, 2017 Contact: Heather Habig, MLS (ASCP) CM, MB CM, 717-851-1422 Operations

More information

Future applications of full length virus genome sequencing

Future applications of full length virus genome sequencing Future applications of full length virus genome sequencing Paul Kellam Virus Genomics Revisiting early HIV resistance ideas AIDS 1991 Nature 1993 Virus genome sequencing Population or single genome Whole

More information

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser

Characterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why

More information

MRC-Holland MLPA. Description version 29; 31 July 2015

MRC-Holland MLPA. Description version 29; 31 July 2015 SALSA MLPA probemix P081-C1/P082-C1 NF1 P081 Lot C1-0114. As compared to the previous B2 version (lot 0813 and 0912), 11 target probes are replaced or added, and 10 new reference probes are included. P082

More information

p.arg119gly p.arg119his p.ala179thr c.540+1g>a c.617_633+6del Prediction basis structure

p.arg119gly p.arg119his p.ala179thr c.540+1g>a c.617_633+6del Prediction basis structure a Missense ATG p.arg119gly p.arg119his p.ala179thr p.ala189val p.gly206trp p.gly206arg p.arg251his p.ala257thr TGA 5 UTR 1 2 3 4 5 6 7 3 UTR Splice Site, Frameshift b Mutation p.gly206trp p.gly4fsx50 c.138+1g>a

More information

CITATION FILE CONTENT/FORMAT

CITATION FILE CONTENT/FORMAT CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined

More information

CHROMOSOMAL MICROARRAY (CGH+SNP)

CHROMOSOMAL MICROARRAY (CGH+SNP) Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due

More information

Reporting TP53 gene analysis results in CLL

Reporting TP53 gene analysis results in CLL Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review

More information

OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES

OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES OVERVIEW OF CURRENT IDENTIFICATION SYSTEMS AND DATABASES EVERY STEP OF THE WAY 1 EVERY STEP OF THE WAY MICROBIAL IDENTIFICATION METHODS DNA RNA Genotypic Sequencing of ribosomal RNA regions of bacteria

More information

P323-B1 CDK4-HMGA2-MDM2

P323-B1 CDK4-HMGA2-MDM2 SALSA MLPA probemix P323-B1 CDK4-HMGA2-MDM2 Lot B1-0714, B1-0711. As compared to previous test version (lot A1-0508), this probemix has been completely redesigned. Probes for HMGA2 and several other genes

More information

Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group

Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,

More information

2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center

2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,

More information

SALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted.

SALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted. mix P169-C2 HIRSCHSPRUNG-1 Lot C2-0915. As compared to version C1 (lot C1-0612), the length of one has been adjusted. Hirschsprung disease (HSCR), or aganglionic megacolon, is a congenital disorder characterised

More information

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr1 13273 G C heterozygous - - -. - DDX11L1 chr1 949654 A G Homozygous 52 - - rs8997 - ISG15 chr1 1021346 A G heterozygous

More information

Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping

Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping RESEARCH ARTICLE Open Access Global assessment of genomic variation in cattle by genome resequencing and high-throughput genotyping Bujie Zhan 1, João Fadista 1, Bo Thomsen 1, Jakob Hedegaard 1,2, Frank

More information

Home Brewed Personalized Genomics

Home Brewed Personalized Genomics Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome

More information

Predict GENES. Select right drug. Select right dose. Develop new drugs. Non-Response Response Adverse Reaction

Predict GENES. Select right drug. Select right dose. Develop new drugs. Non-Response Response Adverse Reaction Predict Select right drug Select right dose Develop new drugs GENES Non-Response Response Adverse Reaction Phase I: Each Chromosome Has Many Genes Chromosome 12 ~ 1,300 Genes Examples of Personalized Medicines

More information

SLCO1B1 Pharmacogenetic Competency

SLCO1B1 Pharmacogenetic Competency SLCO1B1 Pharmacogenetic Competency Updated on 6/2015 Pre-test Question # 1 Which of the following is not currently a recognized SLCO1B1 phenotype? a) Low function b) Normal function c) Intermediate function

More information

MODULE NO.14: Y-Chromosome Testing

MODULE NO.14: Y-Chromosome Testing SUBJECT Paper No. and Title Module No. and Title Module Tag FORENSIC SIENCE PAPER No.13: DNA Forensics MODULE No.21: Y-Chromosome Testing FSC_P13_M21 TABLE OF CONTENTS 1. Learning Outcome 2. Introduction:

More information