Physiological and pathological properties of EMTassociated

Size: px
Start display at page:

Download "Physiological and pathological properties of EMTassociated"

Transcription

1 Physiological and pathological properties of EMTassociated plasticity Stéphane Ansieau Inserm UMR 1050, CNRS UMR 8256 Centre de Recherche en Cancérologie de Lyon, France

2 EMT: a reversible phenotypic and functional switch EMT Primary epithelium Loss of cell polarity Loss of cell to cell contact Cytoskeleton reorganization Disruption of the basal membrane Gain in motility / invasion Resistance to anoikis Phenotypic switch Functional consequences E Cell plasticity M External signals MET EMT is a transient, reversible, and highly regulated transdifferentiation process Secondary epithelium The phenotypic switch is associated with a profound genetic reprogramming

3 EMT: a prerequisite for both morphogenesis and organogenesis during the embryonic development First wave Second waves Cell plasticity Third waves Thiery JP et al., Cell 2009

4 EMT and wound-healing Arnoux V. et al. Rise and fall of Epithelial Phenotype: Concepts of Epithelial-Mesenchymal Transition edited by P. Savagner Eurekah. Com and Kluwer Academic / Plenum Publishers

5 Pathological EMT: the metastatic cascade initiation Polyak K & RA Weinberg, Nature Reviews 2009

6 EMT, MET & the metastatic cascade Primary tumor Secondary tumor 1 5 EMT 3 MET 2 EMT 4 EMT 6 Differentiated tumor cell Cancer cell in EMT Stromal cell Immune cell 1. Dissemination 2. Intravasation 3. Migration in the flux 4. Extravasation 5. Colonisation

7 Schematic representation of the EMT process Wnt, TGFβ, Hdg, Notch mechanical constraint, hypoxia Zeb Snail Twist Epithelial markers (E-cadherin) Attached cells Non-motile Proliferative Mesenchymal markers (N-cadherin /vimentin) Individual cells Motile and invasive (MMP) Poorly proliferative

8 A complex mirna-emt-tf interactome TGFβ Mir-200 ZEB1 Targets Diaz-Lopez A. et al. Cancer Manadgment & Res. 2014

9 EMT is regulated by four interconnected regulatory networks De Craene B. & G. Berx, Nature Reviews Cancer, 2013

10 Observation of EMT figures EMT-TF & permissive environment Protein expression analysis E M Epithelial markers E-cadherin vimentin Mesenchymal markers Acquisition of migratory properties Wound healing (scratch) assay

11 Acquisition of migratory and invasive properties (Boyden chamber) EMT features Crystal violet Chick Chorioallantoic Membrane (CAM) Assay Bio-luminescence xenografted or injected in the caudal vein

12 Experimental demonstration of the biological relevance of EMT in vivo LacZ Myc WAP Cre Mammary epithelial cells Experimental control Lox-STOP-Lox LacZ LacZ ST LacZ+ epithelial cells Cytokeratin + Fibronectin- T T: tumor ST: stroma Breast carcinoma Trimboli AJ et al. Cancer Res. 2008

13 Reversion to an epithelial phenotype is a prerequisite for the second site colonization Healthy keratenocytes Non invasive carcinoma Invasive carcinoma K5 rtta Twist1 DMBA +TPA Twist1 + Dox Twist1 (Topical Dox) EMT transiently induced (Oral Dox) Primary tumor volume control topical oral Secondary tumors Constitutive EMT Tsai JH et al., Cancer Cell 2012 temps O T O T Control Twist1

14 Schematic representation of the EMT process Wnt, TGFβ, Hdg, Notch mechanical constraint, hypoxia Zeb Snail Twist Self-renewal potential Secondary tumor formation Cancer stem cell properties Tumorigenic potential Differential potential Intratumoral heterogeneity

15 EMT associates with a gain in stem-like cell properties epithelial cells EMT (even partial) EMT-TF + Oncogene + EMT permissive environment Tumorigenic potential Stemness properties Tumor subtype WAP: KRASG12D; TWIST1 MaSC Bipotent progenitor Mesenchymal Claudin-low Basal Progenitors Differentiated cells Luminal Luminal Myoepithelial Luminal Mani et al., Cell 2008, Morel et al. PLos ONE 2008; Morel et al., PLoS Genet. 2012

16 EMT associates with a gain in stem-like cell properties Organoid-forming efficiency Competitive mammary fad pat reconstitution assay GFP SNAIL2-GFP MEC (Myoepithelial progenitors) dsred dsred - SNAIL2 + SNAIL2 Rudimentary structures Elaborated ductal tree Luminal differentiated cells - SNAIL2 + SNAIL2 GFP dsred SNAIL2/Sox9-GFP dsred SOX9 SNAIL2 + SOX9 Cooperation with endogenous stemness program Organoid-forming efficiency Guo W. et al. Cell 2012

17 EMT and chemoresistance Genotoxic or cytotoxic stress Definition of an universal EMT signature Epithelial Mesenchymal M Breast (doxorubicin + cyclophosmamide) Ovary (Platinium based Therapy) Mesenchymal Intermediate Epithelial chemoresistance chemoresistance Tan et al., EMBO Mol Med 2014 CR: complete response; PR partial response; SD stable disease; PD progressive disease

18 Gain in migratory and invasive properties Cell commitment to EMT Gain in stemness Gain in chemoresitance As easy as that?...

19 Complete EMT is dispensable for cancer cell dissemination Breast carcinomagenesis model (MMTV-PyMT) with lung metastasis Tracing experiments to follow fully EMT-committed cells (independently of their outcome) Epithelial (RFP,Red), mesenchymal (GFP,Green) No epithelial GFP+ cells in primary and secondary tumors (Same results with MMTv-Neu and vimentin-cre-ert2) Tumor-derived RFP cells Orthotopic tumors RFP+-cells Primary tumor Metastasis These few GFP cells do not contribute to lung metastasis (not detectable in lung) Few positive GFP cells No positive GFP cells

20 Removal of the primary tumor Tumor-derived RFP+ cells CTX: cyclophosmamide EMT associates with chemoresistance Enrichment in EMT cells Fischer KR et al. Nature 2015 Lineage tracing to mark carcinoma cells need to fill two criteria: - Cre/Cre-ER driver needs to be expressed in all cells that transiently undergo EMT activation - When activated the Cre/Cre-ER protein needs to activate the GFP reporter in all cells where Cre/Cre-ER cells are expressed. Fsp1 Snail1-YFP; MMTV-PyMT Vim Fsp1 Vim Snail1 + Zeb1 + Ye X et al. Nature 2017

21 Interfering with EMT plasticity pertubs its contribution to metastasis? Murine pancreatic carcinomagenesis model (activated KRAS and loss of p53 function): KPC Compare KPC with KPC Twist1 KO or with Twist1 Snail1 KO Carcinoma cell tracing with YFP. In absence of Twist/Snail, reduction of YFP+/α-SMA+ cells Similar primary tumor growth Similar local invasion Similar number of DTCs Similar metastatic potential Zheng et al. Nature 2015

22 Inhibition of EMT sensitizes KPC tumors to gentamycin Treatment with gentamycin Zheng et al. Nature α-sma is not a good EMT marker -Reduction of snail2/zeb1 following Twist/Snail depletion is very partial. Aiello NM et al. Nature Difficulty to trace EMT-committed cells: no universal marker - Not a single EMT but EMTs - A highly dynamic process, needs more flexible tools

23 Direct evidence of EMT obtained in unpertubed breast tumors All cancer cells are YFP+ Epithelial cells are blue Ecad-mCFP high (Epi) Ecad-mCFP low (partial EMT) Ecad-mGFP low Specific signature Primary tumors Ecad-mGFP low cancer cells are similar to human mesenchymal CTCs

24 Direct evidence of EMT obtained in unpertubed breast tumors Ecad-mCFP high (Epi)/ orthotopic injection Multi-photon microscopy YFP CFP Nonmigratory field YFP No difference in their ability to extravasate Shift back to an epithelial phenotype CFP Migratory field Similar self-renewal potential Finger-like projection Beerling et al., Cell Reports 2016

25 Cells partially committed to EMT display CSC properties E or M cells Adherent Mammospheres HMEC SV40/RAS Epithelial cells (E) Mesenchymal Cells (M) Mammospheres Single cell RNAseq Shift to an EM gene expression profile Epithelial signature Mesenchymal signature EM signature Breast cancers Coexpression of M and E genes predict poor outcomes Grosse-Wilde A et al., 2015

26 Integrin-β4 segregates partial to fully EMT-committed cells Fully committed to EMT Partially committed to EMT ZEB1 Bierie A et al., 2017

27 Conclusions EMT is a dynamic continuum between an epithelial and a mesenchymal phenotype The partial EMT-committed cells contribute to metastasis EMT-inducers are transiently induced and need to be studied as such. Permanently expressing or deleting them aberrantly fix the epithelial or mesenchymal phenotype.

28 Partial EMT as a driver of metastasis Epithelial cells Partially committed cells Fully committed cells Epithelial shape Epithelial shape Mesenchymal shape Associates with a collective migration rather than single cells (collective migration frequently observed in patients). A metastable phenotype? CTC clusters intra- and extravasate more efficiently than fully committed EMT CTCs and form 50x time more tumors. Coexpression of epithelial and mesenchymal markers is an hallmark of aggressive tumors. mir200 ZEB Higher tumor-initiating and stem-like properties than fully committed EMT cells. Phenotypic Stability Factors (OVOL, GRHL2) Watanabe K et al., Dev. Cell 2014; Jolly MK et al., Oncotarget 2016

29 Partial EMT reflects an underestimated level of regulation Nieto MA et al., Cell 2016

30 EMT-TFs but not only. Failsafe program inhibition (RB and p53 dependent) Modulation of differentiation programs Modification of the cell metabolism ZEB2, SNAIL2 + Differentiation Tumor per mouse WT +/- -/- Twist1 MITF rheostat - ZEB1, TWIST1 Survival Proliferation RAS + p53 KO Dose-dependent activity TSG/oncogenic properties (cell context dependent) Glycolyse induced (increased glucose uptake & macromolecule biosynthesis) Beck B. et al, Cell Stem Cell 2015;Caramel J.. et al. Cancer Cell 2013;Dong C et al. Cancer Cell 2013

31 Concomitant fail-safe program escape and EMT induction ErbB2 Twist1 ErbB2 + Twist1 Sénescence prématurée Cellules épithéliales Cellules mésenchymateuses Ansieau S et al., Cancer Cell 2008

32 Early metastatic dissemination MMTV-ErbB2 Premalignant lesions edccs Malignant progression Her2 +, Twist1 +, Ecad low, DCCs (30% Twist1 + ) (MET) Dormancy Secondary tumors Schardt JA et al. Cancer Cell 2004; Hüsemann Y et al. Cancer Cell 2008, Harper et al., Nature 2016; Hosseini et al., 2016

Cell Polarity and Cancer

Cell Polarity and Cancer Cell Polarity and Cancer Pr Jean-Paul Borg Email: jean-paul.borg@inserm.fr Features of malignant cells Steps in Malignant Progression Cell polarity, cell adhesion, morphogenesis and tumorigenesis pathways

More information

Therapeutic implications of cancer stem cells. Cédric Blanpain, MD, PhD Laboratory of stem cells and cancer WELBIO, Université Libre de Bruxelles

Therapeutic implications of cancer stem cells. Cédric Blanpain, MD, PhD Laboratory of stem cells and cancer WELBIO, Université Libre de Bruxelles Therapeutic implications of cancer stem cells Cédric Blanpain, MD, PhD Laboratory of stem cells and cancer WELBIO, Université Libre de Bruxelles Stem cell properties Differentiation Self-renewal Tumor

More information

Cancer Biology Course. Invasion and Metastasis

Cancer Biology Course. Invasion and Metastasis Cancer Biology Course Invasion and Metastasis 2016 Lu-Hai Wang NHRI Cancer metastasis Major problem: main reason for killing cancer patients, without it cancer can be cured or controlled. Challenging questions:

More information

Fundamental research on breast cancer in Belgium. Rosita Winkler

Fundamental research on breast cancer in Belgium. Rosita Winkler Fundamental research on breast cancer in Belgium Rosita Winkler Medline search for «breast cancer» and Belgium limits: english, posted in the last 5 years. Result: 484 papers - fundamental / clinical -

More information

EMT: Epithelial Mesenchimal Transition

EMT: Epithelial Mesenchimal Transition EMT: Epithelial Mesenchimal Transition A phenotypic change that is characteristic of some developing tissues and certain forms of cancer. This is a multistep, key process in embryonic development and metastasis

More information

Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D.

Tumor microenvironment Interactions and Lung Cancer Invasiveness. Pulmonary Grand Rounds Philippe Montgrain, M.D. Tumor microenvironment Interactions and Lung Cancer Invasiveness Pulmonary Grand Rounds Philippe Montgrain, M.D. February 26, 2009 Objectives Review epithelial mesenchymal transition (EMT), and its implications

More information

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%

More information

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications

1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the

More information

TITLE: Microenvironments and Signaling Pathways Regulating Early Dissemination, Dormancy, and Metastasis

TITLE: Microenvironments and Signaling Pathways Regulating Early Dissemination, Dormancy, and Metastasis AWARD NUMBER: W81XWH-14-1-0296 TITLE: Microenvironments and Signaling Pathways Regulating Early Dissemination, Dormancy, and Metastasis PRINCIPAL INVESTIGATOR: John Condeelis CONTRACTING ORGANIZATION:

More information

Concomitant Gain of Function of Notch and Loss of p53 Signalling trigger an EMT Like Programme Driving Metastatic Intestinal Cancers

Concomitant Gain of Function of Notch and Loss of p53 Signalling trigger an EMT Like Programme Driving Metastatic Intestinal Cancers 8 AVRIl 2015 8 Avril 2015 Concomitant Gain of Function of Notch and Loss of p53 Signalling trigger an EMT Like Programme Driving Metastatic Intestinal Cancers Daniel LOUVARD UMR 144 / CNRS - Institut Curie

More information

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?

1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize? 1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal

More information

Inflammatory Cells and Metastasis

Inflammatory Cells and Metastasis Inflammatory Cells and Metastasis Experimentelle Krebsforschung SS 07 Gerhard Christofori Institute of Biochemistry and Genetics Department of Clinical-Biological Sciences Center of Biomedicine University

More information

Molecular factors influencing epithelial-mesenchymal transition in breast cancer

Molecular factors influencing epithelial-mesenchymal transition in breast cancer Molecular factors influencing epithelial-mesenchymal transition in breast cancer Gisela Nilsson Department of Medical Biochemistry and Cell Biology Institute of Biomedicine Sahlgrenska Academy at University

More information

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic

More information

Enterprise Interest Nothing to declare

Enterprise Interest Nothing to declare Enterprise Interest Nothing to declare Update of mixed tumours of the GI tract, the pancreas and the liver Introduction to the concept of mixed tumours and clinical implication Jean-Yves SCOAZEC Surgical

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC

Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC Supplementary Figure 1. Characterization of NMuMG-ErbB2 and NIC breast cancer cells expressing shrnas targeting LPP. NMuMG-ErbB2 cells (a) and NIC cells (b) were engineered to stably express either a LucA-shRNA

More information

Epithelial mesenchymal plasticity in carcinoma metastasis

Epithelial mesenchymal plasticity in carcinoma metastasis REVIEW Epithelial mesenchymal plasticity in carcinoma metastasis Jeff H. Tsai 1 and Jing Yang 1,2,3 1 Department of Pharmacology, 2 Department of Pediatrics, School of Medicine, University of California

More information

Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ

Contents 1 The Windows of Susceptibility to Breast Cancer 2 The So Called Pre-Neoplastic Lesions and Carcinoma In Situ Contents 1 The Windows of Susceptibility to Breast Cancer... 1 1.1 Introduction... 1 1.2 Risk Factor and Etiological Agents... 2 1.3 The Concept of the Windows of Susceptibility to Carcinogenesis... 5

More information

Six1 expands the mouse mammary epithelial stem/progenitor cell pool and induces mammary tumors that undergo epithelialmesenchymal

Six1 expands the mouse mammary epithelial stem/progenitor cell pool and induces mammary tumors that undergo epithelialmesenchymal Related Commentary, page 2528 Research article Six1 expands the mouse mammary epithelial stem/progenitor cell pool and induces mammary tumors that undergo epithelialmesenchymal transition Erica L. McCoy,

More information

Dual reporter genetic mouse models of pancreatic cancer identify an epithelial to mesenchymal transition independent metastasis program

Dual reporter genetic mouse models of pancreatic cancer identify an epithelial to mesenchymal transition independent metastasis program Dual reporter genetic mouse models of pancreatic cancer identify an epithelial to mesenchymal transition independent metastasis program Yang Chen, Valerie S. LeBleu, Julienne L. Carstens, Hikaru Sugimoto,

More information

Does EMT Contribute to Radiation Resistance in Human Breast Cancer?

Does EMT Contribute to Radiation Resistance in Human Breast Cancer? AD Award Number: W81XWH-10-1-0592 TITLE: Does EMT Contribute to Radiation Resistance in Human Breast Cancer? PRINCIPAL INVESTIGATOR: Anupama Munshi, Ph.D CONTRACTING ORGANIZATION: University of Oklahoma

More information

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath

Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis

More information

Stability of the hybrid epithelial/mesenchymal phenotype

Stability of the hybrid epithelial/mesenchymal phenotype /, Advance Publications 2016 Stability of the hybrid epithelial/mesenchymal phenotype Mohit Kumar Jolly 1,2, Satyendra C. Tripathi 8,*, Dongya Jia 1,5,*, Steven M. Mooney 7, Muge Celiktas 8, Samir M. Hanash

More information

The Z-cad dual fluorescent sensor detects dynamic changes between the epithelial and mesenchymal cellular states

The Z-cad dual fluorescent sensor detects dynamic changes between the epithelial and mesenchymal cellular states Toneff et al. BMC Biology (2016) 14:47 DOI 10.1186/s12915-016-0269-y METHODOLOGY ARTICLE The Z-cad dual fluorescent sensor detects dynamic changes between the epithelial and mesenchymal cellular states

More information

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-

Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn- Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg

More information

The Role of EZH2 in Breast Cancer Progression and Metastasis

The Role of EZH2 in Breast Cancer Progression and Metastasis The Role of EZH2 in Breast Cancer Progression and Metastasis by Heather Marie Moore A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Cellular

More information

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz December 1, 2010 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 25 More mutations as 20 you get older

More information

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting

mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting mir-509-5p and mir-1243 increase the sensitivity to gemcitabine by inhibiting epithelial-mesenchymal transition in pancreatic cancer Hidekazu Hiramoto, M.D. 1,3, Tomoki Muramatsu, Ph.D. 1, Daisuke Ichikawa,

More information

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent

CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION. Androgen deprivation therapy is the most used treatment of de novo or recurrent CHAPTER VII CONCLUDING REMARKS AND FUTURE DIRECTION Stathmin in Prostate Cancer Development and Progression Androgen deprivation therapy is the most used treatment of de novo or recurrent metastatic PCa.

More information

CCN1: A NOVEL TARGET FOR PANCREATIC CANCER. Andrew Leask.

CCN1: A NOVEL TARGET FOR PANCREATIC CANCER. Andrew Leask. CCN1: A NOVEL TARGET FOR PANCREATIC CANCER Andrew Leask CIHR Group in Skeletal Development and Remodeling, Division of Oral Biology and Department of Physiology and Pharmacology, Schulich School of Medicine

More information

Dynamic cohesin-mediated chromatin architecture controls epithelial mesenchymal plasticity in cancer

Dynamic cohesin-mediated chromatin architecture controls epithelial mesenchymal plasticity in cancer Article Dynamic cohesin-mediated chromatin architecture controls epithelial mesenchymal plasticity in cancer Jiyeon Yun,, Sang-Hyun Song, Hwang-Phill Kim, Sae-Won Han,, Eugene C Yi & Tae-You Kim,,, Abstract

More information

Interactions between cancer stem cells and their niche govern metastatic colonization

Interactions between cancer stem cells and their niche govern metastatic colonization Correction Interactions between cancer stem cells and their niche govern metastatic colonization Ilaria Malanchi, Albert Santamaria-Martínez, Evelyn Susanto, Hong Peng, Hans-Anton Lehr, Jean-Francois Delaloye

More information

Review Article Pathways to Breast Cancer Recurrence

Review Article Pathways to Breast Cancer Recurrence Hindawi Publishing Corporation ISRN Oncology Volume 2013, Article ID 290568, 16 pages http://dx.doi.org/10.1155/2013/290568 Review Article Pathways to Breast Cancer Recurrence Aamir Ahmad Department of

More information

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications

A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications A Novel CTC-Detecting Technique Using TelomeScan and Its Clinical Applications Yasuo Urata CEO and President Oncolys BioPharma Inc. February 16, 2013 Telomere Length is a Limiting Factor for Cell Replication

More information

Ichan School of Medicine at Mount Sinai New York, NY Fort Detrick, Maryland Distribution Unlimited

Ichan School of Medicine at Mount Sinai New York, NY Fort Detrick, Maryland Distribution Unlimited AWARD NUMBER: W81XWH-14-1-0365 TITLE: Macrophage Functions in Early Dissemination and Dormancy of Breast Cancer PRINCIPAL INVESTIGATOR: Nina Linde CONTRACTING ORGANIZATION: Ichan School of Medicine at

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,100 116,000 120M Open access books available International authors and editors Downloads Our

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,800 116,000 120M Open access books available International authors and editors Downloads Our

More information

The 5th International Conference on Tumor Microenvironment: Progression, Therapy and Prevention Versailles, France, October 20 24, 2009

The 5th International Conference on Tumor Microenvironment: Progression, Therapy and Prevention Versailles, France, October 20 24, 2009 Cancer Microenvironment (2010) 3:1 5 DOI 10.1007/s12307-010-0039-2 EDITORIAL The 5th International Conference on Tumor Microenvironment: Progression, Therapy and Prevention Versailles, France, October

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

3D in vitro modelling using material from the Breast Cancer Now Tissue Bank

3D in vitro modelling using material from the Breast Cancer Now Tissue Bank @QMBCI bartscancerinstitute 3D in vitro modelling using material from the Breast Cancer Now Tissue Bank Richard Grose Barts Cancer Institute Ed Carter Normal Breast Architecture Calponin / CK8 Myoepithelial

More information

The Hallmarks of Cancer

The Hallmarks of Cancer The Hallmarks of Cancer Theresa L. Hodin, Ph.D. Clinical Research Services Theresa.Hodin@RoswellPark.org Hippocrates Cancer surgery, circa 1689 Cancer Surgery Today 1971: Nixon declares War on Cancer

More information

Stem Cells. Induced Stem Cells

Stem Cells. Induced Stem Cells Induced Stem Cells Stem Cells Mouse and human somatic cells can either be reprogrammed to a pluripotent state or converted to another lineage with a combination of transcription factors suggesting that

More information

Skin squamous cell carcinoma propagating cells increase with tumour progression and invasiveness

Skin squamous cell carcinoma propagating cells increase with tumour progression and invasiveness Manuscript EMBO-2012-83706 Skin squamous cell carcinoma propagating cells increase with tumour progression and invasiveness Gaëlle Lapouge, Benjamin Beck, Dany Nassar, Christine Dubois, Sophie Dekoninck

More information

Seeds and soil theory by Stephen Paget at the end of the XIX century.

Seeds and soil theory by Stephen Paget at the end of the XIX century. Seeds and soil theory by Stephen Paget at the end of the XIX century. In The Distribution Of Secondary Growths In Cancer Of The Breast Paget presents and analyzes 735 fatal cases of breast cancer, complete

More information

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette

More information

Rath, N., and Olson, M. (2016) Regulation of pancreatic cancer aggressiveness by stromal stiffening. Nature Medicine, 22(5), pp. 462-463. There may be differences between this version and the published

More information

Award Number: W81XWH TITLE: Characterizing an EMT Signature in Breast Cancer. PRINCIPAL INVESTIGATOR: Melanie C.

Award Number: W81XWH TITLE: Characterizing an EMT Signature in Breast Cancer. PRINCIPAL INVESTIGATOR: Melanie C. AD Award Number: W81XWH-08-1-0306 TITLE: Characterizing an EMT Signature in Breast Cancer PRINCIPAL INVESTIGATOR: Melanie C. Bocanegra CONTRACTING ORGANIZATION: Leland Stanford Junior University Stanford,

More information

Liquid Biopsy: Implications for Cancer Staging & Therapy

Liquid Biopsy: Implications for Cancer Staging & Therapy Prof. Klaus Pantel, MD, PhD Institut für Tumorbiologie Liquid Biopsy: Implications for Cancer Staging & Therapy Tumor cell dissemination and cancer dormancy Primary tumor Local relapse Cancer cells disseminate

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by

More information

Table S1: Analysis of Notch gene rearrangements in triple negative breast cancer subtypes

Table S1: Analysis of Notch gene rearrangements in triple negative breast cancer subtypes Supplemental Tables Table S1: Analysis of Notch gene rearrangements in triple negative breast cancer subtypes NOTCH1 or NOTCH2 Basal Immune Luminal AR Mesenchymal Stem Like WT 27 (87%) 24 (100%) 4 (66%)

More information

Glioblastoma Multiforme

Glioblastoma Multiforme Glioblastoma Multiforme Highly malignant, invasive, difficult-to-treat primary brain tumor" " Frequency: 9,000 cases/year (peak age, 55 65 years)" " Recurrence: rapid growth; size may double every 10 days"

More information

The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer

The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer The splicing regulation and clinical significance of epithelial splicing regulatory protein 1 in invasion and metastasis of epithelial ovarian cancer Jie Tang MD, Ph.D, Professer Vice director of Department

More information

Characterization of cell lines derived from breast cancers and normal mammary tissues for the study of the intrinsic molecular subtypes

Characterization of cell lines derived from breast cancers and normal mammary tissues for the study of the intrinsic molecular subtypes Breast Cancer Res Treat (2013) 142:237 255 DOI 10.1007/s10549-013-2743-3 PRECLINICAL STUDY Characterization of cell lines derived from breast cancers and normal mammary tissues for the study of the intrinsic

More information

SUPPLEMENTAL TEXT AND FIGURES

SUPPLEMENTAL TEXT AND FIGURES SUPPLEMENTAL TEXT AND FIGURES Prrx1 isoform switching regulates pancreatic cancer invasion and metastatic colonization Shigetsugu Takano, Maximilian Reichert, Basil Bakir, Koushik K. Das, Takahiro Nishida,

More information

Cell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue

Cell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue Cell Therapy for Diabetes: Generating Functional Islets from Human Exocrine Tissue Kevin Docherty University of Aberdeen ELRIG Drug Discovery 2016 ACC Liverpool 14 th October 2016 Autoimmune destruction

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Epithelial-Mesenchymal Transition and Cancer Stem Cells

Epithelial-Mesenchymal Transition and Cancer Stem Cells 9 Epithelial-Mesenchymal Transition and Cancer Stem Cells Gaoliang Ouyang 1,2 1 State Key Laboratory of Stress Cell Biology, School of Life Sciences, Xiamen University, Xiamen 361005, 2 Laboratory of Stem

More information

Identifying genomic signatures in circulating breast tumour cells

Identifying genomic signatures in circulating breast tumour cells Identifying genomic signatures in circulating breast tumour cells 9 th ISMRC 2013, Paris, France September 25th, 2013 NISHA KANWAR PhD Candidate Department of Laboratory Medicine and Pathobiology University

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Characteristics of Cancer Stem Cells (CSCs)

Characteristics of Cancer Stem Cells (CSCs) GENReports: Market & Tech Analysis Characteristics of Cancer Stem Cells (CSCs) > Enal Razvi, Ph.D. Biotechnology Analyst, Managing Director Select Biosciences, Inc. enal@selectbio.us! Topic,IntroducEon,and,Scope!

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AWARD NUMBER: W81XWH-13-1-0184 TITLE: In Vivo Tagging of Lung Epithelial Cells To Define the Early Steps of Tumor Cell Dissemination PRINCIPAL INVESTIGATOR: Hasmeena Kathuria, MD CONTRACTING ORGANIZATION:

More information

The Role of Tenascin-C in Metastasis Formation

The Role of Tenascin-C in Metastasis Formation Chapter 3 The Role of Tenascin-C in Metastasis Formation Metastasis occurs when tumor cells spread from the primary site and form a new tumor at a different site within the same or another organ. This

More information

MIT Student EMT variations in cancer

MIT Student EMT variations in cancer MIT Student EMT variations in cancer Epithelial mesenchymal transition is a transformative process that normal cells, as well as cancer cells, undertake, Throughout the life cycle of a tumor, the environmental

More information

MASTER EN ONCOLOGÍA MOLECULAR 2011 TGF-BETA

MASTER EN ONCOLOGÍA MOLECULAR 2011 TGF-BETA MASTER EN ONCOLOGÍA MOLECULAR 2011 TGF-BETA Joan Seoane ICREA Research Professor Vall d Hebron Institute of Oncology Vall d Hebron University Hospital Barcelona jseoane@vhio.net Glioma Stupp et al. New

More information

Disclosure of Relevant Financial Relationships. Breast Pathology Evening Specialty Conference Case #4. Clinical Case: Pathologic Features

Disclosure of Relevant Financial Relationships. Breast Pathology Evening Specialty Conference Case #4. Clinical Case: Pathologic Features Breast Pathology Evening Specialty Conference Case #4 K.P. Siziopikou, MD, PhD Professor of Pathology Director of Breast Pathology and Breast Pathology Fellowship Program Northwestern University Feinberg

More information

number Done by Corrected by Doctor Maha Shomaf

number Done by Corrected by Doctor Maha Shomaf number 21 Done by Ahmad Rawajbeh Corrected by Omar Sami Doctor Maha Shomaf Ability to Invade and Metastasize The metastatic cascade can be subdivided into two phases: 1-invasion of ECM and vascular dissemination:

More information

Mohamed Bentires-Alj

Mohamed Bentires-Alj San Antonio Breast Cancer Symposium, December 6-10, 2016 Mohamed Bentires-Alj Professor of experimental surgical oncology Department of Biomedicine University of Basel University Hospital Basel m.bentires-alj@unibas.ch

More information

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,

(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.

More information

TITLE: Microenvironments and Signaling Pathways Regulating Early Dissemination, Dormancy, and Metastasis

TITLE: Microenvironments and Signaling Pathways Regulating Early Dissemination, Dormancy, and Metastasis AWARD NUMBER: W81XWH-14-1-0296 TITLE: Microenvironments and Signaling Pathways Regulating Early Dissemination, Dormancy, and Metastasis PRINCIPAL INVESTIGATOR: John Condeelis CONTRACTING ORGANIZATION:

More information

Lab Med Breast Cancer: From Basics to Beyond. Basic Cancer Biology and Model Systems ZENA WERB. 4:30-6 pm November 1, 2010

Lab Med Breast Cancer: From Basics to Beyond. Basic Cancer Biology and Model Systems ZENA WERB. 4:30-6 pm November 1, 2010 Lab Med 180.04 Breast Cancer: From Basics to Beyond Basic Cancer Biology and Model Systems ZENA WERB 4:30-6 pm November 1, 2010 Advantages of mice as breast cancer models hlp://mammary.nih.gov/atlas/histology/

More information

Regulation of Ovarian Cancer Stem Cells or Tumor-Initiating Cells

Regulation of Ovarian Cancer Stem Cells or Tumor-Initiating Cells Int. J. Mol. Sci. 2013, 14, 6624-6648; doi:10.3390/ijms14046624 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Regulation of Ovarian Cancer Stem

More information

The Pennsylvania State University. The Graduate School of. Integrative Biosciences

The Pennsylvania State University. The Graduate School of. Integrative Biosciences The Pennsylvania State University The Graduate School of Integrative Biosciences THE REGULATION OF MESENCHYMAL AND CANCER STEM CELL PHENOTYPES IN HEPATOCELLULAR CARCINOMA A Dissertation in Molecular Medicine

More information

The Beauty of the Skin

The Beauty of the Skin The Beauty of the Skin Rose-Anne Romano, Ph.D Assistant Professor Department of Oral Biology School of Dental Medicine State University of New York at Buffalo The Big Question How do approximately 50 trillion

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

Mario Giuliano Trieste Novembre 2015

Mario Giuliano Trieste Novembre 2015 Mario Giuliano Trieste 20-21 Novembre 2015 Metastatic Cascade Main Actors A small fraction of cells detaching from primary tumors end up forming metastatic lesions. 1 0 Tumor Circulating Tumor Cells (CTCs)

More information

Mitosis. Single Nano Micro Milli Macro. Primary. PCNA expression

Mitosis. Single Nano Micro Milli Macro. Primary. PCNA expression a b c DAPI YFP CC3 DAPI YFP PCNA DAPI YFP ph3 DAPI YFP KI67 e 6 Mitosis f 1 PCNA expression %ph3 + /YFP + n= 63 87 61 3 13 8 n= 15 3 9 1 5 %PCNA+/YFP+ 8 6 Supplementary Figure 1. Proliferation/apoptosis

More information

Biochimica et Biophysica Acta

Biochimica et Biophysica Acta Biochimica et Biophysica Acta 1796 (2009) 293 308 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbacan Review Metastasis mechanisms Thomas

More information

Transcriptomic classification of genetically engineered mouse models of breast cancer identifies human subtype counterparts

Transcriptomic classification of genetically engineered mouse models of breast cancer identifies human subtype counterparts Pfefferle et al. Genome Biology 2013, 14:R125 RESEARCH Transcriptomic classification of genetically engineered mouse models of breast cancer identifies human subtype counterparts Open Access Adam D Pfefferle

More information

TMA-VARESE COHORT-1 TMA-BERN COHORT-2

TMA-VARESE COHORT-1 TMA-BERN COHORT-2 Supplementary Figure 1 TMA-VARESE COHORT-1 TOTAL SAMPLES #5 GLEASON SCORE Number Percentage 6 16 32% = 7 17 34% >7 17 34% TUMOR STAGE T2C 28 56% T3A- 21 42% T3C-T4 1 2% NODE STATUS N 42 84% N1 8 16% PSA

More information

Paracrine and Autocrine Signals Induce and Maintain Mesenchymal and Stem Cell States in the Breast

Paracrine and Autocrine Signals Induce and Maintain Mesenchymal and Stem Cell States in the Breast Paracrine and Autocrine Signals Induce and Maintain Mesenchymal and Stem Cell States in the Breast The MIT Faculty has made this article openly available. Please share how this access benefits you. Your

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge

TEB. Id4 p63 DAPI Merge. Id4 CK8 DAPI Merge a Duct TEB b Id4 p63 DAPI Merge Id4 CK8 DAPI Merge c d e Supplementary Figure 1. Identification of Id4-positive MECs and characterization of the Comma-D model. (a) IHC analysis of ID4 expression in the

More information

Quantitative Data Analysis Assignment Sample Newessays.co.uk

Quantitative Data Analysis Assignment Sample Newessays.co.uk Absorbance Quantitative Data Analysis Assignment Sample Newessays.co.uk Part A: Results of the Study Is there a difference of curve profile between the MTT assay and the cell number? What do the different

More information

Antithetical NFATc1-Sox2 and p53-mir200 signaling networks govern pancreatic cancer cell plasticity

Antithetical NFATc1-Sox2 and p53-mir200 signaling networks govern pancreatic cancer cell plasticity The EMBO Journal Peer Review Process File - EMBO-2014-89574 Manuscript EMBO-2014-89574 Antithetical NFATc1-Sox2 and p53-mir200 signaling networks govern pancreatic cancer cell plasticity Shiv K. Singh,

More information

Pancreatic cancer cell invasion: mesenchymal switch or just hitchhiking?

Pancreatic cancer cell invasion: mesenchymal switch or just hitchhiking? Editorial Pancreatic cancer cell : mesenchymal switch or just hitchhiking? Rémi Samain, Christine Jean, Corinne Bousquet INSERM U1037, Cancer Research Center of Toulouse, University Toulouse III Paul Sabatier,

More information

Breast cancer as a systemic disease: a view of metastasis

Breast cancer as a systemic disease: a view of metastasis Review Click here for more articles from the symposium doi: 10.1111/joim.12084 Breast cancer as a systemic disease: a view of metastasis A. J. Redig 1 & S. S. McAllister 1,2,3 From the 1 Division of Hematology,

More information

!!! Oncology for Scientists (RPN 530) Metastasis and Angiogenesis Chapter 13 and 14 Oct. 28 th 2014

!!! Oncology for Scientists (RPN 530) Metastasis and Angiogenesis Chapter 13 and 14 Oct. 28 th 2014 Oncology for Scientists (RPN 530) Metastasis and Angiogenesis Chapter 13 and 14 Oct. 28 th 2014 Department of Cancer Genetics Masashi Muramatsu, Ph.D. About Exam First, think and understand the concepts.

More information

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013

Cancer and Oncogenes Bioscience in the 21 st Century. Linda Lowe-Krentz October 11, 2013 Cancer and Oncogenes Bioscience in the 21 st Century Linda Lowe-Krentz October 11, 2013 Just a Few Numbers Becoming Cancer Genetic Defects Drugs Our friends and family 200 180 160 140 120 100 80 60 40

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Finite-element analysis of cell cluster dynamics in different cluster trap architectures. (a) Cluster-Chip (b) Filter (c) A structure identical to the Cluster-Chip except that one

More information

Fibroblasts and Cancer Cells: Allies and Foes in the Tumor Wound Andrei Turtoi, PhD

Fibroblasts and Cancer Cells: Allies and Foes in the Tumor Wound Andrei Turtoi, PhD Fibroblasts and Cancer Cells: Allies and Foes in the Tumor Wound Andrei Turtoi, PhD Tumor Microenvironment and Resistance to Treatment Lab, IRCM, France Institut de Recherche en Cancérologie de Montpellier

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

University Journal of Pre and Para Clinical Sciences

University Journal of Pre and Para Clinical Sciences ISSN 2455 2879 Volume 2 Issue 1 2016 Metaplastic carcinoma breast a rare case report Abstract : Metaplastic carcinoma of the breast is a rare malignancy with two distinct cell lines described as a breast

More information

What I Learned from 3 Cases and 3 Antibodies

What I Learned from 3 Cases and 3 Antibodies What I Learned from 3 Cases and 3 Antibodies Melinda Sanders, M.D Vanderbilt University Medical Center Professor of Pathology Consultant in Breast Pathology Disclosure of Relevant Financial Relationships

More information

Can we prevent metastasis?

Can we prevent metastasis? Can we prevent metastasis? A research example to translate from the bench to the bedside Diane Palmieri, Ph.D. Women s Cancers Section Laboratory of Molecular Pharmacology CCR, NCI Some Basic Truths Most

More information

Therapeutic implications of cellular and molecular biology of cancer stem cells in melanoma

Therapeutic implications of cellular and molecular biology of cancer stem cells in melanoma Kumar et al. Molecular Cancer (2017) 16:7 DOI 10.1186/s12943-016-0578-3 REVIEW Therapeutic implications of cellular and molecular biology of cancer stem cells in melanoma Dhiraj Kumar 1, Mahadeo Gorain

More information

Supplement 8: Candidate age-related genes and pathways

Supplement 8: Candidate age-related genes and pathways Supplement 8: Candidate age-related genes and pathways Function Untreated cohort (cohort 1) Treated cohort (cohort 2) Genes Gene sets Effect of age Effect of age FDR of 2 nd Effect of age adjusted Effect

More information

Computational Systems Biology: Biology X

Computational Systems Biology: Biology X Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#5:(October-18-2010) Cancer and Signals Outline 1 2 Outline 1 2 Cancer is a disease of malfunctioning cells. Cell Lineage: Adult

More information