The Challenges of Genes, Gene Expression and Genomics
|
|
- Heather Arnold
- 5 years ago
- Views:
Transcription
1 The Challenges of Genes, Gene Expression and Genomics Scott A. Ness Molecular Genetics & Microbiology University of New Mexico HSC Albuquerque, NM
2 Genes and Gene Products Chromosome: Gene: Spliced mrna: Encoded Protein: Functional Activity: Enzymes, hormones, structural proteins, oncogenes, etc.
3 Chromosome: Genes and Gene Products Mutation Gene: Spliced mrna: Encoded Protein: Activated Oncogene Functional Activity: Enzymes, hormones, structural proteins, oncogenes, etc. e.g. p53, ras, myb
4 Results of the Human Genome Project Humans have at least 50,000 genes Genes encode functional RNAs, proteins Many genes encode multiple products At least 200,000 different gene products Genetic Differences = Diversity At least 1,000 allelic differences per person
5 Genomics I: Measuring Differences in Gene Expression Profiles Different cell types (e.g. liver vs. kidney, normal vs. tumor) express different genes Gene expression patterns can distinguish between different cell or tumor types (classification) Differences in gene expression can identify novel targets for drug development
6 Comparison of Gene Expression Profiles Cells or Tissue e.g. Normal vs. Tumor Purify RNAs, label with fluorescent tags Hybridize to microarray, detect fluorescence
7 Affymetrix GeneChip GeneChip Probe Array 1.28cm Human Genome Array > 50,000 genes > 1,200,000 features
8 Genomics Research at UNM SOM Human Genomics Cancer Biology Novel Targets, Diagnostic Tools Asthma, Diabetes, Drug Screening, Schizophrenia Epidemiology Risk Detection and Prediction Genomics in Animal Models Stroke, Neurological Studies, Toxicology Microbial Genomics DNA Repair and Mutagenesis Cell Cycle Control, Gene Regulation Biosensor, Antibiotic, Diagnostics Development Hantavirus Biology Host-Pathogen Interactions (Cystic Fibrosis)
9 Example: Lymphoma Gene Profiling - Willman Lab 392 Genes 142 Patients
10 Gene Expression in PKD Samples Under-expressed in disease samples
11 Gene Expression in PKD Samples Over-expressed in disease samples
12 Vertebrates Express Three Myb Transcription Factors c-myb A-Myb B-Myb Highly Conserved Central Trans- Negative DNA Binding Activation Domain Domain Regulatory Domain
13 Myb Proteins Affect Development B-Myb c-myb A-Myb blastocyst embryo adult offspring B-Myb knockout blocks cell proliferation c-myb knockout blocks definitive hematopoiesis A-Myb knockout affects testis, mammary gland development
14 Myb Proteins are Transcription Factors Target Genes Myb Proteins Regulate Differentiation Regulate Apoptosis Regulate Proliferation Myb Proteins Control Cell Fate by Regulating the Expression of Other Genes
15 c-myb Expression in Hematopoiesis Hematopoietic Stem Cell Myeloid/Erythroid Stem Cell Lymphoid Stem Cell c-myb CFU-E CFU-Meg CFU-Bas CFU-Eosin CFU-GM Pre-B Pre-T Erythrocyte Megakaryocyte Basophil Eosinophil Neutrophil Monocyte B-Cell T-Cell
16 c-myb Expression in Hematopoiesis Hematopoietic Stem Cell Myeloid/Erythroid Stem Cell Lymphoid Stem Cell v-myb CFU-E CFU-Meg CFU-Bas CFU-Eosin CFU-GM Pre-B Pre-T Erythrocyte Megakaryocyte Basophil Eosinophil Neutrophil Monocyte B-Cell T-Cell
17 v-myb Induces Myeloid Leukemias Normal Chicken Blood v-myb-induced Leukemia
18 Myb Protein Comparisons A-, B- and c-myb proteins have distinct expression patterns A-Myb: specialized epithelial, hematopoietic cells B-Myb: all dividing cells c-myb: immature hematopoietic, epithelial v-myb: oncogenic, induces leukemia Each protein has a unique biological activity All the Myb proteins have similar structures
19 Test the Activities of Myb Proteins on Endogenous Human Genes Myb Expression Vector Recombinant Adenoviruses Use Affymetrix GeneChips to measure changes in endogenous gene expression Human Cells
20 MCF-7: Mammary Epithelial Cells Estrogen-responsive mammary carcinoma cells Common model for estrogen-responsive breast cancer Express A-Myb, B-Myb and c-myb during cell cycle, in response to estrogen
21 Adenovirus Expression Vectors c-myb A-Myb B-Myb MybEng c-myb DNA Binding Domain Engrailed Repressor Domain
22 Filtering Microarray Data to Identify Myb Regulated Genes Affymetrix U95A, U95B, U95C, U95D, U95E arrays 60,000 genes 100 % Filter for genes expressed above background 18,063 genes 30 % Filter for genes induced or repressed >2.5X 215 genes 3.5 %
23 ... Selected Gene Tree: Combined 215 smooth Colored by: MCF7 expressed genes Default Interpretation Gene List: Combined 2.5X up or down (320) 215 Myb Regulated Genes in MCF-7 Each Myb Protein Regulates a Different Set of Genes Uninf Cont A-Myb B-Myb c-myb MybEng Genes Repressed by A-Myb Genes activated by c-myb Genes activated by A-Myb Genes activated by B-Myb
24 Comparison of Myb Gene Activation in MCF-7 A-Myb Activated (119) B-Myb Activated (100) c-myb Activated (43) Genes activated 2.5X in independent replicate assays. More than 12,000 genes tested on U95A GeneChips.
25 Activation of Hep27 and DSIPI Legend Hep27 DSIPI Uninf Control c-myb MybEng Amyb Bmyb Affymetrix GeneChip Data
26 Myb Binding Sites in the Hep27 and DSIPI Gene Promoters Hep27 Promoter NFIL6 Myb Ets Ets Myb DSIPI Promoter YY1 Myb YY1 SP1
27 Swap Domains Between c-myb and A-Myb Conserved Restriction Sites A-Myb CHA AHC c-myb DNA Binding Domain Transcriptional Activation Domain
28 Selected Gene Tree: AC 30 genes >2.5X >2500 A-Myb or c-myb PEARSON Colored by: AC Swap Comparison Default Interpretation Gene List: AC 2.5X up >2500 A-Myb or c-myb (30) _at Homo sapiens cdna FLJ _s_at HEP _at LCP _s_at H1FX _at PP _at KRT _s_at SSAT _at SERPINA _at STHM _x_at MGC2479, FLJ21046, dj _at HEM _at HEM _s_at ASS1, CTLN _at MEH, EPHX _s_at PBP _at IGFBP _s_at CLLP _x_at MT1H _x_at MT _x_at MT _x_at MT _x_at GSPT _x_at MT _s_at FLJ _at CSD, CDB1, CSD1, CSD2, _s_at Homo sapiens cdna FLJ _s_at DRAL, SLIM _s_at RAB _s_at DIP, GILZ, TSC-22R _at EPAS1 A-Myb and c-myb Specificity in Human Cells Ø A CHA AHC C Activated by A- Myb and c-myb Activated by the c-myb transactivation domain Specific for the A-Myb DNA binding domain
29 A-Myb and c-myb Deletions A-Myb AP AB AN c-myb CCA CB CN
30 Domains that Affect Gene Activation Required for Required for activation of activation of Hep27 TGFBI A AP AB AN C CA CB CN Must Must be be removed removed to activate to activate DSIPI TGFBI Northern Blots The ability to activate many genes is determined by the C-terminal domains of c-myb and A-Myb Hep27 TGFBI α-catenin DSIPI
31 Structure of the Human c-myb Gene 1A 8A 9A 9B 10A 13A DBD TAD NRD Alternative splicing can yield > 64 different c-myb mrnas Myb proteins with alternative C-termini are likely to have different specificities and to activate different genes
32 Alternative c-myb Gene Exons Expressed in Normal Cells Exons 8A, 9A, 9B, 10A and 13A are all detected
33 Alternative c-myb Gene Exons in Leukemia Samples Leukemias Express Additional c-myb Transcripts
34 c-myb Alternative Splice Products c-myb +Exon 8A +Exon 9A +Exon 9B +Exon 10A +Exon 13A Alternative C-termini = Alternative Activities
35 Compare the Effects of Myb Proteins in Different Cell Types Myb-Expressing Adenoviruses Do Myb proteins activate the same genes in different cell types?
36 75 Myb Regulated Genes in Lung Epithelial Cells A-Myb 31 genes B-Myb 28 genes c-myb 55 genes Genes activated 2.5X in independent replicate assays. More than 12,000 genes tested on U95A GeneChips.
37 339 Myb Regulated Genes in Lung Fibroblast Cells A-Myb 225 genes B-Myb 142 genes c-myb 170 genes Genes activated 2.5X in independent replicate assays. More than 12,000 genes tested on U95A GeneChips.
38 Myb Activities are Context-Specific MCF-7 A-Myb LE MCF-7 B-Myb LE MCF-7 c-myb LE LF LF LF Almost no overlap in Myb activated genes in different cell types
39 Unique Activities in Each Cell Type MCF genes LE 75 genes Three Myb proteins, three cell types, little overlap amongst activated genes LF 339 genes
40 MSI1 Gene Activation 7 Legend 6 A-Myb B-Myb c-myb Fold Activation MCF-7 Lung Epith Lung Fibro
41 TGFBI Gene Activation 4.5 Legend A-Myb B-Myb c-myb Fold Activation MCF-7 Lung Epith Lung Fibro
42 HSPA6 Gene Activation 90 Legend A-Myb B-Myb c-myb Fold Activation MCF-7 Lung Epith Lung Fibro
43 IL8 Gene Activation 60 Legend 50 A-Myb B-Myb c-myb Fold Activation MCF-7 Lung Epith Lung Fibro
44 B-Myb Gene Activation Legend A-Myb B-Myb c-myb Fold Activation MCF-7 Lung Epith Lung Fibro
45 Mechanisms that Could Alter the Specificity of Myb Proteins Tissue-Specific Combinatorial Interactions Different cell types have different cooperating factors Myb proteins cooperate with other transcription factors Unique domains in Myb protein interact with different factors A Myb B X C Myb X
46 Mechanisms that Could Alter the Specificity of Myb Proteins Tissue-Specific Combinatorial Interactions Different cell types have different cooperating factors Myb proteins cooperate with other transcription factors Unique domains in Myb protein interact with different factors Context-Specific Post-Translational Modifications Myb proteins are modified at numerous sites Different cell types have different modifying enzymes Modifications may alter Myb activity or promote specific interactions
47 Myb Proteins are Subject to Multiple Modifications c-myb A-Myb B-Myb X X X X X X X X X X Myb proteins are modified by X*-ylation Do Differences in Modifications Alter Interactions with Cellular Co-Factors? X* Insert your favorite modification here
48 Multiple Modifications of c-myb CKII Pim-1 CDK6 MAPK c-myb p300/cbp
49 Context-Specific Modifications A Gene 1 Myb B Gene 1 Gene 2 Gene 2 Myb
50 Mutations Unmask the Oncogenic Potential of c-myb c-myb v-myb N-Terminal Deletion Point Mutations Contribute to Transforming Activity C-Terminal Deletion Removes Negative Regulatory Domain AMV v-myb is a mutated, oncogenic version of c-myb
51 The v-myb Mutations Could Deregulate c-myb Repressed c-myb v-myb + C-Terminal Deletion Removes Negative Regulatory Domain
52 Structures of A-Myb, c-myb and v-myb A-Myb CHA AHC c-myb MutMyb v-myb AMV v-myb is a mutated, oncogenic version of c-myb
53 Test the Activities of Myb Proteins on Endogenous Human Genes Myb Expression Vector Recombinant Adenoviruses Use Affymetrix GeneChips to measure changes in endogenous gene expression Human Cells
54 Selected Gene Tree: ACV36 std Colored by: ACV Myb U133A Feb 03 Default Interpretation Gene List: ACV 36 genes up 2.5X >2500 in A,C,v or MutMyb (36) _at Homo sapiens cdna FLJ _s_at HEP _at PP _at KRT _at SERPINA _at STHM _s_at SSAT _s_at H1FX _x_at MGC2479, FLJ21046, dj _at HEM _at HEM _s_at ASS1, CTLN _at MEH, EPHX _s_at FLJ _s_at PBP _at IGFBP _x_at MT1H _x_at MT _x_at MT _x_at MT _at CSD, CDB1, CSD1, CSD2, C _x_at MT _x_at GSPT _s_at DRAL, SLIM _s_at DIP, GILZ, TSC-22R _s_at RAB _s_at Homo sapiens cdna FLJ _at EPAS _s_at CLLP _s_at EHM _at MEMD, CD _at LCP _at KIAA _s_at _s_at _s_at HSP105A, KIAA0201, NY-CO- Comparing A-Myb, c-myb, v-myb Ø A CHA AHC C Mut V The DBD mutations do not affect some genes The v-myb DBD mutations affect a subset of the c-myb regulated genes The activity of v-myb is the most unique Some genes are preferentially activated by MutMyb or v-myb
55 Unique Specificity of v-myb Con C Mut V A AHC CHA Minor differences in Myb proteins cause dramatic changes in gene expression DSIPI TGFBI Hep27 actin Northern Blot
56 The v-myb Protein Has a Unique Transcriptional Activity c-myb MutMyb v-myb The mutations in v-myb make it qualitatively different from c-myb
57 Ness Lab: Adenoviruses, Genomics: Hematopoiesis, Lentiviruses: My Backyard John Rushton Wanli Lei Fan Liu Lisa Davis John O Rourke Pim-1 Activity: Louise Winn (Queen s U., Kingston) Collaborators: Achim Leutz, Berlin Kathy Weston, London Anton Berns, Netherlands Tim Bender, Virginia Scott A. Ness Molecular Genetics & Microbiology University of New Mexico HSC Albuquerque, NM USA
ABS04. ~ Inaugural Applied Bayesian Statistics School EXPRESSION
ABS04-2004 Applied Bayesian Statistics School STATISTICS & GENE EXPRESSION GENOMICS: METHODS AND COMPUTATIONS Mike West Duke University Centro Congressi Panorama, Trento,, Italy 15th-19th 19th June 2004
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationFayth K. Yoshimura, Ph.D. September 7, of 7 RETROVIRUSES. 2. HTLV-II causes hairy T-cell leukemia
1 of 7 I. Diseases Caused by Retroviruses RETROVIRUSES A. Human retroviruses that cause cancers 1. HTLV-I causes adult T-cell leukemia and tropical spastic paraparesis 2. HTLV-II causes hairy T-cell leukemia
More informationCANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)
CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions
More informationIntroduction to Cancer Biology
Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.
More informationChapter 4 Cellular Oncogenes ~ 4.6 -
Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of
More informationAlternative RNA Splicing Produces Multiple Forms of c-myb with Unique Transcriptional Activities
MOLECULAR AND CELLULAR BIOLOGY, Mar. 2008, p. 2091 2101 Vol. 28, No. 6 0270-7306/08/$08.00 0 doi:10.1128/mcb.01870-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Alternative
More informationDeregulation of signal transduction and cell cycle in Cancer
Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationStudying Alternative Splicing
Studying Alternative Splicing Meelis Kull PhD student in the University of Tartu supervisor: Jaak Vilo CS Theory Days Rõuge 27 Overview Alternative splicing Its biological function Studying splicing Technology
More informationBIT 120. Copy of Cancer/HIV Lecture
BIT 120 Copy of Cancer/HIV Lecture Cancer DEFINITION Any abnormal growth of cells that has malignant potential i.e.. Leukemia Uncontrolled mitosis in WBC Genetic disease caused by an accumulation of mutations
More informationThe functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein
THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of
More informationBiochemistry of Carcinogenesis. Lecture # 35 Alexander N. Koval
Biochemistry of Carcinogenesis Lecture # 35 Alexander N. Koval What is Cancer? The term "cancer" refers to a group of diseases in which cells grow and spread unrestrained throughout the body. It is difficult
More informationLESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2
For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationA Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples
A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples Sona Pekova, MD., PhD. Chambon Ltd., Laboratory for molecular diagnostics, Prague, Czech
More informationBIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
More informationTITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer
AD Award Number: W81XWH-04-1-0325 TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer PRINCIPAL INVESTIGATOR: Valerie Boka CONTRACTING ORGANIZATION: University of Texas Health Science
More informationoncogenes-and- tumour-suppressor-genes)
Special topics in tumor biochemistry oncogenes-and- tumour-suppressor-genes) Speaker: Prof. Jiunn-Jye Chuu E-Mail: jjchuu@mail.stust.edu.tw Genetic Basis of Cancer Cancer-causing mutations Disease of aging
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationProfiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
More informationDISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS
DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS James Clinton, Ph.D. Scientist, ATCC February 19, 2015 About ATCC Founded in 1925, ATCC is a non-profit
More informationSeptember 20, Submitted electronically to: Cc: To Whom It May Concern:
History Study (NOT-HL-12-147), p. 1 September 20, 2012 Re: Request for Information (RFI): Building a National Resource to Study Myelodysplastic Syndromes (MDS) The MDS Cohort Natural History Study (NOT-HL-12-147).
More informationMyelodysplastic syndrome (MDS) & Myeloproliferative neoplasms
Myelodysplastic syndrome (MDS) & Myeloproliferative neoplasms Myelodysplastic syndrome (MDS) A multipotent stem cell that can differentiate into any of the myeloid lineage cells (RBCs, granulocytes, megakaryocytes)
More informationTARGETS OF CYCLIN D1-CDK
TARGETS OF CYCLIN D1-CDK FIRST TARGET OF THE COMPLEX CYCLIN D-KINASI: prb, IS THE PRODUCT OF THE GENE CONFERRING SUSCEPTIBILITY TO RETINOBLASTOMA - ABSENT OR MUTATED IN SEVERAL HUMAN CANCERS - TRANSCRIPTIONL
More informationChapter 11 Gene Expression
Chapter 11 Gene Expression 11-1 Control of Gene Expression Gene Expression- the activation of a gene to form a protein -a gene is on or expressed when it is transcribed. -cells do not always need to produce
More informationGetting to the root of Cancer
Cancer Stem Cells: Getting to the root of Cancer Dominique Bonnet, Ph.D Senior Group Leader, Haematopoietic Stem Cell Laboratory Cancer Research UK, London Research Institute Venice, Sept 2009 Overview
More informationCh. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
More informationVIRUSES AND CANCER Michael Lea
VIRUSES AND CANCER 2010 Michael Lea VIRAL ONCOLOGY - LECTURE OUTLINE 1. Historical Review 2. Viruses Associated with Cancer 3. RNA Tumor Viruses 4. DNA Tumor Viruses HISTORICAL REVIEW Historical Review
More informationComputational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project
Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Introduction RNA splicing is a critical step in eukaryotic gene
More informationGenome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department
Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause
More informationWhat causes cancer? Physical factors (radiation, ionization) Chemical factors (carcinogens) Biological factors (virus, bacteria, parasite)
Oncogenes What causes cancer? Chemical factors (carcinogens) Physical factors (radiation, ionization) Biological factors (virus, bacteria, parasite) DNA Mutation or damage Oncogenes Tumor suppressor genes
More informationEinführung in die Genetik
Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de
More informationFayth K. Yoshimura, Ph.D. September 7, of 7 HIV - BASIC PROPERTIES
1 of 7 I. Viral Origin. A. Retrovirus - animal lentiviruses. HIV - BASIC PROPERTIES 1. HIV is a member of the Retrovirus family and more specifically it is a member of the Lentivirus genus of this family.
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationHematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne
Hematopoiesis BHS Liège 27/1/2012 Dr Sonet Anne UCL Mont-Godinne Hematopoiesis: definition = all the phenomenons to produce blood cells Leukocytes = White Blood Cells Polynuclear = Granulocytes Platelet
More informationControl shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE
a Control shrna#9 shrna#12 c Control shrna#9 shrna#12 e Control shrna#9 shrna#12 h 14 12 CFU-E BFU-E GEMM GM b Colony number 7 6 5 4 3 2 1 6 pm A pa pc CFU-E BFU-E GEMM GM pu pgm A p pg B d f CD11b-APC
More informationGeneral Biology 1004 Chapter 11 Lecture Handout, Summer 2005 Dr. Frisby
Slide 1 CHAPTER 11 Gene Regulation PowerPoint Lecture Slides for Essential Biology, Second Edition & Essential Biology with Physiology Presentation prepared by Chris C. Romero Neil Campbell, Jane Reece,
More informationCancer. October is National Breast Cancer Awareness Month
Cancer October is National Breast Cancer Awareness Month Objectives 1: Gene regulation Explain how cells in all the different parts of your body develop such different characteristics and functions. Contrast
More informationEarly cell death (FGF) B No RunX transcription factor produced Yes No differentiation
Solution Key - Practice Questions Question 1 a) A recent publication has shown that the fat stem cells (FSC) can act as bone stem cells to repair cavities in the skull, when transplanted into immuno-compromised
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationDifferentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell
Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Wenxin Li Department of Biological Sciences Fordham University Abstract MEFV is a human gene that codes for an
More informationThe lymphoma-associated NPM-ALK oncogene elicits a p16ink4a/prb-dependent tumor-suppressive pathway. Blood Jun 16;117(24):
DNA Sequencing Publications Standard Sequencing 1 Carro MS et al. DEK Expression is controlled by E2F and deregulated in diverse tumor types. Cell Cycle. 2006 Jun;5(11) 2 Lassandro L et al. The DNA sequence
More informationMultistep nature of cancer development. Cancer genes
Multistep nature of cancer development Phenotypic progression loss of control over cell growth/death (neoplasm) invasiveness (carcinoma) distal spread (metastatic tumor) Genetic progression multiple genetic
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationSupplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.
Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding
More informationc-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis
Research article c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis Shenghao Jin, Huiwu Zhao, Yan Yi, Yuji Nakata, Anna Kalota, and Alan M.
More informationMolecular Pathology of Ovarian Carcinoma with Morphological Correlation
Molecular athology of Ovarian Carcinoma with Morphological Correlation Kathleen R. Cho, M.D. Comprehensive Cancer Center and Departments of athology and Internal Medicine University of Michigan Medical
More informationChapter 11 How Genes Are Controlled
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Copyright 2009 Pearson Education, Inc. Lecture by Mary
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationADx Bone Marrow Report. Patient Information Referring Physician Specimen Information
ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS
More informationEukaryotic Gene Regulation
Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,
More informationDetermination Differentiation. determinated precursor specialized cell
Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:
More informationEarly Embryonic Development
Early Embryonic Development Maternal effect gene products set the stage by controlling the expression of the first embryonic genes. 1. Transcription factors 2. Receptors 3. Regulatory proteins Maternal
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationProblem Set 5 KEY
2006 7.012 Problem Set 5 KEY ** Due before 5 PM on THURSDAY, November 9, 2006. ** Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying the development
More informationAllergy and Immunology Review Corner: Chapter 1 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti.
Allergy and Immunology Review Corner: Chapter 1 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti. Chapter 1: Overview of Immunology Prepared by David Scott, MD, Scripps
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
More informationMicroRNA in Cancer Karen Dybkær 2013
MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
More informationMicroRNA-29a Reveals Oncogenic Role on Myeloid Malignancies by Regulating DNMT3A
MicroRNA-29a Reveals Oncogenic Role on Myeloid Malignancies by Regulating DNMT3A Heba Alkhatabi, PhD Assistant Professor Department of Medical Laboratory Collage of Applied Medical science King Abdul Aziz
More informationSupplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.
prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent
More informationHoward Temin. Predicted RSV converted its genome into DNA to become part of host chromosome; later discovered reverse transciptase.
Howard Temin Predicted RSV converted its genome into DNA to become part of host chromosome; later discovered reverse transciptase Nobel prize 1975 Figure 3.6 The Biology of Cancer ( Garland Science 2007)
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationCourse Title Form Hours subject
Course Title Form Hours subject Types, and structure of chromosomes L 1 Histology Karyotyping and staining of human chromosomes L 2 Histology Chromosomal anomalies L 2 Histology Sex chromosomes L 1 Histology
More informationSC-L-H shared(37) Specific (1)
A. Brain (total 2) Tissue-specific (2) Brain-heart shared (8) Specific (2) CNS-heart shared(68) Specific () Heart (total 4) Tissue-specific () B-L-H shared (37) specific () B. Brain (total 2) Tissue-specific
More informationCancer Genetics. What is Cancer? Cancer Classification. Medical Genetics. Uncontrolled growth of cells. Not all tumors are cancerous
Session8 Medical Genetics Cancer Genetics J avad Jamshidi F a s a U n i v e r s i t y o f M e d i c a l S c i e n c e s, N o v e m b e r 2 0 1 7 What is Cancer? Uncontrolled growth of cells Not all tumors
More informationnumber Done by Corrected by Doctor Maha Shomaf
number 19 Done by Waseem Abo-Obeida Corrected by Abdullah Zreiqat Doctor Maha Shomaf Carcinogenesis: the molecular basis of cancer. Non-lethal genetic damage lies at the heart of carcinogenesis and leads
More informationStem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.
Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem
More informationGene expression analysis. Roadmap. Microarray technology: how it work Applications: what can we do with it Preprocessing: Classification Clustering
Gene expression analysis Roadmap Microarray technology: how it work Applications: what can we do with it Preprocessing: Image processing Data normalization Classification Clustering Biclustering 1 Gene
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationDetermination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection
Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Melissa Mihelidakis May 6, 2004 7.340 Research Proposal Introduction Apoptosis, or programmed cell
More informationChapter 5. Generation of lymphocyte antigen receptors
Chapter 5 Generation of lymphocyte antigen receptors Structural variation in Ig constant regions Isotype: different class of Ig Heavy-chain C regions are encoded in separate genes Initially, only two of
More informationMyeloproliferative Disorders - D Savage - 9 Jan 2002
Disease Usual phenotype acute leukemia precursor chronic leukemia low grade lymphoma myeloma differentiated Total WBC > 60 leukemoid reaction acute leukemia Blast Pro Myel Meta Band Seg Lymph 0 0 0 2
More informationNature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
More informationAlternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6
Alternative splicing Biosciences 741: Genomics Fall, 2013 Week 6 Function(s) of RNA splicing Splicing of introns must be completed before nuclear RNAs can be exported to the cytoplasm. This led to early
More informationNature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
More informationLeukemias and Lymphomas Come From Normal Blood Cells
Leukemias and Lymphomas Come From Normal Blood Cells by Steve Anderson, Ph.D. Steve Anderson has a Ph.D. in Immunology with 25 years experience in biomedical research. His scientific expertise includes
More informationSupplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well
Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in
More informationThe Immune System. A macrophage. ! Functions of the Immune System. ! Types of Immune Responses. ! Organization of the Immune System
The Immune System! Functions of the Immune System! Types of Immune Responses! Organization of the Immune System! Innate Defense Mechanisms! Acquired Defense Mechanisms! Applied Immunology A macrophage
More informationActivation of cellular proto-oncogenes to oncogenes. How was active Ras identified?
Dominant Acting Oncogenes Eugene E. Marcantonio, M.D. Ph.D. Oncogenes are altered forms of normal cellular genes called proto-oncogenes that are involved in pathways regulating cell growth, differentiation,
More informationGene Regulation - 4. One view of the Lactose Operon
Gene Regulation - 1 Regulating Genes We have been discussing the structure of DNA and that the information stored in DNA is used to direct protein synthesis. We've studied how RNA molecules are used to
More informationBreast Cancer and Biotechnology Jacquie L. Bay, Jo K. Perry and Peter E. Lobie
LENScience Senior Biology Seminar Series Breast Cancer and Biotechnology Jacquie L. Bay, Jo K. Perry and Peter E. Lobie Breast Cancer Each year in New Zealand, approximately 2,400 women and 20 men are
More informationHIV-1 Tat second exon limits the extent of Tat-mediated modulation. of interferon-stimulated genes in antigen presenting cells.
HIV-1 Tat second exon limits the extent of Tat-mediated modulation of interferon-stimulated genes in antigen presenting cells The Harvard community has made this article openly available. Please share
More information7.012 Quiz 3 Answers
MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84
More informationGeneration of antibody diversity October 18, Ram Savan
Generation of antibody diversity October 18, 2016 Ram Savan savanram@uw.edu 441 Lecture #10 Slide 1 of 30 Three lectures on antigen receptors Part 1 : Structural features of the BCR and TCR Janeway Chapter
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
More informationCRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies
CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed
More informationOncogenes and Tumor. supressors
Oncogenes and Tumor supressors From history to therapeutics Serge ROCHE Neoplastic transformation TUMOR SURESSOR ONCOGENE ONCOGENES History 1911 1960 1980 2001 Transforming retrovirus RSV v-src is an oncogene
More informationBIOL2005 WORKSHEET 2008
BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationRecombinant Protein Expression Retroviral system
Recombinant Protein Expression Retroviral system Viruses Contains genome DNA or RNA Genome encased in a protein coat or capsid. Some viruses have membrane covering protein coat enveloped virus Ø Essential
More informationIPA Advanced Training Course
IPA Advanced Training Course October 2013 Academia sinica Gene (Kuan Wen Chen) IPA Certified Analyst Agenda I. Data Upload and How to Run a Core Analysis II. Functional Interpretation in IPA Hands-on Exercises
More informationCancer and Gene Alterations - 1
Cancer and Gene Alterations - 1 Cancer and Gene Alteration As we know, cancer is a disease of unregulated cell growth. Although we looked at some of the features of cancer when we discussed mitosis checkpoints,
More informationA. Incorrect! All the cells have the same set of genes. (D)Because different types of cells have different types of transcriptional factors.
Genetics - Problem Drill 21: Cytogenetics and Chromosomal Mutation No. 1 of 10 1. Why do some cells express one set of genes while other cells express a different set of genes during development? (A) Because
More informationMutations. Any change in DNA sequence is called a mutation.
Mutations Mutations Any change in DNA sequence is called a mutation. Mutations can be caused by errors in replication, transcription, cell division, or by external agents. Mutations Mutations can be harmful.
More informationMRC-Holland MLPA. Description version 19;
SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL
More information