The Challenges of Genes, Gene Expression and Genomics

Size: px
Start display at page:

Download "The Challenges of Genes, Gene Expression and Genomics"

Transcription

1 The Challenges of Genes, Gene Expression and Genomics Scott A. Ness Molecular Genetics & Microbiology University of New Mexico HSC Albuquerque, NM

2 Genes and Gene Products Chromosome: Gene: Spliced mrna: Encoded Protein: Functional Activity: Enzymes, hormones, structural proteins, oncogenes, etc.

3 Chromosome: Genes and Gene Products Mutation Gene: Spliced mrna: Encoded Protein: Activated Oncogene Functional Activity: Enzymes, hormones, structural proteins, oncogenes, etc. e.g. p53, ras, myb

4 Results of the Human Genome Project Humans have at least 50,000 genes Genes encode functional RNAs, proteins Many genes encode multiple products At least 200,000 different gene products Genetic Differences = Diversity At least 1,000 allelic differences per person

5 Genomics I: Measuring Differences in Gene Expression Profiles Different cell types (e.g. liver vs. kidney, normal vs. tumor) express different genes Gene expression patterns can distinguish between different cell or tumor types (classification) Differences in gene expression can identify novel targets for drug development

6 Comparison of Gene Expression Profiles Cells or Tissue e.g. Normal vs. Tumor Purify RNAs, label with fluorescent tags Hybridize to microarray, detect fluorescence

7 Affymetrix GeneChip GeneChip Probe Array 1.28cm Human Genome Array > 50,000 genes > 1,200,000 features

8 Genomics Research at UNM SOM Human Genomics Cancer Biology Novel Targets, Diagnostic Tools Asthma, Diabetes, Drug Screening, Schizophrenia Epidemiology Risk Detection and Prediction Genomics in Animal Models Stroke, Neurological Studies, Toxicology Microbial Genomics DNA Repair and Mutagenesis Cell Cycle Control, Gene Regulation Biosensor, Antibiotic, Diagnostics Development Hantavirus Biology Host-Pathogen Interactions (Cystic Fibrosis)

9 Example: Lymphoma Gene Profiling - Willman Lab 392 Genes 142 Patients

10 Gene Expression in PKD Samples Under-expressed in disease samples

11 Gene Expression in PKD Samples Over-expressed in disease samples

12 Vertebrates Express Three Myb Transcription Factors c-myb A-Myb B-Myb Highly Conserved Central Trans- Negative DNA Binding Activation Domain Domain Regulatory Domain

13 Myb Proteins Affect Development B-Myb c-myb A-Myb blastocyst embryo adult offspring B-Myb knockout blocks cell proliferation c-myb knockout blocks definitive hematopoiesis A-Myb knockout affects testis, mammary gland development

14 Myb Proteins are Transcription Factors Target Genes Myb Proteins Regulate Differentiation Regulate Apoptosis Regulate Proliferation Myb Proteins Control Cell Fate by Regulating the Expression of Other Genes

15 c-myb Expression in Hematopoiesis Hematopoietic Stem Cell Myeloid/Erythroid Stem Cell Lymphoid Stem Cell c-myb CFU-E CFU-Meg CFU-Bas CFU-Eosin CFU-GM Pre-B Pre-T Erythrocyte Megakaryocyte Basophil Eosinophil Neutrophil Monocyte B-Cell T-Cell

16 c-myb Expression in Hematopoiesis Hematopoietic Stem Cell Myeloid/Erythroid Stem Cell Lymphoid Stem Cell v-myb CFU-E CFU-Meg CFU-Bas CFU-Eosin CFU-GM Pre-B Pre-T Erythrocyte Megakaryocyte Basophil Eosinophil Neutrophil Monocyte B-Cell T-Cell

17 v-myb Induces Myeloid Leukemias Normal Chicken Blood v-myb-induced Leukemia

18 Myb Protein Comparisons A-, B- and c-myb proteins have distinct expression patterns A-Myb: specialized epithelial, hematopoietic cells B-Myb: all dividing cells c-myb: immature hematopoietic, epithelial v-myb: oncogenic, induces leukemia Each protein has a unique biological activity All the Myb proteins have similar structures

19 Test the Activities of Myb Proteins on Endogenous Human Genes Myb Expression Vector Recombinant Adenoviruses Use Affymetrix GeneChips to measure changes in endogenous gene expression Human Cells

20 MCF-7: Mammary Epithelial Cells Estrogen-responsive mammary carcinoma cells Common model for estrogen-responsive breast cancer Express A-Myb, B-Myb and c-myb during cell cycle, in response to estrogen

21 Adenovirus Expression Vectors c-myb A-Myb B-Myb MybEng c-myb DNA Binding Domain Engrailed Repressor Domain

22 Filtering Microarray Data to Identify Myb Regulated Genes Affymetrix U95A, U95B, U95C, U95D, U95E arrays 60,000 genes 100 % Filter for genes expressed above background 18,063 genes 30 % Filter for genes induced or repressed >2.5X 215 genes 3.5 %

23 ... Selected Gene Tree: Combined 215 smooth Colored by: MCF7 expressed genes Default Interpretation Gene List: Combined 2.5X up or down (320) 215 Myb Regulated Genes in MCF-7 Each Myb Protein Regulates a Different Set of Genes Uninf Cont A-Myb B-Myb c-myb MybEng Genes Repressed by A-Myb Genes activated by c-myb Genes activated by A-Myb Genes activated by B-Myb

24 Comparison of Myb Gene Activation in MCF-7 A-Myb Activated (119) B-Myb Activated (100) c-myb Activated (43) Genes activated 2.5X in independent replicate assays. More than 12,000 genes tested on U95A GeneChips.

25 Activation of Hep27 and DSIPI Legend Hep27 DSIPI Uninf Control c-myb MybEng Amyb Bmyb Affymetrix GeneChip Data

26 Myb Binding Sites in the Hep27 and DSIPI Gene Promoters Hep27 Promoter NFIL6 Myb Ets Ets Myb DSIPI Promoter YY1 Myb YY1 SP1

27 Swap Domains Between c-myb and A-Myb Conserved Restriction Sites A-Myb CHA AHC c-myb DNA Binding Domain Transcriptional Activation Domain

28 Selected Gene Tree: AC 30 genes >2.5X >2500 A-Myb or c-myb PEARSON Colored by: AC Swap Comparison Default Interpretation Gene List: AC 2.5X up >2500 A-Myb or c-myb (30) _at Homo sapiens cdna FLJ _s_at HEP _at LCP _s_at H1FX _at PP _at KRT _s_at SSAT _at SERPINA _at STHM _x_at MGC2479, FLJ21046, dj _at HEM _at HEM _s_at ASS1, CTLN _at MEH, EPHX _s_at PBP _at IGFBP _s_at CLLP _x_at MT1H _x_at MT _x_at MT _x_at MT _x_at GSPT _x_at MT _s_at FLJ _at CSD, CDB1, CSD1, CSD2, _s_at Homo sapiens cdna FLJ _s_at DRAL, SLIM _s_at RAB _s_at DIP, GILZ, TSC-22R _at EPAS1 A-Myb and c-myb Specificity in Human Cells Ø A CHA AHC C Activated by A- Myb and c-myb Activated by the c-myb transactivation domain Specific for the A-Myb DNA binding domain

29 A-Myb and c-myb Deletions A-Myb AP AB AN c-myb CCA CB CN

30 Domains that Affect Gene Activation Required for Required for activation of activation of Hep27 TGFBI A AP AB AN C CA CB CN Must Must be be removed removed to activate to activate DSIPI TGFBI Northern Blots The ability to activate many genes is determined by the C-terminal domains of c-myb and A-Myb Hep27 TGFBI α-catenin DSIPI

31 Structure of the Human c-myb Gene 1A 8A 9A 9B 10A 13A DBD TAD NRD Alternative splicing can yield > 64 different c-myb mrnas Myb proteins with alternative C-termini are likely to have different specificities and to activate different genes

32 Alternative c-myb Gene Exons Expressed in Normal Cells Exons 8A, 9A, 9B, 10A and 13A are all detected

33 Alternative c-myb Gene Exons in Leukemia Samples Leukemias Express Additional c-myb Transcripts

34 c-myb Alternative Splice Products c-myb +Exon 8A +Exon 9A +Exon 9B +Exon 10A +Exon 13A Alternative C-termini = Alternative Activities

35 Compare the Effects of Myb Proteins in Different Cell Types Myb-Expressing Adenoviruses Do Myb proteins activate the same genes in different cell types?

36 75 Myb Regulated Genes in Lung Epithelial Cells A-Myb 31 genes B-Myb 28 genes c-myb 55 genes Genes activated 2.5X in independent replicate assays. More than 12,000 genes tested on U95A GeneChips.

37 339 Myb Regulated Genes in Lung Fibroblast Cells A-Myb 225 genes B-Myb 142 genes c-myb 170 genes Genes activated 2.5X in independent replicate assays. More than 12,000 genes tested on U95A GeneChips.

38 Myb Activities are Context-Specific MCF-7 A-Myb LE MCF-7 B-Myb LE MCF-7 c-myb LE LF LF LF Almost no overlap in Myb activated genes in different cell types

39 Unique Activities in Each Cell Type MCF genes LE 75 genes Three Myb proteins, three cell types, little overlap amongst activated genes LF 339 genes

40 MSI1 Gene Activation 7 Legend 6 A-Myb B-Myb c-myb Fold Activation MCF-7 Lung Epith Lung Fibro

41 TGFBI Gene Activation 4.5 Legend A-Myb B-Myb c-myb Fold Activation MCF-7 Lung Epith Lung Fibro

42 HSPA6 Gene Activation 90 Legend A-Myb B-Myb c-myb Fold Activation MCF-7 Lung Epith Lung Fibro

43 IL8 Gene Activation 60 Legend 50 A-Myb B-Myb c-myb Fold Activation MCF-7 Lung Epith Lung Fibro

44 B-Myb Gene Activation Legend A-Myb B-Myb c-myb Fold Activation MCF-7 Lung Epith Lung Fibro

45 Mechanisms that Could Alter the Specificity of Myb Proteins Tissue-Specific Combinatorial Interactions Different cell types have different cooperating factors Myb proteins cooperate with other transcription factors Unique domains in Myb protein interact with different factors A Myb B X C Myb X

46 Mechanisms that Could Alter the Specificity of Myb Proteins Tissue-Specific Combinatorial Interactions Different cell types have different cooperating factors Myb proteins cooperate with other transcription factors Unique domains in Myb protein interact with different factors Context-Specific Post-Translational Modifications Myb proteins are modified at numerous sites Different cell types have different modifying enzymes Modifications may alter Myb activity or promote specific interactions

47 Myb Proteins are Subject to Multiple Modifications c-myb A-Myb B-Myb X X X X X X X X X X Myb proteins are modified by X*-ylation Do Differences in Modifications Alter Interactions with Cellular Co-Factors? X* Insert your favorite modification here

48 Multiple Modifications of c-myb CKII Pim-1 CDK6 MAPK c-myb p300/cbp

49 Context-Specific Modifications A Gene 1 Myb B Gene 1 Gene 2 Gene 2 Myb

50 Mutations Unmask the Oncogenic Potential of c-myb c-myb v-myb N-Terminal Deletion Point Mutations Contribute to Transforming Activity C-Terminal Deletion Removes Negative Regulatory Domain AMV v-myb is a mutated, oncogenic version of c-myb

51 The v-myb Mutations Could Deregulate c-myb Repressed c-myb v-myb + C-Terminal Deletion Removes Negative Regulatory Domain

52 Structures of A-Myb, c-myb and v-myb A-Myb CHA AHC c-myb MutMyb v-myb AMV v-myb is a mutated, oncogenic version of c-myb

53 Test the Activities of Myb Proteins on Endogenous Human Genes Myb Expression Vector Recombinant Adenoviruses Use Affymetrix GeneChips to measure changes in endogenous gene expression Human Cells

54 Selected Gene Tree: ACV36 std Colored by: ACV Myb U133A Feb 03 Default Interpretation Gene List: ACV 36 genes up 2.5X >2500 in A,C,v or MutMyb (36) _at Homo sapiens cdna FLJ _s_at HEP _at PP _at KRT _at SERPINA _at STHM _s_at SSAT _s_at H1FX _x_at MGC2479, FLJ21046, dj _at HEM _at HEM _s_at ASS1, CTLN _at MEH, EPHX _s_at FLJ _s_at PBP _at IGFBP _x_at MT1H _x_at MT _x_at MT _x_at MT _at CSD, CDB1, CSD1, CSD2, C _x_at MT _x_at GSPT _s_at DRAL, SLIM _s_at DIP, GILZ, TSC-22R _s_at RAB _s_at Homo sapiens cdna FLJ _at EPAS _s_at CLLP _s_at EHM _at MEMD, CD _at LCP _at KIAA _s_at _s_at _s_at HSP105A, KIAA0201, NY-CO- Comparing A-Myb, c-myb, v-myb Ø A CHA AHC C Mut V The DBD mutations do not affect some genes The v-myb DBD mutations affect a subset of the c-myb regulated genes The activity of v-myb is the most unique Some genes are preferentially activated by MutMyb or v-myb

55 Unique Specificity of v-myb Con C Mut V A AHC CHA Minor differences in Myb proteins cause dramatic changes in gene expression DSIPI TGFBI Hep27 actin Northern Blot

56 The v-myb Protein Has a Unique Transcriptional Activity c-myb MutMyb v-myb The mutations in v-myb make it qualitatively different from c-myb

57 Ness Lab: Adenoviruses, Genomics: Hematopoiesis, Lentiviruses: My Backyard John Rushton Wanli Lei Fan Liu Lisa Davis John O Rourke Pim-1 Activity: Louise Winn (Queen s U., Kingston) Collaborators: Achim Leutz, Berlin Kathy Weston, London Anton Berns, Netherlands Tim Bender, Virginia Scott A. Ness Molecular Genetics & Microbiology University of New Mexico HSC Albuquerque, NM USA

ABS04. ~ Inaugural Applied Bayesian Statistics School EXPRESSION

ABS04. ~ Inaugural Applied Bayesian Statistics School EXPRESSION ABS04-2004 Applied Bayesian Statistics School STATISTICS & GENE EXPRESSION GENOMICS: METHODS AND COMPUTATIONS Mike West Duke University Centro Congressi Panorama, Trento,, Italy 15th-19th 19th June 2004

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

The Biology and Genetics of Cells and Organisms The Biology of Cancer

The Biology and Genetics of Cells and Organisms The Biology of Cancer The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried

More information

Fayth K. Yoshimura, Ph.D. September 7, of 7 RETROVIRUSES. 2. HTLV-II causes hairy T-cell leukemia

Fayth K. Yoshimura, Ph.D. September 7, of 7 RETROVIRUSES. 2. HTLV-II causes hairy T-cell leukemia 1 of 7 I. Diseases Caused by Retroviruses RETROVIRUSES A. Human retroviruses that cause cancers 1. HTLV-I causes adult T-cell leukemia and tropical spastic paraparesis 2. HTLV-II causes hairy T-cell leukemia

More information

CANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)

CANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease) CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions

More information

Introduction to Cancer Biology

Introduction to Cancer Biology Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.

More information

Chapter 4 Cellular Oncogenes ~ 4.6 -

Chapter 4 Cellular Oncogenes ~ 4.6 - Chapter 4 Cellular Oncogenes - 4.2 ~ 4.6 - Many retroviruses carrying oncogenes have been found in chickens and mice However, attempts undertaken during the 1970s to isolate viruses from most types of

More information

Alternative RNA Splicing Produces Multiple Forms of c-myb with Unique Transcriptional Activities

Alternative RNA Splicing Produces Multiple Forms of c-myb with Unique Transcriptional Activities MOLECULAR AND CELLULAR BIOLOGY, Mar. 2008, p. 2091 2101 Vol. 28, No. 6 0270-7306/08/$08.00 0 doi:10.1128/mcb.01870-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Alternative

More information

Deregulation of signal transduction and cell cycle in Cancer

Deregulation of signal transduction and cell cycle in Cancer Deregulation of signal transduction and cell cycle in Cancer Tuangporn Suthiphongchai, Ph.D. Department of Biochemistry Faculty of Science, Mahidol University Email: tuangporn.sut@mahidol.ac.th Room Pr324

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

Studying Alternative Splicing

Studying Alternative Splicing Studying Alternative Splicing Meelis Kull PhD student in the University of Tartu supervisor: Jaak Vilo CS Theory Days Rõuge 27 Overview Alternative splicing Its biological function Studying splicing Technology

More information

BIT 120. Copy of Cancer/HIV Lecture

BIT 120. Copy of Cancer/HIV Lecture BIT 120 Copy of Cancer/HIV Lecture Cancer DEFINITION Any abnormal growth of cells that has malignant potential i.e.. Leukemia Uncontrolled mitosis in WBC Genetic disease caused by an accumulation of mutations

More information

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein

The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein THESIS BOOK The functional investigation of the interaction between TATA-associated factor 3 (TAF3) and p53 protein Orsolya Buzás-Bereczki Supervisors: Dr. Éva Bálint Dr. Imre Miklós Boros University of

More information

Biochemistry of Carcinogenesis. Lecture # 35 Alexander N. Koval

Biochemistry of Carcinogenesis. Lecture # 35 Alexander N. Koval Biochemistry of Carcinogenesis Lecture # 35 Alexander N. Koval What is Cancer? The term "cancer" refers to a group of diseases in which cells grow and spread unrestrained throughout the body. It is difficult

More information

LESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2

LESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2 For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?

More information

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation

Cancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated

More information

mirna Dr. S Hosseini-Asl

mirna Dr. S Hosseini-Asl mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples

A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples A Comprehensive Study of TP53 Mutations in Chronic Lymphocytic Leukemia: Analysis of 1,287 Diagnostic CLL Samples Sona Pekova, MD., PhD. Chambon Ltd., Laboratory for molecular diagnostics, Prague, Czech

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.

More information

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer

TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer AD Award Number: W81XWH-04-1-0325 TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer PRINCIPAL INVESTIGATOR: Valerie Boka CONTRACTING ORGANIZATION: University of Texas Health Science

More information

oncogenes-and- tumour-suppressor-genes)

oncogenes-and- tumour-suppressor-genes) Special topics in tumor biochemistry oncogenes-and- tumour-suppressor-genes) Speaker: Prof. Jiunn-Jye Chuu E-Mail: jjchuu@mail.stust.edu.tw Genetic Basis of Cancer Cancer-causing mutations Disease of aging

More information

Introduction to Genetics

Introduction to Genetics Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist

More information

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola

Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the

More information

DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS

DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS DISCOVERING ATCC IMMUNOLOGICAL CELLS - MODEL SYSTEMS TO STUDY THE IMMUNE AND CARDIOVASCULAR SYSTEMS James Clinton, Ph.D. Scientist, ATCC February 19, 2015 About ATCC Founded in 1925, ATCC is a non-profit

More information

September 20, Submitted electronically to: Cc: To Whom It May Concern:

September 20, Submitted electronically to: Cc: To Whom It May Concern: History Study (NOT-HL-12-147), p. 1 September 20, 2012 Re: Request for Information (RFI): Building a National Resource to Study Myelodysplastic Syndromes (MDS) The MDS Cohort Natural History Study (NOT-HL-12-147).

More information

Myelodysplastic syndrome (MDS) & Myeloproliferative neoplasms

Myelodysplastic syndrome (MDS) & Myeloproliferative neoplasms Myelodysplastic syndrome (MDS) & Myeloproliferative neoplasms Myelodysplastic syndrome (MDS) A multipotent stem cell that can differentiate into any of the myeloid lineage cells (RBCs, granulocytes, megakaryocytes)

More information

TARGETS OF CYCLIN D1-CDK

TARGETS OF CYCLIN D1-CDK TARGETS OF CYCLIN D1-CDK FIRST TARGET OF THE COMPLEX CYCLIN D-KINASI: prb, IS THE PRODUCT OF THE GENE CONFERRING SUSCEPTIBILITY TO RETINOBLASTOMA - ABSENT OR MUTATED IN SEVERAL HUMAN CANCERS - TRANSCRIPTIONL

More information

Chapter 11 Gene Expression

Chapter 11 Gene Expression Chapter 11 Gene Expression 11-1 Control of Gene Expression Gene Expression- the activation of a gene to form a protein -a gene is on or expressed when it is transcribed. -cells do not always need to produce

More information

Getting to the root of Cancer

Getting to the root of Cancer Cancer Stem Cells: Getting to the root of Cancer Dominique Bonnet, Ph.D Senior Group Leader, Haematopoietic Stem Cell Laboratory Cancer Research UK, London Research Institute Venice, Sept 2009 Overview

More information

Ch. 18 Regulation of Gene Expression

Ch. 18 Regulation of Gene Expression Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate

More information

VIRUSES AND CANCER Michael Lea

VIRUSES AND CANCER Michael Lea VIRUSES AND CANCER 2010 Michael Lea VIRAL ONCOLOGY - LECTURE OUTLINE 1. Historical Review 2. Viruses Associated with Cancer 3. RNA Tumor Viruses 4. DNA Tumor Viruses HISTORICAL REVIEW Historical Review

More information

Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project

Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Introduction RNA splicing is a critical step in eukaryotic gene

More information

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department

Genome of Hepatitis B Virus. VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Genome of Hepatitis B Virus VIRAL ONCOGENE Dr. Yahwardiah Siregar, PhD Dr. Sry Suryani Widjaja, Mkes Biochemistry Department Proto Oncogen and Oncogen Oncogen Proteins that possess the ability to cause

More information

What causes cancer? Physical factors (radiation, ionization) Chemical factors (carcinogens) Biological factors (virus, bacteria, parasite)

What causes cancer? Physical factors (radiation, ionization) Chemical factors (carcinogens) Biological factors (virus, bacteria, parasite) Oncogenes What causes cancer? Chemical factors (carcinogens) Physical factors (radiation, ionization) Biological factors (virus, bacteria, parasite) DNA Mutation or damage Oncogenes Tumor suppressor genes

More information

Einführung in die Genetik

Einführung in die Genetik Einführung in die Genetik Prof. Dr. Kay Schneitz (EBio Pflanzen) http://plantdev.bio.wzw.tum.de schneitz@wzw.tum.de Prof. Dr. Claus Schwechheimer (PlaSysBiol) http://wzw.tum.de/sysbiol claus.schwechheimer@wzw.tum.de

More information

Fayth K. Yoshimura, Ph.D. September 7, of 7 HIV - BASIC PROPERTIES

Fayth K. Yoshimura, Ph.D. September 7, of 7 HIV - BASIC PROPERTIES 1 of 7 I. Viral Origin. A. Retrovirus - animal lentiviruses. HIV - BASIC PROPERTIES 1. HIV is a member of the Retrovirus family and more specifically it is a member of the Lentivirus genus of this family.

More information

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing

More information

Hematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne

Hematopoiesis. BHS Liège 27/1/2012. Dr Sonet Anne UCL Mont-Godinne Hematopoiesis BHS Liège 27/1/2012 Dr Sonet Anne UCL Mont-Godinne Hematopoiesis: definition = all the phenomenons to produce blood cells Leukocytes = White Blood Cells Polynuclear = Granulocytes Platelet

More information

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE

Control shrna#9 shrna#12. shrna#12 CD14-PE CD14-PE a Control shrna#9 shrna#12 c Control shrna#9 shrna#12 e Control shrna#9 shrna#12 h 14 12 CFU-E BFU-E GEMM GM b Colony number 7 6 5 4 3 2 1 6 pm A pa pc CFU-E BFU-E GEMM GM pu pgm A p pg B d f CD11b-APC

More information

General Biology 1004 Chapter 11 Lecture Handout, Summer 2005 Dr. Frisby

General Biology 1004 Chapter 11 Lecture Handout, Summer 2005 Dr. Frisby Slide 1 CHAPTER 11 Gene Regulation PowerPoint Lecture Slides for Essential Biology, Second Edition & Essential Biology with Physiology Presentation prepared by Chris C. Romero Neil Campbell, Jane Reece,

More information

Cancer. October is National Breast Cancer Awareness Month

Cancer. October is National Breast Cancer Awareness Month Cancer October is National Breast Cancer Awareness Month Objectives 1: Gene regulation Explain how cells in all the different parts of your body develop such different characteristics and functions. Contrast

More information

Early cell death (FGF) B No RunX transcription factor produced Yes No differentiation

Early cell death (FGF) B No RunX transcription factor produced Yes No differentiation Solution Key - Practice Questions Question 1 a) A recent publication has shown that the fat stem cells (FSC) can act as bone stem cells to repair cavities in the skull, when transplanted into immuno-compromised

More information

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data

Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing

More information

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6. Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,

More information

Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell

Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Wenxin Li Department of Biological Sciences Fordham University Abstract MEFV is a human gene that codes for an

More information

The lymphoma-associated NPM-ALK oncogene elicits a p16ink4a/prb-dependent tumor-suppressive pathway. Blood Jun 16;117(24):

The lymphoma-associated NPM-ALK oncogene elicits a p16ink4a/prb-dependent tumor-suppressive pathway. Blood Jun 16;117(24): DNA Sequencing Publications Standard Sequencing 1 Carro MS et al. DEK Expression is controlled by E2F and deregulated in diverse tumor types. Cell Cycle. 2006 Jun;5(11) 2 Lassandro L et al. The DNA sequence

More information

Multistep nature of cancer development. Cancer genes

Multistep nature of cancer development. Cancer genes Multistep nature of cancer development Phenotypic progression loss of control over cell growth/death (neoplasm) invasiveness (carcinoma) distal spread (metastatic tumor) Genetic progression multiple genetic

More information

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017 Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of

More information

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A.

Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Supplementary Figure 1. Genotyping strategies for Mcm3 +/+, Mcm3 +/Lox and Mcm3 +/- mice and luciferase activity in Mcm3 +/Lox mice. A. Upper part, three-primer PCR strategy at the Mcm3 locus yielding

More information

c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis

c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis Research article c-myb binds MLL through menin in human leukemia cells and is an important driver of MLL-associated leukemogenesis Shenghao Jin, Huiwu Zhao, Yan Yi, Yuji Nakata, Anna Kalota, and Alan M.

More information

Molecular Pathology of Ovarian Carcinoma with Morphological Correlation

Molecular Pathology of Ovarian Carcinoma with Morphological Correlation Molecular athology of Ovarian Carcinoma with Morphological Correlation Kathleen R. Cho, M.D. Comprehensive Cancer Center and Departments of athology and Internal Medicine University of Michigan Medical

More information

Chapter 11 How Genes Are Controlled

Chapter 11 How Genes Are Controlled Chapter 11 How Genes Are Controlled PowerPoint Lectures for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Copyright 2009 Pearson Education, Inc. Lecture by Mary

More information

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015 Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a

More information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information

ADx Bone Marrow Report. Patient Information Referring Physician Specimen Information ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS

More information

Eukaryotic Gene Regulation

Eukaryotic Gene Regulation Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,

More information

Determination Differentiation. determinated precursor specialized cell

Determination Differentiation. determinated precursor specialized cell Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:

More information

Early Embryonic Development

Early Embryonic Development Early Embryonic Development Maternal effect gene products set the stage by controlling the expression of the first embryonic genes. 1. Transcription factors 2. Receptors 3. Regulatory proteins Maternal

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

Problem Set 5 KEY

Problem Set 5 KEY 2006 7.012 Problem Set 5 KEY ** Due before 5 PM on THURSDAY, November 9, 2006. ** Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying the development

More information

Allergy and Immunology Review Corner: Chapter 1 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti.

Allergy and Immunology Review Corner: Chapter 1 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti. Allergy and Immunology Review Corner: Chapter 1 of Immunology IV: Clinical Applications in Health and Disease, by Joseph A. Bellanti. Chapter 1: Overview of Immunology Prepared by David Scott, MD, Scripps

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue

More information

MicroRNA in Cancer Karen Dybkær 2013

MicroRNA in Cancer Karen Dybkær 2013 MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear

More information

MicroRNA-29a Reveals Oncogenic Role on Myeloid Malignancies by Regulating DNMT3A

MicroRNA-29a Reveals Oncogenic Role on Myeloid Malignancies by Regulating DNMT3A MicroRNA-29a Reveals Oncogenic Role on Myeloid Malignancies by Regulating DNMT3A Heba Alkhatabi, PhD Assistant Professor Department of Medical Laboratory Collage of Applied Medical science King Abdul Aziz

More information

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein. prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent

More information

Howard Temin. Predicted RSV converted its genome into DNA to become part of host chromosome; later discovered reverse transciptase.

Howard Temin. Predicted RSV converted its genome into DNA to become part of host chromosome; later discovered reverse transciptase. Howard Temin Predicted RSV converted its genome into DNA to become part of host chromosome; later discovered reverse transciptase Nobel prize 1975 Figure 3.6 The Biology of Cancer ( Garland Science 2007)

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.

Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence. Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin

More information

Course Title Form Hours subject

Course Title Form Hours subject Course Title Form Hours subject Types, and structure of chromosomes L 1 Histology Karyotyping and staining of human chromosomes L 2 Histology Chromosomal anomalies L 2 Histology Sex chromosomes L 1 Histology

More information

SC-L-H shared(37) Specific (1)

SC-L-H shared(37) Specific (1) A. Brain (total 2) Tissue-specific (2) Brain-heart shared (8) Specific (2) CNS-heart shared(68) Specific () Heart (total 4) Tissue-specific () B-L-H shared (37) specific () B. Brain (total 2) Tissue-specific

More information

Cancer Genetics. What is Cancer? Cancer Classification. Medical Genetics. Uncontrolled growth of cells. Not all tumors are cancerous

Cancer Genetics. What is Cancer? Cancer Classification. Medical Genetics. Uncontrolled growth of cells. Not all tumors are cancerous Session8 Medical Genetics Cancer Genetics J avad Jamshidi F a s a U n i v e r s i t y o f M e d i c a l S c i e n c e s, N o v e m b e r 2 0 1 7 What is Cancer? Uncontrolled growth of cells Not all tumors

More information

number Done by Corrected by Doctor Maha Shomaf

number Done by Corrected by Doctor Maha Shomaf number 19 Done by Waseem Abo-Obeida Corrected by Abdullah Zreiqat Doctor Maha Shomaf Carcinogenesis: the molecular basis of cancer. Non-lethal genetic damage lies at the heart of carcinogenesis and leads

More information

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research.

Stem cells: units of development and regeneration. Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research. Stem cells: units of development and regeneration Fernando D. Camargo Ph.D. Whitehead Fellow Whitehead Institute for Biomedical Research Concepts 1. Embryonic vs. adult stem cells 2. Hematopoietic stem

More information

Gene expression analysis. Roadmap. Microarray technology: how it work Applications: what can we do with it Preprocessing: Classification Clustering

Gene expression analysis. Roadmap. Microarray technology: how it work Applications: what can we do with it Preprocessing: Classification Clustering Gene expression analysis Roadmap Microarray technology: how it work Applications: what can we do with it Preprocessing: Image processing Data normalization Classification Clustering Biclustering 1 Gene

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection

Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Determination of the temporal pattern and importance of BALF1 expression in Epstein-Barr viral infection Melissa Mihelidakis May 6, 2004 7.340 Research Proposal Introduction Apoptosis, or programmed cell

More information

Chapter 5. Generation of lymphocyte antigen receptors

Chapter 5. Generation of lymphocyte antigen receptors Chapter 5 Generation of lymphocyte antigen receptors Structural variation in Ig constant regions Isotype: different class of Ig Heavy-chain C regions are encoded in separate genes Initially, only two of

More information

Myeloproliferative Disorders - D Savage - 9 Jan 2002

Myeloproliferative Disorders - D Savage - 9 Jan 2002 Disease Usual phenotype acute leukemia precursor chronic leukemia low grade lymphoma myeloma differentiated Total WBC > 60 leukemoid reaction acute leukemia Blast Pro Myel Meta Band Seg Lymph 0 0 0 2

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.

Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells. Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized

More information

Alternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6

Alternative splicing. Biosciences 741: Genomics Fall, 2013 Week 6 Alternative splicing Biosciences 741: Genomics Fall, 2013 Week 6 Function(s) of RNA splicing Splicing of introns must be completed before nuclear RNAs can be exported to the cytoplasm. This led to early

More information

Nature Immunology: doi: /ni.3412

Nature Immunology: doi: /ni.3412 Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell

More information

Leukemias and Lymphomas Come From Normal Blood Cells

Leukemias and Lymphomas Come From Normal Blood Cells Leukemias and Lymphomas Come From Normal Blood Cells by Steve Anderson, Ph.D. Steve Anderson has a Ph.D. in Immunology with 25 years experience in biomedical research. His scientific expertise includes

More information

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well

Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well Supplementary Figure 1: High-throughput profiling of survival after exposure to - radiation. (a) Cells were plated in at least 7 wells in a 384-well plate at cell densities ranging from 25-225 cells in

More information

The Immune System. A macrophage. ! Functions of the Immune System. ! Types of Immune Responses. ! Organization of the Immune System

The Immune System. A macrophage. ! Functions of the Immune System. ! Types of Immune Responses. ! Organization of the Immune System The Immune System! Functions of the Immune System! Types of Immune Responses! Organization of the Immune System! Innate Defense Mechanisms! Acquired Defense Mechanisms! Applied Immunology A macrophage

More information

Activation of cellular proto-oncogenes to oncogenes. How was active Ras identified?

Activation of cellular proto-oncogenes to oncogenes. How was active Ras identified? Dominant Acting Oncogenes Eugene E. Marcantonio, M.D. Ph.D. Oncogenes are altered forms of normal cellular genes called proto-oncogenes that are involved in pathways regulating cell growth, differentiation,

More information

Gene Regulation - 4. One view of the Lactose Operon

Gene Regulation - 4. One view of the Lactose Operon Gene Regulation - 1 Regulating Genes We have been discussing the structure of DNA and that the information stored in DNA is used to direct protein synthesis. We've studied how RNA molecules are used to

More information

Breast Cancer and Biotechnology Jacquie L. Bay, Jo K. Perry and Peter E. Lobie

Breast Cancer and Biotechnology Jacquie L. Bay, Jo K. Perry and Peter E. Lobie LENScience Senior Biology Seminar Series Breast Cancer and Biotechnology Jacquie L. Bay, Jo K. Perry and Peter E. Lobie Breast Cancer Each year in New Zealand, approximately 2,400 women and 20 men are

More information

HIV-1 Tat second exon limits the extent of Tat-mediated modulation. of interferon-stimulated genes in antigen presenting cells.

HIV-1 Tat second exon limits the extent of Tat-mediated modulation. of interferon-stimulated genes in antigen presenting cells. HIV-1 Tat second exon limits the extent of Tat-mediated modulation of interferon-stimulated genes in antigen presenting cells The Harvard community has made this article openly available. Please share

More information

7.012 Quiz 3 Answers

7.012 Quiz 3 Answers MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84

More information

Generation of antibody diversity October 18, Ram Savan

Generation of antibody diversity October 18, Ram Savan Generation of antibody diversity October 18, 2016 Ram Savan savanram@uw.edu 441 Lecture #10 Slide 1 of 30 Three lectures on antigen receptors Part 1 : Structural features of the BCR and TCR Janeway Chapter

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting

More information

CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies

CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed

More information

Oncogenes and Tumor. supressors

Oncogenes and Tumor. supressors Oncogenes and Tumor supressors From history to therapeutics Serge ROCHE Neoplastic transformation TUMOR SURESSOR ONCOGENE ONCOGENES History 1911 1960 1980 2001 Transforming retrovirus RSV v-src is an oncogene

More information

BIOL2005 WORKSHEET 2008

BIOL2005 WORKSHEET 2008 BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Recombinant Protein Expression Retroviral system

Recombinant Protein Expression Retroviral system Recombinant Protein Expression Retroviral system Viruses Contains genome DNA or RNA Genome encased in a protein coat or capsid. Some viruses have membrane covering protein coat enveloped virus Ø Essential

More information

IPA Advanced Training Course

IPA Advanced Training Course IPA Advanced Training Course October 2013 Academia sinica Gene (Kuan Wen Chen) IPA Certified Analyst Agenda I. Data Upload and How to Run a Core Analysis II. Functional Interpretation in IPA Hands-on Exercises

More information

Cancer and Gene Alterations - 1

Cancer and Gene Alterations - 1 Cancer and Gene Alterations - 1 Cancer and Gene Alteration As we know, cancer is a disease of unregulated cell growth. Although we looked at some of the features of cancer when we discussed mitosis checkpoints,

More information

A. Incorrect! All the cells have the same set of genes. (D)Because different types of cells have different types of transcriptional factors.

A. Incorrect! All the cells have the same set of genes. (D)Because different types of cells have different types of transcriptional factors. Genetics - Problem Drill 21: Cytogenetics and Chromosomal Mutation No. 1 of 10 1. Why do some cells express one set of genes while other cells express a different set of genes during development? (A) Because

More information

Mutations. Any change in DNA sequence is called a mutation.

Mutations. Any change in DNA sequence is called a mutation. Mutations Mutations Any change in DNA sequence is called a mutation. Mutations can be caused by errors in replication, transcription, cell division, or by external agents. Mutations Mutations can be harmful.

More information

MRC-Holland MLPA. Description version 19;

MRC-Holland MLPA. Description version 19; SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL

More information