directional migration of circulating neutrophils

Transcription

1 TSpace The University of Toronto s research repository Accepted Manuscript of The axonal repellent, Slit2, inhibits directional migration of circulating neutrophils How to cite TSpace items Always cite the published version, so the author(s) will receive recognition through services that track citation counts, e.g. Scopus. If you need to cite the page number of the TSpace version 1 because you cannot access the published version 2, then cite the Tspace version in addition to the published version. Published version citation: Tole S, Mukovozov IM, Huang YW, Magalhaes MA, Yan M, Crow MR, Liu GY, Sun CX, Durocher Y, Glogauer M, Robinson LA. The axonal repellent, Slit2, inhibits directional migration of circulating neutrophils. J Leukoc Biol Dec;86(6): TSpace version citation: Tole S, Mukovozov IM, Huang YW, Magalhaes MA, Yan M, Crow MR, Liu GY, Sun CX, Durocher Y, Glogauer M, Robinson LA. The axonal repellent, Slit2, inhibits directional migration of circulating neutrophils. TSpace. Available at XXXX/XXXXX. Replace the XXXX/XXXXX' with the item handle from the URL, i.e. the last 9 digits. Uses of this material require specific permission from the publisher. 1 TSpace version: includes the pre-print/original manuscript (version before peer review) and post-print/ accepted manuscript (version after peer-review and editing). 2 Published version: the publisher's final PDF.

2 The Axonal Repellent, Slit2, Inhibits Directional Migration of Circulating Neutrophils Soumitra Tole 1 *, Ilya M. Mukovozov 2 *, Yi-Wei Huang*, Marco A.O. Magalhaes, Ming Yan*, Min Rui Crow*, Guang Ying Liu*, Chun Xiang Sun, Yves Durocher, Michael Glogauer, Lisa A. Robinson* *The Hospital for Sick Children Research Institute, Toronto, Canada Institute of Medical Science, University of Toronto, Toronto, Canada Canadian Institutes of Health Research Group in Matrix Dynamics, University of Toronto, Toronto, Canada Biotechnology Research Institute, National Research Council Canada, Montreal, Canada 1,2 contributed equally to this work. Corresponding author: Lisa A. Robinson The Hospital for Sick Children 555 University Avenue, Room 5264 Toronto, Ontario Canada M5G 1X8 Telephone: (416) ext 1745 FAX: (416) lisa.robinson@sickkids.ca Summary sentence: Slit2, a potentially powerful anti-inflammatory agent, inhibits polarization and chemotaxis, but not random movement, of primary neutrophils towards diverse chemoattractants, in vitro and in vivo. Running Title: Slit2 Inhibits Neutrophil Chemotaxis Keywords: Chemotaxis, Inflammation, Leukocyte trafficking Character count: 39,968 Figure count: 7 (+ 4 supplementary figures + 1 supplementary table + 2 supplementary videos) Color figure count: 1 Reference count: 58 Abstract word count: 248 Summary sentence word count: 25

3 Abstract In inflammatory diseases circulating neutrophils are recruited to sites of injury. Attractant signals are provided by many different chemotactic molecules, such that blockade of one may not effectively prevent neutrophil recruitment. The Slit family of secreted proteins, and their transmembrane receptor, Roundabout (Robo), repel axonal migration during central nervous system development. Emerging evidence shows that by inhibiting the activation of Rho-family GTPases, Slit2/Robo also inhibit migration of other cell types towards a variety of chemotactic factors, in vitro and in vivo. The role of Slit2 in inflammation, however, has been largely unexplored. We isolated primary neutrophils from human peripheral blood and mouse bone marrow, and detected Robo-1 expression. Using video-microscopic live cell tracking, we found that Slit2 selectively impaired directional migration, but not random movement, of neutrophils towards formyl-methionyl-leucyl-phenylalanine (fmlp). Slit2 also inhibited neutrophil migration towards other chemoattractants, namely C5a and interleukin (IL)-8. Slit2 inhibited neutrophil chemotaxis by preventing chemoattractant-induced actin barbed end formation and cell polarization. Slit2 mediated these effects by suppressing inducible activation of Cdc42 and Rac2, but did not impair activation of other major kinase pathways involved in neutrophil migration. We further tested the effects of Slit2 in vivo using mouse models of peritoneal inflammation induced by sodium periodate, C5a, and macrophage inflammatory protein-2 (MIP- 2). In all instances, Slit2 effectively reduced neutrophil recruitment (p < 0.01). Collectively, these data demonstrate that Slit2 potently inhibits chemotaxis, but not random motion, of circulating neutrophils, and point to Slit2 as a potential new therapeutic for preventing localized inflammation. 2

4 Introduction Neutrophils are a critical component of the innate immune system and provide the first line of defense against bacterial and fungal pathogens. During an inflammatory response, neutrophils are recruited to sites of inflammation in a series of coordinated interactions with vascular endothelial cells. Traffic signals are provided by diverse chemoattractant molecules, including chemokines such as IL-8, and bacterial products such as formylated peptides. These chemoattractants recruit circulating neutrophils to sites of inflammation, and activate recruited neutrophils to adhere firmly to the endothelium. While their potent anti-microbial arsenal makes neutrophils efficient at fighting microorganisms, it is also capable of causing injury to the surrounding tissue. Indeed, neutrophils inflict significant tissue damage in inflammatory conditions including ischemia-reperfusion injury of solid organs, acute respiratory distress syndrome, and rheumatoid arthritis [1-4]. Once recruited to sites of injury, infiltrating neutrophils release reactive oxygen species and degradative enzymes, fuelling local tissue destruction. Anti-inflammatory drugs such as aspirin and glucocorticoids are widely used, and yet, have shown modest success in reducing neutrophil-mediated injury. These drugs attenuate activation of transcription factors such as NF- B, thereby reducing expression of cytokines [5]. An alternative approach to prevent neutrophil-mediated tissue damage would be blockade of chemotactic pathways that recruit neutrophils to sites of inflammation. Indeed, some chemokine receptor antagonists or blocking antibodies have shown success in animal models and are undergoing clinical trials [6]. However, given the number of chemoattractant signals that recruit neutrophils, it is unlikely that targeting a single chemokine/chemokine receptor pathway would 3

5 achieve widespread clinical success. Thus, localized general blockade of inflammatory chemoattractants could represent a clinically useful strategy to reduce neutrophil-mediated tissue damage. Clues as to how generalized blockade of neutrophil chemoattractant signals might be realized are provided in the neurodevelopmental literature. The Slit family of secreted proteins, together with their transmembrane receptor Roundabout (Robo), repel migration of axons and neurons during development of the central nervous system. Slit is expressed along the midline of the developing central nervous system and its interaction with Robo prevents axons from repeatedly and randomly crossing the midline [7, 8]. While the importance of Slit/Robo interactions in development has been demonstrated, the intracellular signaling pathways that lead to Slit-mediated inhibition of migration remain unclear. Data from Drosophila suggests that Abelson kinase (Abl) and Enabled (Ena) proteins associate with the intracellular domains of Robo-1 and may be involved in the repulsive response to Slit2 [9]. Addition of extracellular Slit2 to neuronal cells results in the recruitment of soluble Slit Robo guanosine triphosphatase (GTPase) activating protein 1 (srgap1) to the cytoplasmic tail of Robo-1 [10]. In addition to neuronal cells, Slit2 and Robo-1 also inhibit migration of other cell types, including vascular smooth muscle cells, breast cancer cells, and brain tumor cells [11-13]. Several studies have demonstrated that Slit2 inhibits migration of haematopoietic cells, including murine macrophages, cultured cells of granulocytic lineage, dendritic cells, and primary human T-lymphocytes, towards chemoattractant signals [14-17]. Importantly, Slit2 not only inhibits cell migration towards one type of chemoattractant signal, but towards many diverse signals, including platelet-derived growth factor (PDGF) and the chemokines, CXCL12 and CCL2 [12, 13, 16, 17]. In vivo, Slit2 inhibits neoangiogenesis by impairing pathologic migration of 4

6 endothelial cells to vascular endothelial growth factor [18]. Existing data point to a role for Slit2 as a generalized anti-migration signal, which universally inhibits cell migration. However, the potential use of Slit2 to prevent inflammation has been largely unexplored. In particular, there is a paucity of data addressing the effects of Slit2 on migration of human leukocytes, especially neutrophils. Moreover, the mechanisms by which Slit2 mediates its anti-migratory effects are incompletely understood. The aim of this study was to assess, in real-time, the effect of Slit2 on recruitment of primary neutrophils. We observed that primary human and murine neutrophils express the Slit2 receptor, Robo-1, and that Slit2 inhibits directional migration, but not random migration, of neutrophils towards a chemotactic stimulus. Our studies demonstrate that Slit2 mediates these effects by preventing chemoattractant-induced cell polarization and generation of actin free barbed ends, a pre-requisite for directional migration of neutrophils. Our data further suggest that Slit2 prevents chemoattractant-induced free barbed end formation by suppressing inducible activation of the small GTPases, Cdc42 and Rac2, but does not affect activation of other major kinase pathways involved in neutrophil migration. To investigate whether Slit2 prevents neutrophil chemotaxis in vivo, we used mouse models of peritoneal inflammation, and observed a significant reduction in the number of neutrophils recruited to the peritoneum in response to diverse inflammatory stimuli, in the presence of Slit2 [19]. Taken together, these data indicate a novel role for the axonal repellent, Slit2, as an anti-inflammatory agent which specifically prevents chemotactic trafficking of circulating neutrophils. 5

7 Materials and Methods Reagents and antibodies. Unless otherwise stated, reagents were purchased from Sigma-Aldrich (St. Louis, MO). Polymorphprep neutrophil separation medium was purchased from Axis- Shield, Norway. The following primary antibodies were used: anti-robo-1 (Abcam, Cambridge, MA, and Santa Cruz Biotechnology, Santa Cruz, CA), anti-myc 9E10 (Covance, QC, Canada), anti-human Cdc42 (Cell Signaling, Danvers, MA), anti-human Rac2 (Upstate Biotechnology, Lake Placid, NY), anti-mouse CD3 (BD Biosciences, Mississauga, Ontario, Canada), anti-b220 (BD Biosciences), anti-nk1.1 (BD Biosciences), anti-f4/80 (Serotec, Raleigh, NC), anti-erk, anti-phospho-erk, anti-p38 MAPK, anti-phospho-p38 MAPK, anti-akt, and anti-phospho-akt. Rhodamine-conjugated phalloidin was from Invitrogen Canada (Burlington, Ontario, Canada). The following secondary antibodies were used: Cy3-conjugated anti-rabbit IgG, Cy2- conjugated anti-human IgG, phycoerythrin (PE)-conjugated anti-rat IgG and anti-mouse IgG (Jackson Immunoresearch Laboratories, Bar Harbor, ME), and horseradish peroxidase-conjugated antirabbit IgG and anti-mouse IgG (Jackson Immunoresearch Laboratories). C5a was purchased from Biovision, Inc. (Mountain View, CA), interleukin-8 (IL-8) from Invitrogen, and macrophage inflammatory protein-2 (MIP-2) from R&D Systems (Minneapolis, MN). Isolation of primary human and murine neutrophils. Human blood was obtained from healthy volunteers and neutrophils were isolated using two methods. For experiments testing the activation of Rac and Cdc42, neutrophils were isolated by dextran sedimentation as described with slight modifications [20]. Briefly, two volumes of blood were mixed with one volume of 6% dextran T-500 in 0.9% NaCl and set at room temperature until clear separation of layers was 6

8 seen (about 30 min). The leukocyte-rich upper layer was collected and centrifuged at 260g at room temperature for 5 min. The cell pellet was re-suspended in a volume of 0.9% NaCl equal to the starting volume of blood, laid onto 10 ml of Ficoll-hypaque solution, and centrifuged at 460g for 30 min. Red blood cells were lysed by adding 20 ml of ice-cold 0.2% NaCl for 30 s, resuspended in 20 ml of ice-cold 1.6% NaCl and centrifuged at 250g at 4 C for 5 min. Neutrophils were re-suspended in ice-cold PBS with 0.5% BSA. Cells were kept on ice for subsequent experimental use. The purity of neutrophils isolated in this manner was assessed by modified Wright-Giemsa stain (Hema-Tek Stain Pack; Bayer, Elkhart, IN) using an automated stainer (Hema-Tek 2000; Bayer), and was consistently greater than 95%. For all other experiments, the Polymorphprep gradient separation procedure was performed according to the manufacturer s recommendations. Purified neutrophils were suspended in PBS without calcium and kept at room temperature. Prior to use, the neutrophils were re-suspended in HBSS with 1mM CaCl 2 and 1mM MgCl 2. Experiments were performed within 1-2 h of isolation of neutrophils. Cell purity was consistently >85-90%. Cell viability was >98% by Trypan blue exclusion. For RT- PCR experiments, a QIAmp RNA Blood Mini Kit (QIAGEN, Ontario, Canada) was used to isolate total RNA from human leukocytes isolated from whole blood, according to the manufacturer s specifications. Primary murine neutrophils were isolated as previously described [19, 21]. Briefly, adult CD1 mice were killed by CO 2 inhalation. Femurs and tibias were removed and bone marrow was extracted. Bone marrow cells were layered onto discontinuous Percoll gradients of 81%/65%/55%. Mature neutrophils were isolated from the 81%/65% interface. More than 85% of cells were neutrophils as assessed by Wright-Giemsa staining. 7

9 Slit2 expression and purification. Stable human embryonic kidney (HEK) 293 cell line expressing full-length human Slit2 with a c-myc-tag at its carboxyl terminus was a kind gift from Drs. Rolando del Maestro (McGill University, Montreal, Canada) and Yi Rao (Washington University, St. Louis, MO) and grown as described [22]. Recombinant Slit2 was purified from the conditioned medium using two methods. Conditioned medium was concentrated and Slit2 purified by affinity chromatography using anti-c-myc Ab 9E10 (Covance, QC, Canada) and Size Primary Immunoprecipitation kit (Thermo Scientific, Rockford, IL) following the manufacturer's instructions. Slit2 was also obtained by Superdex-200 size exclusion chromatography. Briefly, conditioned medium was concentrated using Centricon Plus-20 (Millipore, Billerica, MA) and loaded onto the column [16]. The column was then washed with PBS and fractions containing Slit2 were pooled, concentrated, aliquoted and stored in 80 C before use. The presence of Slit2 was verifed using silver staining and immunoblotting with anti-myc Ab (Supplementary Figure 1A & B). The above protocol was repeated with conditioned medium from control HEK293 cells to obtain control medium. This preparation of Slit2 was titrated and used at a concentration of 0.6 µg/ml. In parallel assays, control medium was used in lieu of Slit2. Large scale preparation of Slit2 was performed by transfection of HEK293-EBNA1 cells. Briefly, human Slit2 cdna (MGC: ; aa of NP_004778) was amplified using forward (CTATCTAGACCTCAGGCGTGCCCGGCGCAGTGC) and reverse (CTAGGATCCGGACACACACCTCGTACAGC) primers containing XbaI and BamHI restriction sites. The amplified cdna was cloned into the ptt28 vector digested with NheI and BamHI. The ptt28 vector is a derivative of the ptt5 vector [23, 24] and contains a synthetic and codon-optimized signal peptide (MGELLLLLLLGLRLQLSLG) and a C-terminal (His) 8 G tag separated by NheI and BamHI restriction sites. HEK293-EBNA1 cells (clone 6E) were 8

10 transfected with 1 µg/ml cdna as previously described [25]. Culture medium was harvested 120 h post-transfection, clarified by centrifugation (4,000 x g for 15 min), and filtered through a 0.45 µm membrane. Slit2 secreted into the medium was purified by immobilized metal-affinity chromatography using a Fractogel-cobalt column equilibrated in PBS. Following washing steps with 5 column volumes (CV) of Wash1 Buffer (50 mm sodium phosphate ph 7.0 and 300 mm NaCl) followed by 5 CV of Wash2 Buffer (50 mm sodium phosphate ph 7.0, 300 mm NaCl and 25 mm imidazole), bound Slit2 was eluted with Elution Buffer (50 mm sodium phosphate ph 7.0, 300 mm NaCl and 25 mm imidazole). The pooled eluted material was immediately desalted on Econo-Pac 10 columns (Bio-Rad Laboratories, Mississauga, ON) previously equilibrated with PBS according to the manufacturer s specifications. Protein concentration was determined by absorbance at 280 nm using a calculated Slit2 molar extinction coefficient of ( For Western blots, proteins were resolved on reducing SDS-PAGE (4 12% Nu-PAGE Bis-Tris gradient gel, Invitrogen) followed by transfer to a 0.2 mm Protran nitrocellulose membrane (Schleicher & Schuell, Keene, NH) in Tris-glycine buffer for 1 h at 300 ma. Purity was verified by Ponceau staining and immunoblotting (Supplementary Figure 1C & D). The membrane was incubated in blocking reagent (Roche Diagnostics, Laval, Canada), and then probed with anti-polyhis-hrp Ab (Sigma-Aldrich) for 1 h (Supplementary Figure 1D). Detection was performed using BM Chemiluminescence Blotting Substrate (Roche Diagnostics) with a Kodak Digital Science Image Station 440cf equipped with Kodak Digital Science 1D image analysis software version 3.0 (Eastman Kodak, New York, NY). We measured endotoxin levels in purified Slit2 stock preparations using ToxinSensor Chromogenic LAL Endotoxin Assay Kit (GenScript Corp., Piscataway, NJ). Endotoxin 9

11 concentrations ranged from ng/ml, yielding final experimental concentrations of pg/ml which are well below those thought to activate leukocytes [26]. To verify this point, we added similar concentrations of endotoxin in neutrophil Transwell assays, and found that such levels of endotoxin had no effect on neutrophil migration (Supplementary Figure 2). RT-PCR. RNA isolation and RT-PCR were performed using the QIAamp RNA blood mini kit and the QIAGEN one-step RT-PCR kit (QIAGEN, Missisauga, ON) as described [13]. As previously described, the following primers specific for Robo-1 were used: GGCCCCACTCCCCCTGTTCG (forward primer) and TCCTCTTCTGGCGCATCCGTATCC (reverse primer) [13]. Amplified products were analyzed by electrophoresis on 2% agarose gels containing ethidium bromide to confirm primer specificity and PCR product size (278 bp). Immunofluorescent labeling. Primary human and mouse neutrophils were allowed to settle onto fibronectin-coated coverslips and to adhere for 3 minutes at room temperature. The cells were fixed with 4% paraformaldehyde for 10 min at 4 C. Neutrophils were stained with rabbit anti- Robo-1 Ab (1µg/ml) for 2 h, washed and then incubated with anti-rabbit-cy3 secondary Ab for 1 h. In some experiments, human or mouse neutrophils were incubated with fmlp (1 µm) for 3 min, following incubation with purified Slit2 (4.5 µg/ml). Cells were fixed, permeabilized, and incubated with rhodamine-conjugated phalloidin (1:500) for 30 min to visualize actin. A Leica DMIRE2 spinning disc confocal microscope (Leica Microsystems, Toronto, Ontario, Canada) equipped with a Hamamatsu back-thinned EM-CCD camera and Volocity software (Improvision Inc., Lexington, MA) was used to capture images. 10

12 Flow cytometry. Cell surface expression of Robo-1 was verified by incubating human and mouse neutrophils with anti-robo-1 Ab, followed by PE-conjugated secondary Ab. Analysis was performed using a FACScalibur flow cytometer (BD Biosciences) and FlowJo software (Tree Star, Inc., Ashland, OR), as previously described [27, 28]. Immunoblotting. Freshly isolated human or mouse neutrophils were pre-treated with either control medium or Slit2 for 10 min and then activated with fmlp (1 µm). Cells were lysed using ice-cold 2x lysis buffer (1 x = 50 mm Tris, ph 7.5, 10% glycerol, 100 mm NaCl, 1% NP- 40, 5 mm MgCl 2, 1 mm DTT, 1 mm PMSF, 1/100 protease inhibitor cocktail and 1 mm NaVO 3 ). Samples were run on SDS-PAGE, transferred to 0.2 mm PVDF (Millipore) membrane and probed for Robo-1 or for both phosphorylated and total Akt, Erk and p38 MAP kinase. Immunoreactive bands were visualized by enhanced chemiluminescence (Amersham Biosciences, UK Ltd, Buckinghamshire, UK) recorded on x-ray film. Prior to performing experiments, a time-course study was performed to determine the optimal point at which to measure phosphorylation of Akt, Erk, and p38 MAPK following exposure to fmlp. Of samples harvested at s, the maximum signal was observed at 30 s, and therefore, a 30 s timepoint was used for all subsequent experiments. Migration assay. Freshly isolated neutrophils (10 6 cells/ 100µl) were incubated with medium alone, Slit2 (0.6 µg/ml), or control medium at 37 C for 10 minutes. Cells were loaded into the top chamber of a 3 µm Transwell insert (Corning Life Sciences, Corning, NY) in a 24-well plate. A coverslip was added to the bottom chamber which was filled with 600 µl of HBSS alone, fmlp (1 µm), C5a (2 µg/ml), or IL-8 (0.1 µg/ml) [29-32]. Into the bottom chamber Slit2, 11

13 control medium, or HBSS was dispensed. Transwell plates were incubated for 1 h at 37 C. To determine the number of neutrophils which had migrated from the top to the bottom chamber, the filter was removed and neutrophils in the lower chamber were rapidly spun down onto the coverslips, fixed with 4% paraformaldehyde, washed, and labeled with DAPI. A Leica DMIRE microscope was used to take representative 40x and 63x high-power images. A Nikon light microscope was used to count at least 10 random fields from each coverslip. The data represent the mean value ± SEM from at least 4 independent experiments for each treatment condition. Micropipette chemotaxis assays. To measure neutrophil migration, round glass coverslips (25- mm diameter; Thomas Scientific, Swedesboro, NJ) coated with fibronectin were mounted in Leiden chambers, overlaid with 0.5 ml of the indicated solution, and placed on the heated stage of a Leica DM IRB microscope (Leica Microsystem, Richmond Hill, Ontario, Canada). Next, a 100 l aliquot of the neutrophil suspension containing 10 6 cells was added, and cells allowed to settle for 10 min. To induce chemotaxis, a point-source of chemoattractant was delivered using a glass micropipette [33-36]. Micropipettes were prepared from borosilicate capillaries with an outer diameter of 1.0 mm and an inner diameter of 0.78 mm (Sutter, Novato, CA) using a model P-97 micropipette puller (Sutter). The tips of the micropipettes were 1.0 m in diameter. Precise positioning of the micropipette in the visual field was accomplished using a model 5171 micromanipulator (Eppendorf, Hamburg, Germany). Although the distance between the pipette and the individual cells adherent to the coverslip varied, the initial average distance of the cells under observation (i.e., those in the microscopic field under observation) ranged between 40 and 50 m. The pipette remained stationary, and diffusion of the chemoattractant generated a standing gradient [33-36]. Images were acquired every 10 s until completion of the experiment. 12

14 Only cells which started and remained in the field of view over the entire course of videocapture were analyzed. Using Volocity TM software (Improvision, Waltham, MA), the distance traveled was measured by tracking the centroid of each cell over time. Four different measures of chemotactic activity were assessed: total migration (distance), net migration (displacement), speed (distance/time) and directionality (displacement/distance). Total migration was defined as the sum of the absolute distances traveled in all the individual time intervals. The net migration was calculated as the difference between the initial distance of the cell with respect to the pipette and that at the end of the experiment. Migration speed was calculated by dividing the total distance travelled over the elapsed time. Directionality was measured by obtaining a ratio of displacement over distance. Actin free barbed end assay. To assess the effects of Slit2 on fmlp-induced actin polymerization, actin nucleation activity was measured as enhancement of pyrene actin fluorescence as previously described [21, 37, 38]. Briefly, human neutrophils (5x10 6 /ml) were permeabilized for 10 s using 0.1 vol of OG buffer (PHEM buffer containing 4% octyl glucoside, 10 µm phallacidin, 42 nm leupeptin, 10 mm benzamidine, and mm aprotinin) or NP-40 (final concentration of 1%). Permeabilization was stopped by diluting the detergent with 3 vol of buffer B (1 mm Tris, 1 mm EGTA, 2 mm MgCl 2, 10 mm KCl, 5 mm -mercaptoethanol, 5 mm ATP; ph 7.4). We then assayed for nuclei by adding pyrene-labeled rabbit skeletal muscle actin to a final concentration of 1 µm, and followed the fluorescence increase with a microplate reader (FLUOstaroptima, BMG Labtech, Nepean, Ontario, Canada) at excitation and emission wavelengths of 366 and 386 nm, respectively [21, 37]. 13

15 Cdc42 and Rac2 activation assays. Prior to performing these experiments, a time-course study was performed to determine the optimal point at which to measure activation of Rac2 and Cdc42 following exposure to fmlp. Of samples harvested at s, the maximum signal was observed at 30 s, and therefore, a 30 s time-point was used for subsequent experiments. To assess the effects of Slit2 on fmlp-induced activation of Cdc42 and Rac2, pull-down assays were performed as previously described with slight modifications [39]. The p21-binding domain (PBD; aa ) of PAK1 in pgex-4t3 vector was expressed as a GST fusion protein in BL21 (DE3) E. coli cells. The GST-PBD fusion protein was affinity purified using glutathione sepharose 4B beads (GE Healthcare Bio-Sciences, Piscataway, NJ). Protein bound beads were aliquoted and stored at 80 C for later use. Human neutrophils purified by dextran sedimentation (~1 x 10 7 /sample) were diluted in 0.5 ml 37 C warmed HEPES-HBSS and incubated with purified Slit2 (0.6 µg/ml) at 37 C for 10 min. Cells were stimulated with fmlp (1 µm) for 30 s at 37 C and the reaction was stopped by adding 0.5 ml ice-cold 2x lysis buffer (1x = 50 mm Tris, ph 7.5, 10% glycerol, 100 mm NaCl, 1% NP-40, 5 mm MgCl 2, 1 mm DTT, 1mM PMSF, 1/100 protease inhibitor cocktail, and 1 mm NaVO 3 ). Samples were centrifuged at maximal speed in a bench-top centrifuge for 5 min at 4 C and an aliquot of supernatant was used as loading control. The remaining supernatants were added to GST-PBD glutathione beads (20 µg GST-PBD/sample). Samples were rotated at 4 C for 1 h, washed 3 times with cold wash buffer (50 mm Tris, ph 7.5, 40 mm NaCl, 0.5% NP-40, 30 mm MgCl 2, 1 mm DTT, 1 mm PMSF, 0.1 mm NaVO 3 ) and 20 µl of 2x Laemmli loading buffer added. Samples were run on SDS-PAGE and transferred onto a 0.2 mm PVDF (Millipore) membrane. Cdc42 and Rac2 were detected using anti-human Cdc42 and anti-human Rac2 primary Ab and HRP-conjugated secondary Ab. Densitometry analysis was performed on the blots using Image J software. 14

16 To examine the effects of Slit2 on spatial distribution of activated Rac and Cdc42, assays were performed as previously described [33]. Briefly, mouse bone marrow-derived neutrophils were isolated and 1x 10 6 cells were suspended in Nucleofector solution supplemented with 6 µg cdna expression plasmids encoding each of yellow fluorescent protein-tagged p21-binding domain of PAK (PAK-PBD-YFP), which selectively detects activated Rac and Cdc42, together with red fluorescent protein-tagged H-Ras (H-Ras-RFP) to label the plasma membrane [21, 33]. Cells were transfected using a Cell Line V Nucleofector TM kit (Amaxa Biosystems, Amaxa, Inc.) and the Nucleofector TM program Y-001 [21, 33]. Transfected cells were carefully recovered and transferred to Iscove s Modified Dulbecco s Medium pre-warmed to 37 C and allowed to recover for 2 h. Neutrophils were placed on coverslips coated with 1% BSA mounted in an Attafluor cell chamber (Invitrogen) and exposed to a point source of fmlp (1 µm) dispensed through a glass micropipette [21, 33]. In some experiments, neutrophils were pre-incubated with purified Slit2 (4.5 µg/ml) for 10 min. Cells were maintained on a microscope stage heated to 37 C, and digital images were acquired every 3-5 s using a Leica DMIRE2 inverted fluorescence microscope equipped with a Hamamatsu backthinned EM-CCD camera and spinning disc confocal scan head [21, 33]. Images were acquired and analyzed using Volocity TM software. Following chemotactic stimulation with fmlp, the ratio of the fluorescence intensity of PAK- PBD-YFP: H-Ras-RFP was compared at the leading edge of the cell and the trailing edge of the cell [21, 33]. The normalized mean fluorescence intensity was calculated for 19 cells from three independent experiments [33]. Mouse peritonitis experiments. To determine the effects of Slit2 on neutrophil chemotaxis in vivo, we used a mouse model of sodium periodate-induced peritonitis as previously described 15

17 [19]. All procedures were carried out in accordance with the Guide for the Humane Use and Care of Laboratory Animals and were approved by the Hospital for Sick Children Research Institute Animal Care Committee. Adult CD1 mice were injected intraperitoneally with Slit2 (100 ng) or control medium, then 1 h later with 1 ml of 5 mm sodium periodate in PBS [15]. After 3 h, mice were euthanized and the peritoneal exudate collected by lavage with chilled PBS (5 ml/mouse). Infiltrating neutrophils were counted using an electronic cell counter (Becton Dickinson) and neutrophil influx was confirmed by analyzing cytospun slides. To determine whether Slit2 administered systemically prevents neutrophil recruitment, purified Slit2 (1.8 µg in 0.2 ml normal saline) was administered by intravenous tail-vein injection. One hour later, 1 ml PBS containing sodium periodate (5 mm), C5a (10 µg), or MIP-2 (2.5 µg) was injected intraperitoneally [40, 41]. After 3 h, mice were euthanized, peritoneal exudate collected, and infiltrating neutrophils counted as described above. The number of infiltrating monocytes/macrophages, T lymphocytes, B lymphocytes, and natural killer cells was determined by labeling cells with Ab directed to F4/80 (10 µg/ml), CD3 (5 µg/ml), B220 (2 µg/ml), or NK1.1 (2 µg/ml), respectively, and performing flow cytometry as previously described [27, 28]. Statistical analysis. Analysis of variance (ANOVA) followed by Bonferonni post-hoc testing was performed using SPSS statistical software to analyze the data from Transwell experiments. In all other cases, the Student s t-test was used. p < 0.05 was considered significant. 16

18 Results 1) Primary human and mouse neutrophils express the Slit2 receptor, Robo-1. Robo-1 mrna and protein expression were detected in both human and mouse neutrophils (Figure 1A & B) [19, 21]. Since Robo-1 expression has previously been demonstrated in primary human lymphocytes, as a positive control, we verified Robo-1 expression in human leukocytes isolated from whole blood (Figure 1A) [16]. We detected two distinct bands for Robo-1 protein in mouse neutrophils, consistent with the splice variants previously reported (Figure 1B) [42]. Using immunofluorescence microscopy and flow cytometry, we detected Robo-1 expression on the surface of human and murine neutrophils (Figure 1C-E). 2) Slit2 inhibits migration of human neutrophils towards fmlp. We studied the effects of Slit2 on Transwell migration of human neutrophils. As expected, basal migration was minimal (Figure 2A & E), but increased in the presence of an fmlp chemotactic gradient (Figure 2B & E; p < 0.001). When no chemotactic gradient was present, purified Slit2 did not stimulate neutrophil transmigration (Figure 2D). However, Slit2 prevented neutrophil migration towards fmlp in the lower chamber, in a dose-dependent fashion (compare Figure 2B & C; Figure 2E, p < for the two highest Slit2 concentrations tested). When fplc-enriched Slit2 from conditioned medium of Slit2-expressing HEK-293T cells was tested, very similar results were obtained (Supplementary Figure 3). In this instance, control medium from mock-transfected cells had no effect on neutrophil migration, verifying that the Slit2 preparation did not contain any factors that could inadvertently affect neutrophil migration (Supplementary Figure 3; p < 0.05 vs no 17

19 fmlp). Together, these data demonstrate that Slit2 inhibits fmlp-induced migration of primary human neutrophils in a dose-dependent fashion. 3) Slit2 inhibits migration of human neutrophils towards other chemoattractants. To determine whether Slit2 inhibits neutrophil migration towards different chemoattractant signals, we performed Transwell assays in which C5a or IL-8 were placed in the lower chamber. Slit2 resulted in a four-fold and six-fold decrease in neutrophil migration towards IL-8 and C5a, respectively (Figure 2F; IL-8: 93 ± 23 cells/field; IL-8 + Slit2: 23 ± 5 cells/field; C5a: 51 ± 10 cells/field; C5a + Slit2: 8 ± 3 cells/field; p < for C5a and IL-8). These data demonstrate that Slit2 is a potent inhibitor of neutrophil migration towards diverse types of chemotactic cue. 4) Slit2 inhibits directional but not random migration of human neutrophils. We next determined whether the observed effects of Slit2 on neutrophil migration were due to inhibition of cell chemotaxis or chemokinesis. Chemokinesis is defined as random movement in response to a stimulant. Unlike chemokinesis, chemotaxis includes a vectoral assessment of migration and is defined as directional migration in response to a chemotactic gradient. Therefore, defects in chemokinesis result in the failure of a cell to move while defects in chemotaxis result in the failure of a cell to move in the right direction. In the absence of Slit2, neutrophils migrated efficiently towards a point-source of fmlp (Supplementary Video 1 and Supplementary Figure 4A-C). In the presence of Slit2, neutrophils moved randomly but failed to move towards the micropipette (Supplementary Video 2 and Supplementary Figure 4D-F). These data suggest that Slit2 does not inhibit generalized movement of neutrophils but rather, their directionality. 18

20 To refine the analysis, we tracked the centroid of each neutrophil over time. Figure 3A depicts the migratory tracks of neutrophils exposed to an fmlp gradient while Figure 3B represents the migratory tracks of neutrophils exposed to fmlp in the presence of Slit2. The displacement, speed, and directionality were determined for each cell. A neutrophil migrating efficiently (directly) up a chemotactic gradient would have very similar displacement and distance measurements. As such, its directionality value would be close to 1. Conversely, a neutrophil moving randomly would have a smaller net displacement despite traveling the same distance, thereby having a directionality value closer to 0. Neutrophils incubated with fmlp alone had an average speed of 6.8 ± 0.6 µm/min, no different from those incubated with fmlp together with Slit2 (6.5 ± 0.6 µm/min; Figure 3C). In the presence of Slit2, the directionality ratio was significantly reduced (Figure 3D; fmlp 0.61 ± 0.04; fmlp + Slit ± 0.04; p < 0.002). Taken together, these data demonstrate that Slit2 does not inhibit the random movement and speed of neutrophil migration but, rather, prevents directional migration towards a chemotactic gradient. 5) Slit2 inhibits chemoattractant-stimulated actin free barbed end formation in human neutrophils. We directly assayed the effects of Slit2 on actin free barbed end formation, an event critical for formation of protruding lamellipodia and neutrophil migration [21, 37, 43-46]. In pyrene-actin polymerization curves generated, the slope is proportional to the free barbed end numbers [21, 37]. As expected, unstimulated neutrophils demonstrated low basal levels of free barbed end generation, but fmlp promoted a rapid, six-fold increase (Figure 4A & B; p < 0.04). Similarly, when neutrophils were treated with control medium prior to stimulation with fmlp, we observed a five-fold increase in the rate of actin polymerization as compared to unstimulated 19

21 cells (Figure 4A & B; p < 0.01). In the presence of Slit2, fmlp-induced actin polymerization was considerably more modest, resulting in less than a three-fold increase compared to unstimulated cells (Figure 4A & B; p < 0.04). Slit2 significantly reduced fmlp-stimulated generation of actin filaments (Figure 4A & B; p < 0.05 vs control medium). Accordingly, Slit2 inhibited accumulation of actin at the leading edge of neutrophils following exposure to fmlp (Figure 4C). Collectively, these data suggest that Slit2 inhibits directional migration of neutrophils by disrupting generation of high-affinity free barbed ends that drive actin filament elongation. This in turn inhibits actin assembly at the leading edge of migrating cells, thus preventing efficient chemotaxis. 6) Slit2 inhibits chemoattractant-induced polarization and activation of Rac2 and Cdc42 in primary human neutrophils. Following chemotactic stimulation, activation of the Rho GTPases, Rac and Cdc42, plays a key role in the re-organization of actin filaments [19, 21, 34]. Since the predominant isoform of Rac in human neutrophils is Rac2, not Rac1, we specifically studied activation of Rac2 [47, 48]. We used GST beads conjugated to the p21-binding domain of p21- activated kinase-1 (PAK-PBD) to detect the activated, GTP-bound species of Rac and Cdc42 [39]. Unstimulated neutrophils had low basal levels of activated Rac2 and Cdc42 (Figure 5A & B). Exposure to fmlp increased levels of activated Cdc42 by five-fold, and of activated Rac2 by three-fold (Figure 5A and B; p 0.01 vs unstimulated for both Cdc42 and Rac2). Slit2 did not affect basal levels of activated Rac2 and Cdc42, but significantly inhibited fmlp-induced activation of these GTPases (Figure 5A & B; p < 0.05). Upon stimulation with fmlp, levels of activated Cdc42 and Rac2 in the presence of Slit2 were less than half those observed when Slit2 was not present (Figure 5B; p < 0.05). Moreover, Slit2 prevented spatial accumulation of 20

22 activated Rac and Cdc42 at the leading edge of fmlp-stimulated neutrophils (Figure 5C & D; p < 0.001). These data demonstrate that Slit2 inhibits neutrophil chemotaxis and actin polymerization by preventing cell polarization and disrupting generation and recruitment to the lamellipodium of activated Rac2 and Cdc42. 7) Slit2 does not inhibit chemoattractant-induced activation of other major kinase pathways. We examined the effects of Slit2 on activation of a number of other kinase pathways associated with neutrophil chemotaxis, namely, phosphoinositide 3-kinase (PI3K), Akt, Extracellular signalrelated kinase (Erk), and p38 mitogen-activated protein kinase (MAPK) [49-52]. As expected, stimulation of neutrophils with fmlp led to rapid phosphorylation of Akt, Erk and p38-mapk (Figure 6A-D; p < for Akt; p < 0.05 for Erk; p < 0.05 for p-38 MAPK). Slit2 treatment had no effect on the basal level of kinase activation (Figure 6A-D). Upon stimulation with fmlp, resulting levels of activated Akt were comparable in the presence or absence of Slit2, suggesting that Slit2 does not impair the ability of neutrophils to generate PI(3,4,5)P 3 (Figure 6A & B). Similarly, Slit2 treatment had no effect on fmlp-induced phosphorylation of Erk and p38 MAP kinase (Figure 6A, C, and D). Collectively, these data suggest that Slit2 inhibits neutrophil chemotaxis by specifically preventing activation of Cdc42 and Rac2, but not activation of Akt, Erk, or p38 MAPK. 8) Slit2 inhibits leukocyte recruitment in peritoneal inflammation. To study the effects of Slit2 on neutrophil recruitment in vivo, we used a well-described mouse model of chemical irritant peritonitis [43]. In the presence of control medium, sodium periodate administration resulted in influx of 1.90 x10 6 ± 0.50 x10 6 neutrophils (Figure 7A). When Slit2 was pre-administered by 21

23 intraperitoneal injection, neutrophil recruitment to the peritoneal cavity decreased six-fold (Figure 7A; 0.30 x10 6 ± 0.11x10 6 ; p < 0.05). When purified Slit2 was pre-administered intravenously by tail vein injection, neutrophil influx fell from 0.86 x10 6 ± 0.10 x10 6 to 0.05 x10 6 ± 0.02 x10 6 (Figure 7B; p < 0.001). Although the number of other leukocyte subsets recruited to the peritoneal cavity was small, Slit2 also inhibited infiltration of several of them, especially monocytes/macrophages (Supplementary Table 1; p < 0.01). Slit2 prevented neutrophil recruitment to the peritoneum in response to other chemoattractant factors, namely C5a and MIP-2 (Figure 7B; C5a: 1.50 x10 6 ± 0.60x10 6 ; C5a + Slit2: 0.30 x10 6 ± 0.08 x10 6 ; p < 0.001; MIP-2: 1.12 x x10 6 ± 0.24x10 6 ; MIP-2 + Slit2: 0.65 x 10 6 ± 0.19 x10 6, p < 0.01). These data demonstrate that Slit2 acts as a potent inhibitor of chemotaxis for circulating neutrophils, as well as for other leukocytes, towards diverse inflammatory stimuli. 22

24 Discussion The aim of this study was to assess the effect of Slit2 on the migration of circulating neutrophils. We demonstrated that primary human neutrophils express Robo-1 and that exogenous application of Slit2 blocks migration of neutrophils in response to a chemotactic gradient. This observation is consistent with the effect of Slit2 on other cells expressing Robo-1 on their surface. Indeed, Slit2/Robo-1 have recently been shown to inhibit the migration of a number of different cell types, including cells of hematopoetic lineage such as dendritic cells and T lymphocytes [14-16]. A major finding of our study is that Slit2 did not inhibit all movement but specifically the directed migration of neutrophils. This is a particularly important distinction because neutrophil chemotaxis to sites of injury is an important component of inflammatory tissue injury. Indeed, neutrophil-mediated tissue damage is associated with a number of inflammatory conditions, including rheumatoid arthritis and ischemia-reperfusion injury [2, 53]. The ability of Slit2 to specifically disrupt neutrophil chemotaxis points to the potential use of this agent as a novel therapeutic for inflammatory tissue injury. While Slit2 has been shown to inhibit chemotactic migration of several cell types, the mechanisms that mediate these effects remain poorly understood. Neutrophil migration involves a complex series of events in which the cell, upon sensing a chemotactic gradient, develops a polarized morphology with a wide lamella at the front and a narrow tail-like uropod at the back. Critical to the maintenance of this asymmetry and to forward propulsion is the rapid turnover of actin filaments at the lamella. In this study, we demonstrated that treatment of neutrophils with Slit2 led to a significant reduction in fmlp-stimulated generation of free barbed ends which are required for rapid actin polymerization at the leading edge [37]. This observation is consistent 23

25 with data from neuronal cells linking Robo-1 to proteins associated with the actin cytoskeleton, including Enabled kinase (Ena) and slit-robo GTPase activating protein-1 (srgap1) [9, 10]. However, to the best of our knowledge, this study provides the first evidence directly linking Slit2 treatment to a reduction in chemoattractant-stimulated high affinity actin filament ends. In neutrophils undergoing chemotaxis, the family of small GTPases mediate turnover of actin. Indeed, treatment of cells with Clostridium difficile toxin, which inhibits GTPases by monoglucosylation, results in severe defects in actin turnover and migration [54]. Seminal work describing the effects of introducing dominant-negative cdna constructs into HL-60 granolucytic cells identified Rac as the key determinant of actin assembly, and Cdc42 as being responsible for maintaining the direction of migration [34]. We observed that exogenous application of Slit2 prevented chemoattractant-induced activation and recruitment of both Cdc42 and Rac2. These data are consistent with data from neuronal cells where Slit2 treatment has been shown to recruit the novel GTPase activating protein srgap1, and to subsequently inactivate Cdc42 and inhibit axonal migration [10]. In HL-60 neutrophil-like cells, inhibition of Cdc42 using a dominant negative allele prevents cells from efficiently moving up a chemotactic gradient, and results in extension of random lamellae in all directions [34]. We found that Slit2 also prevented chemoattractant-induced activation of Rac2. Similarly, Slit2 has been shown to suppress Rac activation in human vascular smooth muscle cells, human T lymphocytes, and murine RAW264.7 macrophages [13, 15, 16]. In murine neutrophils, Rac1 and Rac2 are expressed at similar levels, and each isoform has distinct functions. Neutrophils deficient in Rac1 display normal migratory velocity but reduced directionality towards chemotactic gradients [19]. In contrast, Rac2-deficient neutrophils demonstrate reduced migration speed, but normal chemotactic migration [19]. Rac1-deficient 24

26 neutrophils show a partial reduction in chemoattractant-induced actin polymeraization, and the kinetics of actin assembly are delayed, preferentially inhibiting early rather than later events [43]. Overall, the effects of Slit2 we observed on neutrophil migratory characteristics are highly reminiscent of Rac1 deficiency. In our experiments, rather than evaluate overall actin assembly, we focused on a key regulatory feature of this process, namely, generation of free high-affinity actin filament ends. Measurement of free barbed end formation specifically measures the initial burst of actin activity following chemotactic stimulation. Indeed, free barbed end generation of actin is required for efficient cell chemotaxis. We found that Slit2 inhibited chemoattractantinduced generation of free barbed ends by over 50%. This falls in between values observed in Rac1- and Rac2-deficient neutrophils, in which a 30% defect and a 70% defect in free barbed end generation has been reported, respectively [21]. It is interesting to note that following chemotactic stimulation of both Slit2-treated human neutrophils and Rac1-deficient murine neutrophils, random migration of cells remains intact despite a partial defect in generation of actin high-affinity free barbed ends. Emerging data supports the concept that it is not the total amount of actin polymerization that governs cell motility, but rather, the spatiotemporal dynamics of actin assembly within the migrating cell. In support of this notion is the recent discovery that hematopoietic protein 1 (Hem-1) constitutes part of an organizational complex that localizes to propagating waves of actin nucleation within migrating neutrophils [55, 56]. These waves interact reciprocally with actin to define and organize the leading edge of neutrophils [56]. In this way, net cell movement results from the collective actions of multiple self-organizing actin-based waves. At the molecular and cellular level, Slit2 s effects on neutrophil migration share features akin to those seen in both Rac1- and Rac2-null mice. This may be explained by the differences 25

27 in expression of Rac isoforms between murine and human neutrophils. In murine neutrophils, Rac1 and Rac2 are expressed at equivalent concentrations. In human neutrophils, Rac2 expression is 4 to 40 times greater than that of Rac1 [47, 48, 57]. Thus, in human neutrophils it is likely that Rac2 mediates functions assumed by Rac1 in murine neutrophils. In human neutrophils it has proven very difficult to delineate the individual functions of Rac1 and Rac2. The two GTPases are 92% homologous and the guanine nucleotide exchange factors that regulate them are the same, rendering expression of mutant proteins in neutrophil-like cell lines an ineffective means of dissecting the individual roles played by Rac1 and Rac2 in chemotaxis. Moreover, human neutrophils are small, terminally differentiated cells which are difficult to transfect, further complicating the ability to experimentally manipulate them. Together, our data suggest a mechanism of action whereby Slit2 binding to Robo-1 in human neutrophils prevents chemoattractant-induced activation of Rac2 and Cdc42, with consequent disruption of actin free barbed end formation, and ultimately, inhibition of directional neutrophil migration. Stimulation of neutrophils by fmlp also leads to rapid phospholipid metabolism and activation of major kinase pathways, including Akt, Erk, and p38-mapk, responsible for transcriptional changes. Studies using specific inhibitors demonstrate that disrupting each of these pathways significantly disrupts neutrophil chemotaxis. However, exogenous treatment with Slit2 had no effect on the chemoattractant-induced activation of any of the above pathways. We observed normal activation of the Akt pathway in response to chemotactic stimulation, suggesting that Slit2 does not inhibit phospholipid metabolism and specifically, generation of PI(3,4,5)P3. These results were somewhat surprising, given the important role played by PI(3,4,5)P3 in chemotactic migration of neutrophils. In one study, neutrophils from PI3K deficient mice displayed reduced directional migration towards chemotactic gradients [50]. Our 26

28 data is, however, consistent with observations in human HL-60 granulocytic cells expressing a dominant negative allele of Cdc42. In these studies, suppression of Cdc42 still led to normal PI(3,4,5)P3 production and Akt activation [34]. In yet another study, Slit2 prevented chemokine-induced activation of PI3K in human breast cancer cells [12]. We further found that in human neutrophils, Slit2 did not inhibit chemoattractant-induced activation of Erk, nor p38- MAPK. These data are in concordance with those of others, demonstrating that neither activation of p38-mapk in Jurkat T lymphocytes nor activation of Erk in human granulocytic cells was affected by Slit2 [16, 17]. In another study, Slit2 prevented chemotaxis and chemoinvasion of breast cancer cells towards the chemokine, CXCL12, and inhibited CXCL12-induced activation of Erk [12]. These differential effects of Slit2 on inducible kinase activity may be attributable to the different cell types used and to the different chemotactic agents used to stimulate them. To determine whether Slit2 can prevent neutrophil recruitment in vivo, we used mouse models of peritoneal inflammation induced by local instillation of sodium periodate, C5a, or MIP-2. We found that administration of Slit2, either intraperitoneally or intravenously, significantly reduced neutrophil recruitment. This is the first direct demonstration of Slit2 s potent anti-chemotactic actions on neutrophils in vivo. These data confirm a universal antimigratory role for Slit2, and are in keeping with recent work showing that Slit2 prevents pathologic neovascularization within the eye by inhibiting chemotaxis of endothelial cells towards vascular endothelial growth factor [18]. In another study, Slit2 ameliorated glomerulonephritis-associated kidney injury by inhibiting chemotactic infiltration of macrophages [15]. Our results would suggest that localized or systemic delivery of Slit2 may reduce neutrophil recruitment and subsequent tissue damage associated with inflammation. Soluble Slit2 is relatively sticky and could potentially be locally maintained at high 27

29 concentration by adhering to extracelleular matrix proteins such as glypican-1 [58]. Thus, after regional administration, Slit2 could be retained at sites of inflammation, such as joints and transplanted organs, thereby alleviating neutrophil-inflicted tissue injury associated with rheumatoid arthritis and ischemia reperfusion injury. Because Slit2 blocks migration of several types of inflammatory cells, including neutrophils, T lymphocytes, macrophages, and dendritic cells, towards diverse chemotactic stimuli, it could act as a highly effective anti-inflammatory agent [14-17]. Further studies are needed to explore the clinical use of Slit2, or a Slit-like agent, for prevention and treatment of localized inflammation. Acknowledgments The authors wish to thank Dr. Mohabir Ramjeesingh for technical assistance, and Drs. Gilles St- Laurent, and Sylvie Perret for reagents. We are grateful to Dr. Sergio Grinstein for reagents and for helpful advice. This work was supported by the Canadian Institute of Health Research (L.A.R.), the Kidney Foundation of Canada (L.A.R.), and an Early Researcher Award from the Ministry of Research and Innovation, Government of Ontario (L.A.R.). L.A.R. holds a Canada Research Chair, Tier 2. Authorship S.T. designed and performed experiments, analyzed results, and helped with manuscript preparation. I.M.M., Y-W.H., M.A.O.M., and M.Y. designed and performed experiments and analyzed results. M.R.C., G-Y.L., and C.X.S. designed and performed experiments. Y.D. generated critical reagents and helped with manuscript preparation. M.G. designed experiments 28

30 and helped with manuscript preparation. L.A.R. designed experiments, interpreted results, and prepared the manuscript. 29

31 References 1. Reutershan, J., Ley, K. (2004) Bench-to-bedside review: Acute respiratory distress syndrome- how neutrophils migrate into the lumg. Crit Care 8, Weissmann, G., Korchak, H. (1984) Rheumatoid arthritis: the role of neutrophil activation. Inflammation 8 Suppl, S3-S Rossen, R.D., Swain, J.L., Michael, L.H., Weakley, S., Giannini, E., Entman, M.L. (1985) Selective accumulation of the first component of complement and leukocytes in ischemic canine heart muscle. A possible initiator of an extra myocardial mechanism of ischemic injury. Circ Res 57, Lucchesi, B.R., Mullane, K.M. (1986) Leukocytes and ischemia-induced myocardial injury. Annu Rev Pharmacol Toxicol 26, Panes, J., Perry, M., Granger, D.N. (1999) Leukocyte-endothelial cell adhesion: avenues for therapeutic intervention. Br J Pharmacol 126, Charo, I.F., Ransohoff, R.M. (2006) The many roles of chemokines and chemokine receptors in inflammation. N Engl J Med 354, Nguyen Ba-Charvet, K.T., Brose, K., Ma, L., Wang, K.H., Marillat, V., Sotelo, C., Tessier-Lavigne, M., Chedotal, A. (2001) Diversity and specificity of actions of Slit2 proteolytic fragments in axon guidance. J Neurosci 21, Brose, K., Bland, K.S., Wang, K.H., Arnott, D., Henzel, W., Goodman, C.S., Tessier- Lavigne, M., Kidd, T. (1999) Slit proteins bind Robo receptors and have an evolutionarily conserved role in repulsive axon guidance. Cell 96,

32 9. Bashaw, G.J., Kidd, T., Murray, D., Pawson, T., Goodman, C.S. (2000) Repulsive axon guidance: Abelson and Enabled play opposing roles downstream of the Roundabout receptor. Cell 101, Wong, K., Ren, X.-R., Huang, Y.-Z., Xie, Y., Liu, G., Saito, H., Tang, H., Wen, L., Brady-Kalnay, S.M., Mei, L., Wu, J.Y., Xiong, W.-C., Rao, Y. (2001) Signal transduction in neuronal migration: roles of GTPase activating proteins and the small GTPase Cdc42 in the Slit-Robo pathway. Cell 107, Werbowetski-Ogilvie, T.E., Seyed Sadr, M., Jabado, N., Angers-Lostau, A., Agar, N.Y.R., Wu, J., Bjerkvig, R., Antel, J.P., Faury, D., Rao, Y., Del Maestro, R.F. (2006) Inhibition of medulloblastoma cell invasion by Slit. Oncogene 25, Prasad, A., Fernandis, A.Z., Rao, Y., Ganju, R.K. (2004) Slit protein-mediated inhibition of CXCR4-induced chemotactic and chemoinvasive signaling pathways in breast cancer cells. J Biol Chem 279, Liu, D., Hou, J., Hu, X., Wang, X., Xiao, Y., Mou, Y., De Leon, H. (2006) Neuronal chemorepellent Slit2 inhibits vascular smooth muscle cell migration by suppressing small GTPase Rac1 activation. Circ Res 98, Guan, H., Zu, G., Tang, H., Johnson, M., Xu, X., Kevil, C., Xiong, W.-C., Elmets, C., Rao, Y., Wu, J.Y., Xu, H. (2003) Neuronal repellent Slit2 inhibits dendritic cell migration and the development of immune responses. J Immunol 171, Kanellis, J., Garcia, G.E., Li, P., Parra, G., Wilson, C.B., Han, S., Smith, C.W., Johnson, R.J., Wu, J.Y., Feng, L. (2004) Modulation of inflammation by Slit protein in vivo in experimental crescentic glomerulonephritis. Am J Pathol 165,

33 16. Prasad, A., Qamri, Z., Wu, J., Ganju, R.K. (2007) Slit-2/Robo-1 modulates the CXCL12/CXCR4-induced chemotaxis of T cells. J Leukoc Biol 82, Wu, J.Y., Feng, L., Park, H.-T., Havlioglu, N., Wen, L., Tang, H., Bacon, K.B., Jiang, Z.- h., Zhang, X.-c., Rao, Y. (2001) The neuronal repellent Slit inhibits leukocyte chemotaxis induced by chemotactic factors. Nature 410, Jones, C.A., Londin, N.R., Chen, H., Park, K.W., Sauvaget, D., Stockton, R.A., Wythe, J.D., Suh, W., Larrieu-Lahargue, F., Mukoutama, Y.-s., Lindblom, P., Seth, P., Frias, A., Nishiya, N., Ginsberg, M.H., Gerhardt, H., Zhang, K., Li, D.Y. (2008) Robo4 stabilizes the vascular network by inhibiting pathologic angiogenesis and endothelial hyperpermeability. Nat Med 14, Sun, C.X., Downey, G.P., Zhu, F., Koh, A.L.Y., Thang, H., Glogauer, M. (2004) Rac1 is the small GTPase responsible for regulating the neutrophil chemotaxis compass. Blood 104, Clark, R.A., Volpp, B.D., Leidal, K.G., Nauseef, W.M. (1990) Two cytosolic components of the human neutrophil respiratory burst oxidase traslocate to the plasma membrane during cell activation. J Clin Invest 85, Sun, C.X., Magalhaes, M.A.O., Glogauer, M. (2007) Rac1 and Rac2 differentially regulate actin free barbed end formation downstream of the fmlp receptor. J Cell Biol 179, Li, H.S., Chen, J.H., Wu, W., Fagaly, T., Zhou, L., Yuan, W., Dupuis, S., Jiang, Z.H., Nash, W., Gick, C., Ornitz, D.M., Wu, J.Y., Rao, Y. (1999) Vertebrate slit, a secreted ligand for the transmembrane protein roundabout, is a repellent for olfactory bulb axons. Cell 96,

34 23. Zhang, J., Liu, X., Bell, A., To, R., Nath Berall, T., Azizi, A., Li, J., Cass, B., Durocher, Y. (2009) Transient expression and purification of chimeric heavy chain antibodies. Protein Expr Purif 65, Shi, C., Shin, Y.-O., Hanson, J., Cass, B., Loewen, M.C., Durocher, Y. (2005) Purification and characterization of a recombinant G-protein-coupled receptor, Saccharomyces cerevisiae Ste2p, transiently expressed in HEK203 EBNA1 cells. Biochemistry 44, Durocher, Y., Perret, S., Kamen, A. (2002) High-level and high-throughput recombinant protein production by transient transfection of suspension-growing human 293-EBNA1 cells. Nucleic Acids Res 30, E Moore, K.J., Andersson, L.P., Ingalls, R.R., Monks, B.G., Li, R., Arnaout, M.A., Golenbock, D.G., Freeman, M.W. (2000) Divergent responses to LPS and bacteria in CD14-deficient murine macrophages. J Immunol 165, Robinson, L.A., Nataraj, C., Thomas, D.W., Cosby, J.M., Griffiths, R., Bautch, V.L., Patel, D.D., Coffman, T.M. (2003) The chemokine CX3CL1 regulates NK cell activity in vivo. Cellular Immunol 225, Robinson, L.A., Nataraj, C., Thomas, D.W., Howell, D.N., Griffiths, R., Bautch, V., Patel, D.D., Feng, L., Coffman, T.M. (2000) A role for fractalkine and its receptor (CX3CR1) in cardiac allograft rejection. J Immunol 165, Yan, M., Di Ciano-Oliveira, C., Grinstein, S., Trimble, W.S. (2007) Coronin function is required for chemotaxis and phagocytosis in human neutrophils. J Immunol 178,

35 30. Veldkamp, K.E., Heezius, H.C.J.M., Verhoef, J., van Strijp, J.A.G., Van Kessel, K.P.M. (2000) Modulation of neutrophil chemokine receptors by Staphylococcus aureus supernate. Infect Immun 68, Crawford, M.A., Aylott, C.V., Bourdeau, R.W., Bokoch, G.M. (2006) Bacillus anthracis toxins inhibit human neutrophil NADPH oxidase activity. J Immunol 176, Fickl, H., Theron, A.J., Anderson, R., Mitchell, T.J., Feldman, C. (2007) Palladium attenuates the pro-inflammatory interactions of C5a, interleukin-8 and pneumolysin with human neutrophils. J Immunotoxicol 4, Magalhaes, M.A.O., Zhu, F., Sarantis, H., Gray-Owen, S.D., Ellen, R.P., Glogauer, M. (2007) Expression and translocation of fluorescent-tagged p21-activated kinase-binding domain and PH domain of protein kinase B during murine neutrophil chemotaxis. J Leukoc Biol 82, Srinivasan, S., Wang, F., Glavas, S., Ott, A., Hofmann, F., Aktories, K., Kalman, D., Bourne, H.R. (2003) Rac and Cdc42 play distinct roles in regulating PI(3,4,5)P3 and polarity during neutrophil chemotaxis. J Cell Biol 160, Hayashi, H., Aharonovitz, O., Alexander, R.T., Touret, N., Furuya, W., Orlowski, J., Grinstein, S. (2008) Na+/H+ exchange and ph regulation in the control of neutrophil chemokinesis and chemotaxis. Am J Physiol Cell Physiol 294, C526-C Gardiner, E.M., Pestonjamasp, K.N., Bohl, B.P., Chamberlain, C., Hahn, K.M., Bokoch, G.M. (2002) Spatial and temporal analysis of Rac activation during live cell chemotaxis. Curr Biol 12,

36 37. Glogauer, M., Hartwig, J.H., Stossel, T.P. (2000) Two pathways through Cdc42 couple the N-formyl receptor to actin nucleation in permeabilized human neutrophils. J Cell Biol 150, Barkalow, K., Witke, W., Kwiakowski, D.J., Hartwig, J.H. (1996) Coordinated regulation of platelet actin filament barbed ends by gelsolin and capping protein. J Cell Biol 134, Benard, V., Bohl, B.P., Bokoch, G.M. (1999) Characterization of Rac and Cdc42 activation in chemoattractant-stimulated human neutrophils using a novel assay for active GTPases. J Biol Chem 274, de Haas, C.J.C., Veldkamp, K.E., Peschel, A., Weerkamp, F., Van Wamel, W.J.B., Heezius, E.C.J.M., Poppelier, M.J.J.G., Van Kessel, K.P.M., van Strijp, J.A.G. (2004) Chemotaxis inhibitory protein of Staphylcoccus aureus, a bacterial antiinflammatory agent. J Exp Med 199, Bajt, M.L., Farhood, A., Jaeschke, H. (2001) Effects of CXC chemokines on neutrophil activation and sequestration in hepatic vasculature. Am J Physiol Gastrointest Liver Physiol 281, G1188-G Clark, K., Hammond, E., Rabbitts, P. (2002) Temporal and spatial expression of two isoforms of the Dutt1/Robo1 gene in mouse development. FEBS Letters 523, Glogauer, M., Marchal, C.C., Zhu, F., Worku, A., Clausen, B.E., Foerster, I., Marks, P., Downey, G.P., Dinauer, M., Kwiakowski, D.J. (2003) Rac1 deletion in mouse neutrophils has selective effects on neutrophil function. J Immunol 170, Condeelis, J. (2001) How is actin polymerization nucleated in vivo? Trends Cell Biol 11,

37 45. Ichetovkin, I., Grant, W., Condeelis, J. (2002) Cofilin produces newly polymerized actin filaments that are preferred for dendritic nucleation by the Arp/3 complex. Curr Biol 12, Huang, T.Y., DerMardirossian, C., Bokoch, G.M. (2006) Cofilin phosphatases and regulation of actin dynamics. Curr Opin Cell Biol 18, Li, S., Yamauchi, A., Marchal, C.C., Molitoris, J.K., Quilliam, L.A., Dinauer, M.C. (2002) Chemoattractant-stimulated Rac activation in wild-type and Rac2-deficient murine neutrophils: preferential activation of Rac1 and Rac2 gene dosage effect on neutrophil functions. J Immunol 169, Quinn, M.T., Evans, T., Loetterle, L.R., Jesaitis, A.J., Bokoch, G.M. (1993) Translocation of Rac correlates with NADPH oxidase activation. Evidence for equimolar translocation of oxidase components. J Biol Chem 268, Coxon, P.Y., Rane, M.J., Uriarte, S., Powell, D.W., Singh, S., Butt, W., Chen, Q., McLeish, K.R. (2003) MAPK-activated protein kinase-2 participates in p38 MAPKdependent and ERK-dependent functions in human neutrophils. Cell Signal 15, Hannigan, M., Zhan, L., Li, Z., Ai, Y., Wu, D., Huang, C.-K. (2002) Neutrophils lacking phosphoinositide 3-kinase gamma show loss of directionality during N-formyl-Met-Leu- Phe-induced chemotaxis. Proc Natl Acad Sci USA 99, Heit, B., Tavenere, S., Raharjo, E., Kubes, P. (2002) An intracellular signaling hierarchy determines direction of migration in opposing gradients. J Cell Biol 159, Zu, Y.-L., Qi, J., Gilchrist, A., Fernandez, G.A., Vazquez-Abad, D., Kreutzer, D.L., Huang, C.-K., Sha'afi, R.I. (1998) p38 mitogen-activated protein kinase activation is 36

38 required for human neutrophil function triggered by TNF-alpha or fmlp stimulation. J Immunol 160, Kaminski, K.A., Bonda, T.A., Korecki, J., Musial, W.J. (2002) Oxidative stress and neutrophil activation- the two keystones of ischemia/reperfusion injury. Int J Cardiol 86, Sehr, P., Joseph, G., Genth, H., Just, I., Pick, E., Aktories, K. (1998) Glucosylation and ADP ribosylation of rho proteins: effects of nucleotide binding, GTPase activity, and effector coupling. Biochemistry 37, Weiner, O.D., Rentel, M.C., Ott, A., Brown, G.E., Jedrychowski, M., Yaffe, M.B., Gygi, S.P., Cantley, L.C., Bourne, H.R., Kirschner, M.W. (2006) Hem-1 complexes are essential for Rac activation, actin polymerization, and myosin regulation during neutrophil chemotaxis. PLoS Biol 4, e Weiner, O.D., Marganski, W.A., Wu, L.F., Altschuler, S.J., Kirschner, M.W. (2007) An actin-based wave generator organizes cell motility. PLoS Biol 5, e Gu, Y., Filippi, M.-D., Cancelas, J.A., Siefring, J.E., Williams, E.P., Jasti, A.C., Harris, C.E., Lee, A.W., Prabhakar, R., Atkinson, S.J., Kwiakowski, D.J., Williams, D.A. (2003) Hematopoietic cell regulation by Rac1 and Rac2 guanosine triphosphatases. Science 302, Ronca, F., Andersen, J.S., Paech, V., Margolis, R.U. (2001) Characterization of Slit protein interactions with glypican-1. J Biol Chem 276,

39 Figure Legends Figure 1. Primary human and murine neutrophils express Robo-1. A, Primary human neutrophils were isolated from venous blood of healthy volunteers, RNA was extracted, and RT- PCR was performed using specific primers for Robo-1. For comparison, total RNA was isolated from human leukocytes from whole blood, and RT-PCR similarly performed. B, Cell lysates from primary human neutrophils and bone marrow-derived murine neutrophils were harvested and immunoblotting was performed using anti-robo-1 primary Ab and HRP-conjugated secondary Ab. C, Human neutrophils were plated on fibronectin-coated coverslips and labeled with anti-robo-1 Ab followed by Cy3-conjugated secondary Ab. Cells were examined using a Leica DMIRE2 spinning disc confocal microscope at 100x magnification. Scale bar is 10 µm. Representative image from one of three separate experiments. D, To detect cell surface expression of Robo-1, primary human neutrophils were fixed, incubated with anti-robo-1 Ab followed by PE-conjugated secondary Ab or with secondary Ab alone, and analyzed using a FACScalibur flow cytometer (BD Biosciences) and FlowJo software (Tree Star, Inc., Ashland, OR). Representative image from one of three similar independent experiments. Value indicates % of cells with positive labeling. E, Mouse bone marrow-derived neutrophils were isolated and cell surface Robo-1 labeled as described in D. Representative image from one of three similar independent experiments. Value indicates % of cells with positive labeling. Figure 2. Slit2 inhibits migration of human neutrophils towards diverse chemoattractants. A-D, Primary human neutrophils were incubated with purified Slit2 (4.5 µg/ml) for 10 min at 37 C, then migration assays performed across 3 m Transwell inserts. The lower chamber contained HBSS or Slit2-containing HBSS in the presence or absence of fmlp (1 µm). 38

40 Neutrophils were placed in the upper chamber and Transwell plates incubated for 1 h at 37 C. The insert was removed, and cells which had migrated from the upper to the lower chamber were gently centrifuged onto coverslips and cell nuclei labeled with DAPI to facilitate visualization. Representative high-power (63x) images of migrated cells from four independent experiments were taken using a Leica deconvolution microscope: A, HBSS. B, HBSS with fmlp. C, Slit2 with fmlp. D, Slit2. E, Transwell assays were performed as described above, in the presence of the indicated concentrations of Slit2. Random fields were counted using a Nikon light microscope. Mean number of cells counted per 63x field ± SEM. *, p < 0.001; n=10. F, Transwell migration assays were performed as described above. In the lower chamber was placed either C5a (2 µg/ml) or IL-8 (0.13 µg/ml), in the presence or absence of purified Slit2 (4.5 µg/ml). *, p < 0.001; n = 4. Figure 3: Slit2 inhibits neutrophil chemotaxis. Primary human neutrophils were allowed to settle onto fibronectin-coated coverslips. A micropipette containing fmlp (1 µm) was used to dispense a point-source and gradient of chemoattractant, and neutrophil migration was monitored using time-lapse video microscopy. The cells were maintained on the 37 C-heated stage of a Leica DMIRE2 inverted microscope equipped with a Hamamatsu back-thinned EM-CCD camera and spinning disc confocal scan head. Digital pictures were acquired every 3 s. In some experiments, neutrophils were also exposed to anti-myc Ab affinity-purified Slit2 (0.6 µg/ml). Volocity TM (Improvision) software was used to track the centroid of migrating neutrophils and thus calculate the total distance, net distance and speed of migration. Directionality (displacement/distance) was used as a measure of chemotaxis. A minimum of 8-10 cells for each condition were examined from each of three separate experiments. Two to 3 cells from each 39

41 quadrant were randomly selected prior to initiating tracking. Only cells which started and remained in the field of view over the entire course of video capture were analyzed. A, Migratory tracks from one experiment where neutrophils were exposed to fmlp. X marks the position of the micropipette. B, Migratory tracks from one experiment where neutrophils were exposed to fmlp together with Slit2. X marks the position of the micropipette. Panel inset depicts an enlarged view of the tracks made by a single neutrophil. C, Graph depicting the mean migratory speed of neutrophils exposed to fmlp alone or to fmlp in conjunction with Slit2. Mean values ± SEM for 3 separate experiments. D, Graph depicting the mean directionality of neutrophils exposed to fmlp alone or to fmlp together with Slit2. Mean values ± SEM for 3 separate experiments. *, p < Figure 4: Slit2 inhibits chemoattractant-stimulated formation of actin free barbed ends in human neutrophils. A, Time series analysis of the fluorescence increase associated with actin polymerization. Briefly, 1x10 6 freshly isolated human neutrophils were permeabilized for 10 s with 0.2% OG buffer, and the permeabilization process was stopped by diluting the detergent with 3 vol of buffer B, as described in Materials and Methods. Cells were stimulated with fmlp (1µM) for 120 s in the presence of fplc-enriched Slit2 (0.6 µg/ml) from conditioned medium or control medium. Free barbed end generation was assayed by adding pyrene-labeled rabbit skeletal muscle actin to a final concentration of 1 µm and following the fluorescence increase using a microplate reader (FLUOstaroptima) with fluorescence excitation and emission wavelengths of 355 and 405 nm, respectively. Representative results of four separate experiments are shown. B, Pyrene-actin incorporation was monitored as in (A) for 150s and the change in slope of the curve was used as a measure of the rate of actin polymerization. Mean 40

42 rate of actin polymerization normalized to the unstimulated control ± SEM. *, p < 0.05; **, p < 0.04; ***, p < C, Freshly isolated human and mouse neutrophils were incubated with Slit2 and plated on fibronectin-coated coverslips in a 6 well tissue culture plate. Cells were incubated with fmlp (1 µm) for 3 min, then fixed, permeabilized with 0.1% Triton, and incubated with rhodamine-conjugated phalloidin for 30 min to visualize actin. Cells were examined using a Leica DMIRE2 spinning disc confocal microscope at 100x magnification. Figure 5: Slit2 prevents chemoattractant-induced activation and redistribution of Rac2 and Cdc42. A, Neutrophils were activated with PBS or fmlp (1 µm for 30 s) in the presence or absence of anti-myc Ab affinity-purified Slit2 (0.6 µg/ml), and cell lysates collected. GST beads conjugated to the p21-binding domain of PAK1 were used to pull down activated Cdc42 and Rac and immunoblotting was performed using specific Ab directed against Cdc42 or Rac2. Blots shown are representative of five independent experiments. B, Mean values ± SEM of normalized band intensities from five independent experiments (*p < 0.01; ** p < 0.05). C, Neutrophils were isolated from murine bone marrow as described in Materials and Methods. One million cells were suspended in 100 µl Nucleofector TM solution (Amaxa, Inc.) supplemented with 6 µg cdna for PAK-PBD-YFP and H-Ras-RFP. Cells were transfected using a Cell Line V Nucleofector TM kit and the Nucleofector TM program Y-001. Transfected cells were carefully recovered with 500 µl Iscove s Modified Dulbecco s Medium (IMDM) pre-warmed to 37 C, and transferred to 1.5 ml pre-warmed IMDM supplemented with 10% FBS in six-well plates for 2 h. After the recovery period, cells were incubated with purified Slit2 (4.5 µg/ml) for 10 min. Cells were mounted on a 1% BSA-coated coverslip in an Attafluor cell chamber mounted on the 37 Cheated stage of a Leica DMIRE2 inverted fluorescence microscope quipped with a Hamamatsu 41

43 back-thinned EM-CCD camera and spinning disc confocal scan head. Cells were exposed to a point-source of chemoattractant using a glass micropipette containing fmlp (1 µm). Digital pictures were taken every 3 s for 5 min, and images were acquired and analyzed using Volocity software (Improvision Ltd). Images showing the distribution of PAK-PBD-YFP, H-Ras-RFP, and the resulting GFP-RFP ratio at the leading edge compared to the trailing edge of cells exposed to fmlp alone or fmlp in the presence of Slit2. Arrow indicates the direction of the chemotactic gradient. Images are representative of at least 19 cells analyzed from 3 separate experiments. D, Experiments were performed as described in (C). Mean values ± SEM for the normalized mean fluorescence intensity (MFI), calculated as the GFP:RFP ratio at the leading edge compared to the trailing edge of the cell. A minimum of 19 cells were analyzed from 3 separate experiments. *, p < Figure 6: Slit2 does not inhibit chemoattractant-induced activation of Akt, Erk, or p38- MAPK. A, Neutrophils were incubated with fmlp and/or Slit2, as described for Figure 5A. Cell lysates were collected, and immunoblotting was performed using specific Ab detecting phospho-akt, phospho-erk, and phospho-p38 MAPK. Blots were stripped and re-probed using Ab detecting total Akt, total Erk, and total p38 MAPK, respectively. Blots are representative of 3 independent experiments. B, Band intensities for phospho-akt (p-akt) normalized to total Akt. Mean values ± SEM for 3 independent experiments (*, p < ; **, p < 0.05). C, Band intensities for phospho-erk (p-erk) normalized to total Erk. Mean values ± SEM for 3 independent experiments (**, p < 0.05). D, Band intensities for phospho-p38-mapk (p-p38) normalized to total p38-mapk. Mean values ± SEM for 3 independent experiments. (**, p < 0.05; ***, p < 0.005). 42

44 Figure 7: Slit2 inhibits neutrophil chemotaxis in vivo towards diverse attractant stimuli. A, Adult CD1 mice were injected intraperitoneally with Slit2 (0.1 µg/mouse) or control medium, and 1 h later, with 1 ml of 5 mm sodium periodate (NaIO4). After 3 h, mice were euthanized and the peritoneal exudates collected by lavage with chilled PBS (5 ml/mouse). Infiltrating leukocytes were counted using an electronic cell counter and the number of neutrophils quantified using Wright-Giemsa stain. Mean values ± SEM from 5 separate experiments. *, p < 0.05; **, p < B, Adult CD1 mice received an intravenous dose of purified Slit2 (1.8 µg in 0.2 ml normal saline) by tail-vein injection. One hour later, mice were given 1 ml of NaIO4 (5 mm), C5a (10 µg), or MIP-2 (2.5 µg) by intraperitoneal injection. After 3 h, mice were euthanized and the peritoneal exudates collected by lavage with chilled PBS (5 ml/mouse). Infiltrating leukocytes were counted using an electronic cell counter and the number of neutrophils quantified using Wright-Giemsa stain. Mean values ± SEM from 4 to 6 separate experiments per treatment condition. *, p < 0.001; **, p < Supplementary Figure 1: Recombinant hslit2 purified by size-exclusion chromatography and cobalt-affinity chromatography. A-B, Conditioned medium was harvested from HEK293- hslit2-myc cells and control HEK-293 cells as described in Materials and Methods. Using size-exclusion chromatography, fractionated samples were collected and were run in 8% SDS- PAGE. A, Representative gel for a sample from pooled fractions was silver stained. B, Representative gel, transferred to a PVDF membrane and immunoblotting performed using monoclonal anti-myc Ab. C-D, For larger-scale preparation of Slit2, conditioned medium was harvested from HEK293-EBNA1 cells transfected with ptt28-slit2 expression plasmid, as 43

45 described in Materials and Methods. Slit2 secreted into the medium was purified by immobilized metal-affinity chromatography using Fractogel-cobalt columns. Samples were desalted and immunoblotting performed. Proteins were resolved on reducing NuPAGE 4-12% Bis-Tris gradient gels, and transferred to nitrocellulose membranes. C, Representative membrane, stained with Ponceau red solution. D, Representative membrane, probed with antipolyhis-hrp Ab. For C and D, lanes are marked as follows: 1) harvested medium 5 days posttransfection; 2) IMAC flow-through; 3) Wash1; 4) Wash 2; 5) pooled eluted fractions from Fractogel-cobalt column. Supplementary Figure 2: Measurement and verification of endotoxin levels and activity present in Slit2 preparations. From each separate Slit2 preparation, endotoxin levels were measured using ToxinSensor Chromogenic LAL Endotoxin Assay Kit (GenScript Corp., Piscataway, NJ), according to the manufacturer s specifications. Endotoxin concentrations ranged from EU/ml, corresponding to ng/ml endotoxin, and yielding final experimental concentrations of pg/ml, which are well below those thought to activate leukocytes. To verify this, endotoxin (40 pg/ml) was added to Transwell assays, and effects on neutrophil transmigration examined as described in Materials and Methods and in Figure 2. n=2. Supplementary Figure 3: Slit2 inhibits migration of primary human neutrophils. Primary human neutrophils were incubated with FPLC-enriched Slit2 from conditioned medium (0.6 µg/ml) or with similar fractions from control medium for 10 min at 37 C, then migration assays performed across 3 m Transwell inserts. The lower chamber contained HBSS, control medium 44

46 or Slit2 in the presence or absence of fmlp (1 µm). Neutrophils were placed in the upper chamber and Transwell plates incubated for 1 h at 37 C. The insert was removed, and cells which had migrated from the upper to the lower chamber were gently centrifuged onto coverslips, fixed and random fields were counted using a Nikon light microscope. Representative high-power (63x) images of migrated cells from four independent experiments were taken using a Leica deconvolution microscope. Mean number of cells counted per 63x field ± SEM for 4 independent experiments. (*, p < 0.05). Supplementary Figure 4: Slit2 inhibits directional migration of human neutrophils. Primary human neutrophils were allowed to settle onto fibronectin-coated coverslips. A micropipette containing fmlp (1 µm) was used to dispense a point-source and gradient of chemoattractant, and neutrophil migration was monitored using time-lapse video microscopy at 37 C. A-C, Migration of neutrophils exposed to a gradient of fmlp over the course of 5 minutes. D-F, Migration of neutrophils exposed to a gradient of fmlp together with Slit2 (0.6 µg/ml) over 5 minutes. Representative images from one of five separate experiments. for 4 independent experiments. (*, p < 0.05). Supplementary Video 1. Human neutrophils migrate effectively towards a point source of fmlp. Glass coverslips were coated with fibronectin, mounted in a Leiden chamber, and placed on the heated stage of a microscope. A suspension of human neutrophils containing 10 6 cells/ 100 µl was added and allowed to settle for 10 min. To induce chemotaxis, a point-source of fmlp (1 µm) was delivered using a borosilicate capillary micropipette. The pipette was held stationary and diffusion of fmlp generated a standing gradient. Images were acquired using 45

47 MetaMorph software (Universal Imaging, West Chester, PA) running on a Dell Optiplex DGX 590 computer interfaced with a Photometrics camera via a 12-bit GPIB/IIA board (National Instruments, Foster City, CA). Image acquisition was started upon the pipette entering the field and images were obtained every 10 s until completion of the experiment. Representative video from one of five separate experiments. Supplementary Video 2. Slit2 inhibits directional migration of human neutrophils towards a point source of fmlp. Experiments were performed as described in Supplementary Video 1. Neutrophils were also exposed to anti-myc Ab affinity-purified Slit2 (0.6 µg/ml) and cell migration was monitored by time-lapse videomicroscopy. Representative video from one of five separate experiments. Supplementary Table 1. Leukocyte subsets recovered from peritoneal lavage fluid following sodium periodate-induced peritonitis. Adult CD1 mice received an intravenous dose of purified Slit2 (1.8 µg in 0.2 ml normal saline) by tail-vein injection. One hour later, mice were given 1 ml of NaIO4 (5 mm) by intraperitoneal injection. After 3 h, mice were euthanized and the peritoneal exudates collected by lavage with chilled PBS (5 ml/mouse). The total number of cells was counted, and the numbers of monocytes/macrophages, T lymphocytes, B lymphocytes, and natural killer cells determined by labeling with Ab directed to F4/80, CD3, B220, and NK1.1, respectively, followed by PE-conjugated secondary Ab. Flow cytometry was performed using a FACScalibur flow cytometer and FlowJo software. Mean values ± SEM from 4 separate experiments. 46

48 LA Robinson: Figure 1 A 300 bp ladder no RNA template no RT Neutrophil Leukocyte B kda Human Mouse C D 400 E Control Robo Control 76.2 Robo

49 LA Robinson: Figure 2 Unstimulated fmlp fmlp + Slit2 Slit2 A B C D E 350 No. neutrophils per field Slit2 (µg/ml) fmlp F 140 No. neutrophils per field * * * * 0 Unstimulated IL-8 IL-8 + Slit2 C5a C5a + Slit2 Slit2

50 LA Robinson: Figure 3 A Distance in Y ( m) C Mean speed ( m / min) Distance in X ( m) fmlp fmlp+slit2 B Distance in Y ( m) D Mean directionality (displacement / distance) Distance in Y ( m) * Distance in X ( m) fmlp fmlp+slit2

51 LA Robinson: Figure 4 A Fluorescence units (AU) unstimulated fmlp control + fmlp Slit2 + fmlp B Mean rate of actin polymerization (normalized to unstimulated) ** Time (seconds) *** unstimulated fmlp Slit2+fMLP control+fmlp * C Unstimulated fmlp Slit2 + fmlp Human Mouse