Anti-adipogenic Effects of Corni Fructus in 3T3-L1 Preadipocytes
|
|
- Toby Edwards
- 5 years ago
- Views:
Transcription
1 Biotechnology and Bioprocess Engineering 19: (2014) DOI /s RESEARCH PAPER Anti-adipogenic Effects of Corni Fructus in 3T3-L1 Preadipocytes Chang-Ho Kang, Yoon-Jung Kwon, and Jae-Seong So Received: 8 July 2013 / Revised: 28 October 2013 / Accepted: 2 November 2013 The Korean Society for Biotechnology and Bioengineering and Springer 2014 Abstract Obesity is the most common health problem in developed countries and is considered a significant risk factor for many major human diseases. The goal of the present study was to evaluate the inhibitory effect of herbal extracts on adipocyte differentiation in 3T3-L1 preadipocytes. We screened the extracts of 30 plants, used in traditional medicine to test their effects against obesity. Among the tested extracts, Corni fructus ethanolic extract (CFEE), significantly inhibited adipocyte differentiation by more than 80% in 3T3-L1 preadipocytes in a dose-dependent manner. The level of adipogenesis in the 3T3-L1 cells was measured by Oil Red O staining and the triglyceride content assay. Furthermore, CFEE inhibited adipocyte differentiation by suppressing the expression of the adipogenic transcription factors CCAAT/enhancer binding protein (C/EBP) and peroxisome proliferator-activated receptor (PPAR), as confirmed by reverse transcription-polymerase chain reaction (RT-PCR) analysis. These results suggest that CFEE inhibits adipogenesis by suppressing the expression of adipogenic transcription factors. Keywords: adipogenesis, adipocyte, 3T3-L1, corni fructus 1. Introduction In spite of the current public awareness of obesity, its prevalence continues to increase. Obesity is the most common health problem in developed countries and is Chang-Ho Kang, Jae-Seong So * Department of Biological Engineering, Inha University, Incheon , Korea Tel: ; Fax: sjaeseon@inha.ac.kr Yoon-Jung Kwon Department of Organic and Nano System Engineering, Konkuk University, Seoul , Korea considered a significant risk factor for many major human diseases such as heart disease, cancer, arthritis, and diabetes [1]. The development of obesity is characterized by an increase in the number of fat cells and their lipid content as a result of adipocyte differentiation (adipogenesis). The primary role of the adipocytes involves the synthesis and storage of triglycerides during periods of caloric excess. As a result of adipogenesis, the size or number of fat cells increases and lipid drops accumulate [1]. Thus, preadipocyte cell lines are useful models for investigating the adipogenic process. An enhanced understanding of the process of adipogenesis would help prevent the initiation and progression of adipogenesis, which leads to obesity and obesity-related diseases in humans. Adipogenesis involves the induction and repression of a number of genes in a programmed manner [2]. The sequential expression of specific transcription factors, such as those of the CCAAT/enhancer-binding protein (C/EBP-α) and peroxisome proliferation activating receptor (PPAR-γ) families, plays a key role in the intracellular mechanisms involved in the early stage of adipogenesis. During adipogenesis, C/EBP-β expression is rapidly induced by hormonal stimulation, and it functions to regulate PPAR-γ transcription. PPAR-γ is a ligand-activated transcription factor and is a member of a nuclear receptor superfamily; its overexpression enhances adipogenesis in vitro. PPAR-γ is also known to promote the expression of an array of genes involved in the maturation of adipocytes [3]. The fructus of Cornus officinalis Sieb. et Zucc. (Corni fructus) has traditionally been used in medicinal practices in Korea. The major chemical constituents of Corni fructus include saponins, phenolic acids (gallic acid and tannic acid), and loganin [4]. Saponins and phenolic acids are known to have antioxidant activity [5]. Recently, it was reported that Corni fructus was beneficial in models of advanced glycation end product-mediated renal injury in streptozotocin (STZ)-treated diabetic rats [6] and db/db
2 Anti-adipogenic Effects of Corni Fructus in 3T3-L1 Preadipocytes 53 mice [7]. Therefore, in this study, 30 traditional herbs were selected through a literature review and evaluated for their antiadipogenic activity. Among these 30 herbs, Corni fructus was found to effectively inhibit adipocyte differentiation in terms of morphology and gene expression. 2. Materials and Methods 2.1. Chemicals Dulbecco s modified Eagle medium (DMEM), fetal bovine serum (FBS), and insulin were obtained from Gibco BRL (Grand Island; NY, USA). Dimethyl sulfoxide (DMSO), dexamethasone, isobutylmethylxanthine (IBMX), Oil Red O, free-glycerol reagent, (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT), TG assay kit, and TRIzol reagent were purchased from Sigma Chemical Co. (St. Louis, MO, USA). The BrdU proliferation assay kit was purchased from Invitrogen (Carlsbad, CA, USA). All other chemicals were of analytical grade or equivalent and were purchased commercially Sample preparation Dried herbs were purchased from the Kyungdong Oriental Herbal Market in Korea. Each herb (50 g) was crushed and extracted 3 times with 95% ethanol at room temperature using a shaking incubator for 24 h (Table 1). The supernatant was filtered and evaporated in a vacuum below 45 C using a rotary evaporator (EYELA Ltd.; Kyoto, Japan). Each extract was suspended in DMSO and stored at 4 C until further use. Table 1. Inhibition of adipocyte differentiation by various herbal extracts Botanical origin Scientific name Used part Yield (%) Inhibition (%) * Corni fructus Cornus officinalis Sieb.et Zucc. fruit ± 1.35 Pinellia rhizome Pinellia ternata Thunberg Breit. root ± 1.50 Paeoniae Radix Paeonia lactiflora Pall. root ± 1.31 Pericarpium citri Citrus unshiu Markovich. pericarp ± 1.81 Schisandra chinensis Schisandra chinensis Baill. fruit ± 2.76 Atractylodes japonica Atractylodes japonica Koidz. root ± 1.90 Morus alba Morus alba L. bark ± 1.21 Polygoni multiflori caulis Polygonum multiflorum Thunb. root ± 1.23 Scutellaria radix Scutellaria baicalensis Georgi. root ± 1.21 Folium perillae Perillae folium leaves ± 1.31 Crataegi fructus Crataegus pinnatifida Bunge. fruit ± 1.31 Radix astragali Astragalus membranaceus Bunge root ± 2.71 Radix platycodi Platycodon grandiflorum A. DC. root ± 1.26 Siegesbeckiae herba Siegesbeckia glabrescens Makino leaves ± 1.46 Semen coicis Coix lachryma-jobi var. ma-yuen fruit ± 1.50 Carthamus tinctorius Carthamus tinctorius L. flower ± 1.51 Ephedra sinica Ephedra sinica Stapf. stem ± 1.27 Alismatis rhizoma Alisma plantago-aquatica var. orientale root ± 1.20 Rheum undulatum Rheum undulatum L. stem ± 1.36 Semen Phaseoli Phaseoli angularis Wight fruit ± 1.76 Mori fructus Morus alba L. fruit ± 1.38 Radix Glycyrrhizae Glycyrrhiza uralensis Fisch. root ± 1.44 Pinus densiflora Pinus densiflora Sieb. et Zuccarini leaves ± 1.15 Japanese persimmon Diospyros kaki Thunb. leaves ± 1.12 Artemisia capillaris Artemisia capillaris Thunberg. leaves ± 1.70 Flos Chrysanthemi Chrysanthemum morifolium leaves ± 1.46 Eriobotryae folium Eriobotrya japonica Lindl. leaves ± 1.25 Dendrobium nobile Dendrobium nobile Lindl. stem ± 1.16 Folium Phyllostachys Phyllostachys niger M. var. Henonis leaves ± 1.57 Semen Cassiae Cassia tora L. fruit ± 2.12 The inhibition data of the extracts from herbs are presented as the mean ± S.D., and inhibited adipocyte differentiation activity was examined at a concentration of 250 µg/ml. * The inhibitory rate (%) was defined as follows: [(sample OD control OD)/(MDI OD Control OD)] 100.
3 54 Biotechnology and Bioprocess Engineering 19: (2014) 2.3. Cell differentiation and sample treatment 3T3-L1 preadipocytes were purchased from American Type Culture Collection (ATCC) and cultured in DMEM supplemented with 10% (v/v) heat-inactivated FBS at 37 C in an atmosphere containing 5% CO 2. To induce adipocyte differentiation, 2-day post-confluent 3T3-L1 preadipocytes (day 0) were stimulated for 48 h (day 2) with a standard induction cocktail (0.5 mm 3-isobutyl-1-methylxanthine, 1 µm dexamethasone, and 1 µg/ml insulin; MDI) and herbal extracts (250 µg/ml), and then maintained for 4 days (day 6) in DMEM supplemented with 10% FBS and 1 µg/ml insulin. To examine the effects of the herbal extracts on adipocyte differentiation, the medium was treated every 2 day, until the end of the experiment on day 8. In the control experiments, cells were cultured in the same media containing a drug-free vehicle and baicalin (100 µm), which has been reported to be an adipogenesis inhibitor [8], which were used as a positive control Cell viability and Oil Red O staining Cell viability was assessed using the MTT assay [9]. 3T3- L1 preadipocytes were treated with Corni fructus ethanolic extracts (CFEE) at concentrations of 50, 100, and 200 µg/ml. After 24 h, 20 µl of MTT solution was added, and cells were incubated at 37 C for 4 h. The supernatant was then removed, and 200 µl of DMSO was added. Absorbance was measured on a microplate reader (Bio-Rad Model 550; Hercules, CA, USA) at 546 nm to obtain the percentage of viable cells. Eight days after inducing differentiation, the media was removed, and the cells were washed twice with phosphate-buffered saline (PBS) and fixed with 3.7% formalin for 15 min. To visualize the lipid droplets, the fixed cells were washed twice with 60% isopropanol (in PBS) and then stained with a 0.5% Oil Red O solution for 40 min at room temperature. The Oil Red O solution was then removed and the cells were washed twice with deionized water before being photographed. For quantification of Oil Red O uptake, cells were incubated with isopropanol, and the optical density of the solution was measured at 540 nm Measurement of triglyceride (TG) and glycerol The cellular TG content was measured using a commercial TG assay kit according to the manufacturer s instructions. In 6-well plates, cells were treated with plant extracts at a concentration of 100 µg/ml during adipocyte differentiation over 4 days. The cells were washed twice with PBS, suspended in 80 µl of a homogenizing solution (154 mm KCl, 1 mm ethylenediaminetetraacetic acid (EDTA), and 50 mm Tris; ph 7.4), and sonicated to homogenize the cell suspension. The residual cell lysate was centrifuged at 3,000 g for 5 min at 25 C to remove the fat layers. The supernatants were assayed to measure the TG and protein levels. TG was normalized to the protein concentration, which was determined by the Bradford assay using bovine serum albumin (BSA) as the standard. The results were expressed in milligrams of TG per milligram of cellular protein (TG (mg)/cellular protein (mg)). Lipolysis was assessed by determining the amount of glycerol released into the medium, according to the manufacturer s instructions. Specifically, differentiated 3T3-L1 adipocytes were treated with plant extracts for 24 h. After incubation, 80 µl of the medium was incubated with 120 µl of the free glycerol reagent for 15 min at room temperature. Glycerol levels were quantified by measuring the absorbance at 590 nm Reverse transcription-polymerase chain reaction (RT-PCR) analysis Total RNA was isolated from mature adipocytes (day 8) using TRIzol reagent. Reverse transcription was performed using a Superscript Preamplification System (Roche; Indianapolis, IN, USA) to synthesize first-strand cdna according to the manufacturer s instructions. Reverse transcription was performed at 45 C for 30 min and then at 94 C for 5 min to inactivate the reverse transcriptase. The following primers were used: PPARγ (forward): 5'-ACCACTCGC ATTCCTTTGAC-3', PPARγ (reverse): 5'-TCAGCGGGA AGGACTTTATG-3', C/EBPα (forward): 5'-ATGGAGTCG GCCGA CTTCTAC-3', C/EBPα (reverse): 5'-CAGGAA CTCGTCGTTGAAGGC-3', GAPDH (forward): 5'-AAC TTTGGCATTGTG GAAGGGC-3', GAPDH (reverse): 5'- GACACA TTGGGGGTAGGAACAC-3' (Bioneer, Korea). C/EBPα and PPARγ amplifications were performed by denaturing at 94 C for 30 sec, annealing at 55 C for 30 sec, extension at 72 C for 1 min for 25 cycles, followed by a final extension at 72 C for 5 min. The PCR products were loaded onto 1% agarose gels, stained with ethidium bromide, and visualized under UV light [10] BrdU proliferation assay Cell proliferation was assayed by BrdU staining. A cell proliferation assay kit was used to detect BrdU incorporation into the newly synthesized DNA of proliferating cells. Cells were fixed with 4% paraformaldehyde in PBS and cryoprotected with primary anti-brdu monoclonal antibody (1:200) in 10% normal goat serum overnight at 4 C. Goat anti-mouse Ig conjugated to fluoresce in isothiocyanate (No. F1010; Sigma; 1:500) were used as secondary antibodies. Propidium iodide (No. P4170; Sigma) staining was performed in PBS for 5 min. Images were taken using a Fluorescence Stereomicroscope (M165FC; Leica Ltd.) equipped with an Optronics CCD camera Statistical analysis The results are expressed as the means ± S.D. of three
4 Anti-adipogenic Effects of Corni Fructus in 3T3-L1 Preadipocytes 55 experiments. Statistical analysis was performed by the Student s t-test, and a p value of < 0.05 was considered to indicate a significant difference. 3. Results and Discussion 3.1. Inhibitory effect of 30 herbal extracts on adipocyte differentiation Adipocyte differentiation is a very complex process involving whole-cell changes, and is triggered by coordinated signaling by growth factors, cytokines, and hormones [2]. In this study, we screened the extracts of 30 herbs to test their potential anti-adipogenic activity. 3T3-L1 adipocytes were cultured and differentiated in DMEM containing 10% FBS for 6 ~ 8 day in the absence or presence of the extracts (at a final concentration of 250 µg/ml) according to the differentiation protocols. As shown in Table 1, CFEE had the highest inhibitory effect (87.11 ± 1.35%) on adipogenesis of 3T3-L1 preadipocytes, as assessed by intracellular triglyceride droplet staining with Oil Red O. In addition, extracts of Atractylodis japonica (87.02 ± 1.90%) and Rheum undulatum (82.42 ± 1.36%) displayed high inhibitory effects of more than 80%. These 3 extracts significantly suppressed lipid accumulation, and their inhibitory effect was higher than that of baicalin (100 µm). Conversely, extracts from Pinus densiflora ( ± 1.15%), Flos Chrysanthemi ( ± 1.46%), Mori Fructus ( ± 1.38%), Artemisia capillaries ( ± 1.70%), Pinellia rhizome ( 6.41 ± 1.50%), Pericarpium Citri ( 2.16 ± 1.81%), and Carthamus tinctorius ( 2.06 ± 1.51%) enhanced adipogenesis. As CFEE significantly inhibited adipocyte differentiation (by over 80%), we chose to further examine this herb extract. Previous research has shown that some flavonoids (including phloretin and nobiletin) enhance adipocyte differentiation in 3T3-L1 cells [11,12] Inhibitory effects of CFEE on cell viability and 3T3-L1 cell differentiation The effect of CFEE on cell viability in both preadipocytes and mature adipocytes was demonstrated by using the MTT assay (Fig. 1). CFEE displayed low toxicity in 3T3- L1 preadipocyte and mature adipocyte cultures, with the cell viability remaining at approximately 80 ~ 100%. In Fig. 2A, the effects of CFEE on lipid droplet formation in 3T3-L1 cells are presented by quantifying the amount of Oil Red O staining. Incubation of 3T3-L1 cells with 25, 50, 100, and 200 µg/ml CFEE decreased the lipid droplet amounts by 21, 72, 83, and 85%, respectively. Thus, CFEE Fig. 1. Effect of Corni fructus ethanolic extract (CFEE) on viability of 3T3-L1 cells. 3T3-L1 preadipocytes were differentiated into mature adipocytes as described in Materials and Methods. The cell viability was measured by using the MTT assay. (A) Preadipocytes; (B) mature adipocytes. Fig. 2. Effect of CFEE on Oil Red O staining in cultured 3T3-L1 cells. (A) Effect of CFEE on fat droplet formation in 3T3-L1 cells. The cells were stained with Oil Red O dye and examined under a light microscope. (B) Relative lipid content obtained by counting Oil Red O stained cells. Data are presented as mean ± S.D. (n = 3). * indicates p < 0.05.
5 56 Biotechnology and Bioprocess Engineering 19: (2014) Fig. 3. Effect of different concentrations of CFEE on lipid accumulation in differentiated 3T3-L1 cells. (A) Preadipocytes were treated with no additives (control) or in the presence of CFEE of different concentrations. # p < 0.05 compared with control; * p < 0.05 compared with MDI-treated group. was found to significantly reduce lipid accumulation in 3T3-L1 adipocytes, suggesting an anti-obesity effect. These results directly indicate that CFEE inhibits lipid deposition in a dose-dependent manner without causing cytotoxic effects. Adipose tissue is composed of adipocytes that store TG as a fuel for the body. Approximately 80 ~ 90% of the wet weight of adipocytes consists of TG. In order to understand adipocyte physiology, a mouse fibroblast cell line (3T3-L1 cells) has been widely used. Differentiation of 3T3-L1 cells is essential for optimal adipocyte formation [13,14]. As shown in Fig. 3, lipid accumulation was measured based on the TG content of 3T3-L1 cells differentiated in the presence of CFEE. The amount of TG in 3T3-L1 cells treated with 100 and 200 µg/ml CFEE was decreased by approximately 38 and 43%, respectively. Treatment of 3T3-L1 cells with CFEE was found to significantly decrease cell differentiation and TG accumulation in a dose-dependent manner CFEE inhibits the expression of C/EBP-α and PPAR-γ Several transcription factors that act in a sequential fashion to promote adipocyte differentiation have been identified [15]; these include members of the C/EBP and PPAR families [14,16]. For adipogenesis, the sequential expression of several genes must occur in a coordinated and temporal pattern. For example, C/EBP-β and C/EBP-γ mediate the transcriptional activation of PPAR-γ and C/EBP-α [17]. To investigate whether CFEE suppresses adipogenesis at a transcriptional level, we extracted total RNA from differentiated 3T3-L1 cells treated with increasing concentrations of CFEE (50, 100, and 200 µg/ml), and performed RT-PCR. As shown in Fig. 4A, PPAR-γ mrna expression was Fig. 4. Effect of CFEE on (A) mrna expression of CCAAT/ enhancer binding protein (C/EBP)-α and peroxisome proliferatoractivated receptor (PPAR)-γ and (B) cell proliferation. reduced by up to 41.2%, and C/EBP-α mrna expression was decreased by up to 75.9%. These observations suggest that CFEE can suppress adipogenesis at the mrna level. The results from cdna quantifications suggest that CFEE might stimulate cell proliferation. C/EBP proteins (C/EBP α, β, and γ) belong to the basic leucine zipper family of transcription factors, whereas PPAR-γ is a member of the nuclear receptor superfamily of transcription factors and is predominantly expressed in adipose tissue. These transcription factors appear to function as dominant activators of adipocyte differentiation [13]. PPAR-γ is induced prior to the transcriptional activation of most adipocyte-specific genes. The expression of PPAR-γ is sufficient to induce growth arrest and to initiate adipogenesis in exponentially growing fibroblast cell lines [18]. In addition, it was reported that the transcription factor C/EBP-α is a likely candidate for directly regulating adipocyte differentiation [19]. To confirm this, we used BrdU to monitor DNA replication (Fig. 4B). In the untreated cultures, a small percentage of cells were BrdU-positive. Treatment with CFEE resulted in a marked increase in the number of BrdU-positive cells. This result indicates that 3T3-L1 cell proliferation was increased in the CFEE-treated cultures more than in the untreated cultures. In conclusion, the results of this study show that CFEE has considerable anti-adipogenic activity, which is directly proportional to its concentration. CFEE suppresses the expression of specific genes associated with adipogenesis, and can be used as an alternative phytochemical or therapeutic
6 Anti-adipogenic Effects of Corni Fructus in 3T3-L1 Preadipocytes 57 agent. Further studies will be conducted to identify the active components of CFEE. Acknowledgement This study was supported by the Inha University Research Grant. References 1. Hwang, J. H., S. W. Lee, K. H. Han, H. J. Seo, and J. D. Kim (2013) Anti-angiogenesis and Anti-adipogenesis effects of Anthrisci radix extract. Biotechnol. Bioproc. Eng. 18: Cristancho, A. G. and M. A. Lazar (2011) Forming functional fat: A growing understanding of adipocyte differentiation. Nat. Rev. Mol. Cell Biol. 12: Moon, H. S., D. D. Guo, H. H. Song, I. Y. Kim, H. L. Jin, and Y. K. Kim (2007) Regulation of adipocyte differentiation by PEGylated all-trans retinoic acid; reduced cytotoxicity and attenuated lipid accumulation. J. Nutr. Biochem. 18: Park, C. H., T. Tananka, J. H. Kim, E. J. Cho, J. C. Park, N. Shibahara, and T. Yokozawa (2011) Hepato-protective effects of loganin, iridoid glycoside from Corni Fructus, against hyperglycemia-activated signaling pathway in liver of type 2 diabetic db/ db mice. Toxicol. 290: Xi, M., H. Tang, M. Chen, K. Fang, and L. Liang (2008) Antioxidant and antiglycation properties of total saponins extracted from traditional Chinese medicine used to treat diabetes mellitus. Phytother. Res. 22: Gao, D., Q. Li, Z. Gao, and L. Wang (2012) Antidiabetic effects of Corni Fructus extract in Streptozotocin-induced diabetic rats. Younsei. Med. J. 53: Yamabe, N., K. S. Kang, E. Goto, T. Tanaka, and T. Yokozawa (2007) Beneficial effect of Cornus Fructus, a constituent of Hachimi-jio-gan, on advanced glycation end-product-mediated renal injury in streptozotocin-treated diabetic rats. Biol. Pharm. Bull. 30: Guo, X. and K. Liao (2000) Analysis of gene expression profile during 3T3-L1 preadipocyte differentiation. Gene. 251: Yang, Z., Y. Tu, H. Xia, G. Jie, X. Chen, and P. He (2007) Suppression of free-radicals and protection against H 2 O 2 -induced oxidative damage in HPF-1 cell by oxidized phenolic compounds present in black tea. Food Chem. 105: Kim, H. J. and Y. C. Kim (2010) Antidiabetic and renoprotective effects of Corni fructus extract in db/db mice. Mol. Cell. Toxicol. 6: Chen, L., T. He, Y. Han, J. Z. Sheng, S. Jin, and M. W. Jin (2011) Pentamethylquercetin improves adiponectin expression in differentiated 3T3-L1 cells via a mechanism that implicates PPARγ together with TNF-α and IL-6. Molecules 16: Saito, T., D. Abe, and K. Sekiya (2007) Nobiletin enhances differentiation and lipolysis of 3T3-L1 adipocyte. Biochem. Biophys. Res. Commun. 357: Lefterova, M. I. and M. A. Lazar (2009) New developments in adipogenesis. Trends Endocrinol. Metab. 20: Yim, M. J., M. Hosokawa, Y., Mizushina, H., Yoshida, Y. Saito, and K. Miyashita (2011) Suppressive effects of amarouciaxanthin A on 3T3-L1 adipocyte differentiation through down-regulation of PPARγ and C/EBPα mrna expression. J. Agric. Food Chem. 59: Hu, E., P. Tontonoz, and B. M. Spiegelman (1995) Transdifferentiation of myoblasts by the adipogenic transcription factors PPARg and C/EBPa. Proc. Natl. Acad. Sci. USA. 92: Rosen, E. D. and O. A. MacDougald (2006) Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell. Biol. 7: Cousin, W., C. Dani, and P. Peraldi (2006) Inhibition of anti-adipogenic Hedgehog signaling pathway by cycloplamine does not trigger adipocyte differentiation. Biochem. Biophys. Res. Commun. 349: Zhang, X., M. Wu, W. Zhang, J. Shen, and H. Liu (2010) Differentiation of human adipose-derived stem cells induced by recombinantly expressed fibroblast growth factor 10 in vitro and in vivo. In vitro Cell. Dev. Biol. Anim. 46: Norifumi, K., B. K. Dan, A. Kinji, N. Kazuki, M. Yukiko, S. Shuichi, and Y. Katsutoshi (2001) Characterization of a stellate cell activation-associated protein (STAP) with peroxidase activity found in rat hepatic stellate cells. J. Biol. Chem. 276:
ab Adipogenesis Assay Kit (Cell-Based)
ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended
More informationResearch Article Inhibitory Effects of 4-(4-Methylbenzamino)benzoate on Adipocyte Differentiation
Chemistry Volume 2015, Article ID 171570, 4 pages http://dx.doi.org/10.1155/2015/171570 Research Article Inhibitory Effects of 4-(4-Methylbenzamino)benzoate on Adipocyte Differentiation Jin Taek Hwang,
More informationSerum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages
Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van
More informationUNDERSTANDING THE BIOLOGY OF FAT METABOLISM is fundamental
Image-Based High-Throughput Quantification of Cellular Fat Accumulation MIKE DRAGUNOW, 1,3 RACHEL CAMERON, 1 PRITIKA NARAYAN, 1,3 and SIMON O CARROLL 2 A number of biochemical methods are available for
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationPelagia Research Library
Available online at www.pelagiaresearchlibrary.com Der Pharmacia Sinica, 2014, 5(3): 32-36 ISSN: 0976-8688 CODEN (USA): PSHIBD Study of the effect of ethanolic extract of Solanum xanthocarpum schrad &
More informationIN VITRO ANTICANCER ACTIVITY OF FLOWER EXTRACTS OF COUROUPITA GUIANENSIS
CHAPTER 3 IN VITRO ANTICANCER ACTIVITY OF FLOWER EXTRACTS OF COUROUPITA GUIANENSIS 3. INTRODUCTION Plants are the basic source of knowledge of modern medicine. Almost all the parts of the plant, namely
More informationA high-performance liquid chromatography (HPLC) method for determination of chlorogenic acid and emodin in Yinhuang Jiangzhi Tea
Journal of Hainan Medical University 2016; 22(12): 17-21 17 Journal of Hainan Medical University http://www.jhmuweb.net/ A high-performance liquid chromatography (HPLC) method for determination of chlorogenic
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSupporting Information
Supporting Information Chlorinated Polyfluorinated Ether Sulfonates Exhibit Higher Activity towards Peroxisome Proliferator-Activated Receptors Signaling Pathways than Perfluorooctane Sulfonate Chuan-Hai
More informationKit for assay of thioredoxin
FkTRX-02-V2 Kit for assay of thioredoxin The thioredoxin system is the major protein disulfide reductase in cells and comprises thioredoxin, thioredoxin reductase and NADPH (1). Thioredoxin systems are
More informationLipid (Oil Red O) staining Kit
Lipid (Oil Red O) staining Kit Catalog Number KA4541 1 Kit Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
More informationB16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationOnline Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2
Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of
More informationAnti-Aging Activity Of Cucurbita moschata Ethanolic Extract Towards NIH3T3 Fibroblast Cells Induced By Doxorubicin
Indonesian Journal of Cancer Chemoprevention, 2016, 7(2): 49-53 ISSN: 2088 0197 Anti-Aging Activity Of Cucurbita moschata Ethanolic Extract Towards NIH3T3 Fibroblast Cells Induced By Doxorubicin Laeli
More informationMamofillin New aesthetic perspective
New aesthetic perspective info@ White adipose tissue (WAT) White adipose tissue (WAT) is the prevalent type in human adults functioning as the major storage site for the lipids absorbed from daily intake
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationSUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Acetone and methanol fruit extracts of Terminalia paniculata inhibit HIV-1 infection in vitro Ankita Durge a, Pratiksha Jadaun a, Ashish Wadhwani a, Ashish A. Chinchansure b, Madhukar
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationGinkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells
Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells Zhuhong Zhang 1, Si Chen 2, Hu Mei 3, Jiekun Xuan 2, Xiaoqing Guo 1, Letha Couch 2, Vasily N.
More informationZORBAX Eclipse XDB-C 18 (100 mm 4.6 mm 3.5 µm) Lichrospher-C 18 (200 mm 4.6 mm 5 µm) Megres5-C 18 (250 mm 4.6 mm 5 µm)
1 11 Tab. 1 Similarity of 11 batches of Formula Granule of Artemisiae Scopariae Herba /% S1 0904181 0.991 S2 1002065 0.985 S3 1009047 0.998 S4 1101070 0.963 S5 1104052 0.991 S6 1108069 0.975 S7 1110021
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationab Hepatic Lipid Accumulation/ Steatosis Assay Kit
ab133131 Hepatic Lipid Accumulation/ Steatosis Assay Kit Instructions for Use For evaluating steatosis risk of drug candidates using Oil Red O to stain neutral lipids in hepatocytes. This product is for
More informationGlucose Uptake Assay Kit (Red Fluorescence)
Glucose Uptake Assay Kit (Red Fluorescence) Catalog Number KA4085 100 assays Version: 03 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the
More informationJournal of Chemical and Pharmaceutical Research, 2017, 9(12): Research Article
Available online www.jocpr.com Journal of Chemical and Pharmaceutical Research, 2017, 9(12):30-34 Research Article ISSN : 0975-7384 CODEN(USA) : JCPRC5 Evaluation of Anticancer Activity of Alphonsea Sclerocarpa
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationAssessment of the in vitro skin irritation of chemicals using the Vitrolife-Skin human skin model
AATEX 14, Special Issue, 417-423 Proc. 6th World Congress on Alternatives & Animal Use in the Life Sciences August 21-25, 2007, Tokyo, Japan Assessment of the in vitro skin irritation of chemicals using
More informationDoctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,
Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationOPTIMIZATION OF EXTRACTION PROCESS FOR TOTAL POLYPHENOLS FROM ADLAY
OPTIMIZATION OF EXTRACTION PROCESS FOR TOTAL POLYPHENOLS FROM ADLAY Yun-Xin Liu and Qing-Ping Hu * College of Life Sciences, Shanxi Normal University, Linfen 041004, China ABSTRACT: The single-factor experiment
More informationComprehensive rehabilitation with integrative medicine for subacute stroke: A.
Comprehensive rehabilitation with integrative medicine for subacute stroke: A multicenter randomized controlled trial Jianqiao Fang Ph.D. M.D. *1,2 fangjianqiao7532@163.com Lifang Chen Ph.D. M.D. 1 clfang@163.com
More informationCinnamomum Essential Oil Prevents DNA Damage- Induced by Doxorubicin on CHO-K1 Cells
Indonesian Journal of Cancer Chemoprevention, 2017, 8(1): 27-31 ISSN: 2088 0197 Cinnamomum Essential Oil Prevents DNA Damage- Induced by Doxorubicin on CHO-K1 Cells Layung Sekar Sih Wikanthi, Nindi Wulandari,
More informationNEW PHYTOCHEMICAL BASED COCKTAIL FOR IN VITRO ADIPOCYTES DIFFERENTIATION. Resources Engineering, Universiti Teknologi Malaysia, Skudai, Johor.
NEW PHYTOCHEMICAL BASED COCKTAIL FOR IN VITRO ADIPOCYTES 1 DIFFERENTIATION F.A. ABDUL MAJID 1*, M. TAHER 1 AND M.R. SARMIDI 2 1 Department of Bioprocess, 2 Chemical Engineering Pilot Plant, Faculty of
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationChloroquine inhibits cell growth and induces cell death in A549 lung cancer cells
Bioorganic & Medicinal Chemistry 14 (2006) 3218 3222 Chloroquine inhibits cell growth and induces cell death in A549 lung cancer cells Chuandong Fan, a,c Weiwei Wang, a,c Baoxiang Zhao, b, Shangli Zhang
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationA549 and A549-fLuc cells were maintained in high glucose Dulbecco modified
Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing
More informationA simple flow cytometric method to assess lipid accumulation in fat cells
A simple flow cytometric method to assess lipid accumulation in fat cells Ying-Hue Lee 1 *, Su-Yin Chen 1, Rudolf J. Wiesner 2 and Yi-Fong Huang 1 1 Laboratory of Molecular Pathology, Institute of Molecular
More informationACTH Enhances Lipid Accumulation in Bone-marrow derived Mesenchymal stem cells undergoing adipogenesis
ACTH Enhances Lipid Accumulation in Bone-marrow derived Mesenchymal stem cells undergoing adipogenesis Thomas Rhodes a, Michelle Pazienza a and Jodi F. Evans a ACTH is a major hormone of the stress axis
More information2-Deoxyglucose (2DG) Uptake Measurement kit
Document#:K2DG13516E For research use only. Not for clinical diagnosis. Catalog No. CSR-OKP-PMG-K1E 2-Deoxyglucose (2DG) Uptake Measurement kit Introduction Measurement of 2-deoxyglucose (2DG) uptake in
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationProteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
More informationSensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric*
SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric* Catalog # 72146 Kit Size 500 Assays (96-well plate) Optimized Performance: This kit is optimized to detect alkaline phosphatase activity Enhanced
More informationEffects of COX-2 Inhibitor on the Proliferation of MCF-7 and LTED MCF-7 Cells
Mahidol University Journal of Pharmaceutical Sciences 2008; 35(1-4): 47-51. Original Article Effects of COX-2 Inhibitor on the Proliferation of MCF-7 and LTED MCF-7 Cells K. Poemsantitham, N. Sookvanichsilp
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More informationAnnals of Oncology Advance Access published January 10, 2005
Annals of Oncology Advance Access published January 10, 2005 Original article Annals of Oncology doi:10.1093/annonc/mdi077 Expression of survivin and bax/bcl-2 in peroxisome proliferator activated receptor-g
More informationRat Primary Pre-adipocytes Culture Kit
Primary Cell Co., Ltd Rat Primary Pre-adipocytes Culture Kit Primary Cells from rat mesenteric, epididymal, and subcutaneous adipose tissues. Catalog # PMC-VAC01-COS, PMC-EAC01-COS, PMC-SAC01-COS Notice
More informationResearch on the inhibitory effect of metformin on human oral squamous cell carcinoma SCC-4 and CAL-27 cells and the relevant molecular mechanism.
Biomedical Research 2017; 28 (14): 6350-6354 ISSN 0970-938X www.biomedres.info Research on the inhibitory effect of metformin on human oral squamous cell carcinoma SCC-4 and CAL-27 cells and the relevant
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION DOI: 10.1038/NNANO.2012.80 Protein-Inorganic Hybrid Nanoflowers Jun Ge, Jiandu Lei, and Richard N. Zare Supporting Online Material Materials Proteins including albumin from bovine
More informationThe effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells
The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells Published in: Natl Med J China, February 10, 2003; Vol 83, No 3, Page 195-197. Authors: JIAO Shun-Chang,
More informationRat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN
YK051 Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418 0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes
More informationTable 3. Comparative table on English titles and part of use of crude drugs in JP, CP, KP and VP
Table 3 Comparative table on English titles and part of use of crude drugs in JP, CP, KP and VP 31 32 1 Alisma orientale Juzepczuk JP ALISMATIS RHIZOMA Alisma Rhizome tuber periderm CP RHIZOMA ALISMATIS
More informationSummary and Conclusions
Summary and Conclusions 125 Summary The thesis entitled Studies on Anti-hyperlipidemic and Anti-atherosclerotic activities of selected Indian Medicinal Plants incorporated the study of antioxidant, antihyperlipidemic
More informationThe roots of Atractylodes japonica Koidzumi promote adipogenic differentiation via activation of the insulin signaling pathway in 3T3-L1 cells
Han et al. BMC Complementary and Alternative Medicine 2012, 12:154 RESEARCH ARTICLE Open Access The roots of Atractylodes japonica Koidzumi promote adipogenic differentiation via activation of the insulin
More informationNF-κB p65 (Phospho-Thr254)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual
More informationSupporting Information
Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More information2-Deoxyglucose Assay Kit (Colorimetric)
2-Deoxyglucose Assay Kit (Colorimetric) Catalog Number KA3753 100 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...
More informationL6 GLUT4myc Cell Growth Protocol
L6 GLUT4myc Cell Growth Protocol Background: Parental L6 cells selected for high fusion (2, 3) were stably transfected with a rat GLUT4 cdna carrying a myc epitope (recognized by the commercially available
More informationThiol-Activated gem-dithiols: A New Class of Controllable. Hydrogen Sulfide (H 2 S) Donors
Thiol-Activated gem-dithiols: A New Class of Controllable Hydrogen Sulfide (H 2 S) Donors Yu Zhao, Jianming Kang, Chung-Min Park, Powell E. Bagdon, Bo Peng, and Ming Xian * Department of Chemistry, Washington
More informationCytotoxic and Apoptotic Effect of Commercial Tinctures of Scutellaria baicalensis on Lung Cancer Cell Lines
. Journal of Applied Pharmaceutical Science Vol. 3 (02), pp. 052-059, February, 2013 Available online at http://www.japsonline.com DOI: 10.7324/JAPS.2013.30209 ISSN 2231-3354 Cytotoxic and Apoptotic Effect
More informationSupplemental Experimental Procedures
Cell Stem Cell, Volume 2 Supplemental Data A Temporal Switch from Notch to Wnt Signaling in Muscle Stem Cells Is Necessary for Normal Adult Myogenesis Andrew S. Brack, Irina M. Conboy, Michael J. Conboy,
More informationLife Sciences METABOLISM. Transform Your Metabolic Research
METABOLISM Transform Your Metabolic Research COMPREHENSIVE TOOLS FOR ADVANCING YOUR METABOLIC RESEARCH Metabolism refers to a set of chemical reactions which are responsible for transforming carbohydrates,
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationTotal Phosphatidic Acid Assay Kit
Product Manual Total Phosphatidic Acid Assay Kit Catalog Number MET- 5019 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Phosphatidic Acid (PA) is a critical precursor
More informationPRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature
PRODUCT: RNAzol BD for Blood May 2014 Catalog No: RB 192 Storage: Store at room temperature PRODUCT DESCRIPTION. RNAzol BD is a reagent for isolation of total RNA from whole blood, plasma or serum of human
More informationHuman Leptin ELISA Kit
Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone
More informationIN VITRO HORMESIS EFFECTS OF SODIUM FLUORIDE ON KIDNEY CELLS OF THREE-DAY-OLD MALE RATS
292 Tang, An, Du, Zhang, Zhou 292 IN VITRO HORMESIS EFFECTS OF SODIUM FLUORIDE ON KIDNEY CELLS OF THREE-DAY-OLD MALE RATS Qin-qing Tang, a Xiao-jing An, a Jun Du, a Zheng-xiang Zhang, a Xiao-jun Zhou a
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationMBB317. Dr D MANGNALL OBESITY. Lecture 2
MBB317 Dr D MANGNALL OBESITY Lecture 2 When the structure of the insulin receptor was first discovered it was assumed that the active beta subunit tyrosine kinase would phosphorylate some intracellular
More informationAnti-adipogenic effect of mulberry leaf ethanol extract in 3T3-L1 adipocytes
Nutrition Research and Practice 2014;8(6):613-617 c2014 The Korean Nutrition Society and the Korean Society of Community Nutrition http://e-nrp.org Anti-adipogenic effect of mulberry leaf ethanol extract
More information8. CHAPTER IV. ANTICANCER ACTIVITY OF BIOSYNTHESIZED SILVER NANOPARTICLES
8. CHAPTER IV. ANTICANCER ACTIVITY OF BIOSYNTHESIZED SILVER NANOPARTICLES 8.1. Introduction Nanobiotechnology, an emerging field of nanoscience, utilizes nanobased-systems for various biomedical applications.
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationProtein-Mediated Anti-Adhesion Surface against Oral Bacteria
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2018 Supporting Information Protein-Mediated Anti-Adhesion Surface against Oral Bacteria Xi Liu a,b,
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More information2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein
Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN
More information5þ ; AA, ascorbic acid.
A B C SUPPLEMENTAL FIG. S1. Synergistic effect of MnTMPyP, AA, and GSH on PC-3 cell proliferation. PC-3 cells were incubated with different concentrations of AA (A) and GSH (B) with MnTMPyP for various
More informationAnti-diabetic Activity of a Polyphenol-rich Extract from Phellinus. igniarius in KK-Ay Mice with Spontaneous Type 2 Diabetes Mellitus
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2017 Anti-diabetic Activity of a Polyphenol-rich Extract from Phellinus igniarius in KK-Ay Mice
More informationFree Fatty Acid Assay Kit
Free Fatty Acid Assay Kit Catalog Number KA1667 100 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...
More informationCombined DNA, toxicological and heavy metal analyses provides an auditing toolkit to improve pharmacovigilance of traditional Chinese medicine (TCM).
Combined DNA, toxicological and heavy metal analyses provides an auditing toolkit to improve pharmacovigilance of traditional Chinese medicine (TCM). Megan L. Coghlan 1, Garth Maker 2,3, Elly Crighton
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationSUPPLEMENTARY MATERIAL Antiradical and antioxidant activity of flavones from Scutellariae baicalensis radix
SUPPLEMENTARY MATERIAL Antiradical and antioxidant activity of flavones from Scutellariae baicalensis radix Dorota Woźniak A, Andrzej Dryś B, and Adam Matkowski* A A Department of Pharmaceutical Biology
More informationBy: Dr Mehrnoosh Shanaki
Resveratrol could partly improve the crosstalk between canonical β-catenin/wnt and FOXO pathways in coronary artery disease patients with metabolic syndrome: A case control study By: Dr Mehrnoosh Shanaki
More informationLecithin Cholesterol Acyltransferase (LCAT) ELISA Kit
Product Manual Lecithin Cholesterol Acyltransferase (LCAT) ELISA Kit Catalog Number STA-616 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cholesterol is a lipid sterol
More informationMitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit
PROTOCOL Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit DESCRIPTION Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit Sufficient materials
More informationApoptosis Mediated Cytotoxicity of Curcumin Analogues PGV-0 and PGV-1 in WiDr Cell Line
Apoptosis Mediated Cytotoxicity of Curcumin Analogues PGV-0 and PGV-1 in WiDr Cell Line Endah Puji Septisetyani, Muthi Ikawati, Barinta Widaryanti and Edy Meiyanto* ) Cancer Chemoprevention Research Center,
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationEffects of methionine-containing dipeptides on α s1 casein expression in bovine mammary epithelial cells *
Journal of Animal and Feed Sciences, 16, Suppl. 2, 2007, 325 329 Effects of methionine-containing dipeptides on α s1 casein expression in bovine mammary epithelial cells * H.H. Wu 1, J.Y. Yang 1,2, K.
More informationIn Western medicine, there are three stages to a miscarriage or spontaneous
7 Prevention of Miscarriage In Western medicine, there are three stages to a miscarriage or spontaneous abortion: 1) threatened miscarriage, 2) incomplete miscarriage, and 3) complete miscarriage. The
More informationEthanolic Extract of Moringa oleifera L. Increases Sensitivity of WiDr Colon Cancer Cell Line Towards 5-Fluorouracil
Indonesian Journal of Cancer Chemoprevention, 2010, 1(2):124-128 Ethanolic Extract of Moringa oleifera L. Increases Sensitivity of WiDr Colon Cancer Cell Line Towards 5-Fluorouracil Kholid Alfan Nur, Herwandhani
More informationGENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC
Published in "" which should be cited to refer to this work. mrna extraction and RT-PCR Total RNA from 5 15 mg of crushed white adipose tissue was isolated using the technique described by Chomczynski
More informationKit for assays of mammalian Trx
FkTRX-04 Kit for assays of mammalian Trx The thioredoxin system is the major protein disulfide reductase in cells and comprises thioredoxin, thioredoxin reductase and NADPH (1). Thioredoxin systems are
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationModulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis
icell Skeletal Myoblasts Application Protocol Modulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis Introduction The skeletal muscle is one of the
More informationDepartment of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
More informationA protocol for enhancement of the AAV-mediated expression of transgenes
A protocol for enhancement of the AAV-mediated expression of transgenes Hiroaki Mizukami, Takeharu Kanazawa, Takashi Okada, and Keiya Ozawa Division of Genetic Therapeutics, Center for Molecular Medicine,
More information