British Journal of Nutrition

Transcription

1 (28), 1, q The Authors 27 doi:1.117/s Lipid peroxidtive stress nd ntioxidnt defence sttus during ontogeny of rinbow trout (Oncorhynchus mykiss) Stéphnie Fontgné*, Emilie Ltillde, Jnine Brèque nd Sdsivm Kushik Unit of Nutrition, Aquculture nd Genomics NuAGe, Pôle d Hydrobiologie INRA, Sint Pée-sur-Nivelle 631, Frnce (Received 3 July 27 Revised 23 October 27 Accepted 3 October 27 First published online 6 December 27) The objective of the present study ws to chrcterise some importnt ntioxidnt enzymes nd their reltionships with retinoids nd lipid peroxidtion during rinbow trout (Oncorhynchus mykiss) erly development. Eggs were incubted t 78C until the swim-up stge whereupon fry were fed two semi-purified diets with % (CO) nd 8 % (OX) oxidised lipid respectively for 2 months t 178C. The ctivities nd gene expression of superoxide dismutse (SOD), ctlse (CAT) nd glutthione peroxidse (GPX) were determined s well s the levels of retinoids, F2-isoprostnes nd lipid-soluble fluorescent products (LSFP) t vrious developmentl stges. Only SOD hd detectble ctivity in embryos which incresed during development nd ws linked with n increse of mitochondril (SOD2) nd cytosolic (SOD1) gene expression. SOD1 nd SOD2 mrna were more bundnt in fry fed OX thn in fry fed CO. CAT ctivity nd gene expression lso incresed during development nd were higher in fry fed OX compred with fry fed CO. Activity of Se-dependent GPX (Se-GPX) incresed during development. The gene expression of cytosolic Se-GPX (GPX1) incresed from htching to 2-month-fed fry. Both phospholipid-hydroperoxide GPX nd GPX1 genes were more expressed in fry fed OX thn in fry fed CO. Retinoids decresed during development nd, by 2 months, were lowered in fry fed OX compred with those fed CO. The levels of LSFP were higher in fry fed OX compred with fry fed CO. The present study demonstrtes tht ntioxidnt defence systems re ctive ll through the development of rinbow trout nd modulted by feeding oxidised lipid. Rinbow trout: Lrvl development: Lipid peroxidtion: Antioxidnt enzymes Under physiologicl conditions, erobic tissues continuously generte rective oxygen species s byproduct of oxidtive metbolism (1). In some specific cell types, rective oxygen species genertion my be beneficil ginst pthogen. However, in most cses, high mounts of rective oxygen species re hrmful to cells nd cuse DNA dmge, enzyme inctivtion nd structurl protein degrdtion s well s peroxidtion of PUFA leding to pthologies nd ltertion of development (2). As fish contin high concentrtions of highly unsturted ftty cids, they re vulnerble to lipid peroxidtion nd to tissue dmge resulting from lipid peroxidtion (3). Pthology relted to oxidtive stress in fish includes reduced growth, poor survivl, liver degenertion, nemi nd musculr dystrophy ( 6). Oxidtive stress is due to the overwhelming of ntioxidnt defences of cells by pro-oxidnts. This imblnce cn be ggrvted by diet composition. Feeds for fish nd especilly feeds for fish lrve contin high levels of PUFA derived from mrine fish oils nd mels. These ftty cids re prticulrly prone to oxidtive dmge during diet preprtion nd storge. Products derived from lipid peroxidtion my be bsorbed nd trnsported to tissues, where they my induce oxidtive stress (7). To decrese rective oxygen species levels nd void lipid peroxidtion, ll erobic orgnisms possess two types of ntioxidnt defence systems. One is represented by enzymes nd includes superoxide dismutse (SOD), ctlse (CAT) nd glutthione peroxidse (GPX). SOD is metlloenzyme tht ctlyses the dismuttion of the superoxide nion ðo 2 2 Þ into oxygen nd H 2 O (8) 2. The Cu/Zn-SOD is locted in the cytosol nd nucleus, while Mn-SOD is loclised within the mitochondril mtrix. Subsequently, H 2 O 2 is reduced to wter by CAT in the peroxisomes. GPX ctlyses the sme rection s CAT in the cytosol nd lso converts lipid hydroperoxides into lipid hydroxides, which re more stble products. The other group of ntioxidnt defence systems is composed of free rdicl scvengers. These compounds, generlly of low moleculr weight, lipid or wter soluble, re minly represented by vitmins E nd C. However, vitmin A hs lso been shown to reduce lipid peroxidtion (9). If the ntioxidnt ctions of vitmins E nd C re well known, the ntioxidnt ction of vitmin A remins still uncler. It could be due to the bility of the free lcohol form of vitmin A to quench singlet oxygen (1) or to the bility of retinoic cid to increse expression nd ctivity of ntioxidnt enzymes (11). Moreover, Abbrevitions: CAT, ctlse; CO, semi-purified diet with % oxidised lipid; CT, cycle threshold; dpf, dys post-fertilistion; EF1, elongtion fctor 1; GPX, glutthione peroxidse; HPGPX, phospholipid-hydroperoxide glutthione peroxidse; LSFP, lipid-soluble fluorescent products; OX, semi-purified diet with 8 % oxidised lipid; Se-GPX, Se-dependent glutthione peroxidse; SOD, superoxide dismutse. * Corresponding uthor: Dr Stephnie Fontgné, fx þ , emil fontgne@st-pee.inr.fr

2 Antioxidnt functions in rinbow trout fry 13 vitmin A hs mny other functions tht re more prominent thn its ctivity s n ntioxidnt especilly during erly development (12). The objective of the present study ws hence to chrcterise some importnt ntioxidnt enzymes nd their reltionships with retinoids nd lipid peroxidtion during rinbow trout (Oncorhynchus mykiss) erly development. The response of ntioxidnt defence systems to dietry pro-oxidnt conditions ws lso evluted by feeding fry with oxidised lipid. Mterils nd methods Experimentl fish nd diets Rinbow trout (O. mykiss) eggs were obtined from fertilistion of ov collected from eight femles by common pool of sperm from eight mles in the INRA experimentl fish frm in Lées-Aths (Pyrénées-Atlntiques, Frnce). Eggs were incubted in lrge try supplied by spring wter t 7 ^ 18C. At the eyed stge (32 d post-fertilistion (dpf)) nd htching ( dpf), ded embryos were removed. At the swim-up stge (7 dpf), fry were trnsferred to the INRA experimentl fish frm in Donzcq (Lndes, Frnce) nd rndomly distributed into six tnks (6 lrve per 5 litre fibreglss tnk) supplied by spring wter t 17 ^ 18C. From the swim-up stge, which corresponds to the beginning of exogenous feeding, fish were hnd-fed four or six times per d to pprent stition. Two semi-purified diets with % (CO) nd 8 % (OX) oxidised lipid respectively were tested in triplicte for 2 months (Tble 1). Diets were isoproteic (56 %) nd Tble 1. Formultion nd composition of experimentl diets (g/1 g dry weight) Diet CO OX Ingredients Csein dextrin bsis* Soyben lecithin 8 8 Fresh slmon oil 8 Oxidised slmon oil 8 Minerl mixture 5 5 Vitmin mixture 5 5 Proximte composition DM (%) Crude protein Totl lipids Ash Gross energy (kj/g DM) CO, semi-purified diet with % oxidised lipid; OX, semi-purified diet with 8 % oxidised lipid. * Csein dextrin bsis (% diet): 35 % csein (VWR Prolbo ; Fonteny-sous-Bois, Frnce); 1 5 % csein N slt (Sigm C865); 5 % csein hydrolyste (Sigm C626); 6 % D,L-methionine (Ajinomoto Eurolysine); 8 % L-rginine HCl (Ajinomoto Eurolysine); 23 1 % dextrin (Sigm D2256). Louis Frnçois, St Mur des Fossés, Frnce. Minerl mixture (g/kg minerl mix): KCl, 9; KI, ; CHPO 2H 2 O, 5; NCl, ; CuSO 5H 2 O, 3; ZnSO 7H 2 O, ; CoSO, 2; FeSO 7H 2 O, 2; MnSO H 2 O, 3; CCO 3, 215; MgOH, 12; N 2 SeO 3, 3; NF, 1. Vitmin mixture (per kg vitmin mix): retinyl cette, mg retinol equivlent (5 IU); choleclciferol, 6 25 mg (25 IU); DL--tocopheryl cette, 5 g; mendione, 1 g; thimin HCl, 1 g; riboflvin, g; D-clcium pnthothente, 2 g; pyridoxine HCl, 3 g; cynocoblmin, 1 mg; nicin, 1 g; choline, 1 g; scorbic cid (L-scorbyl-2-polyphosphte), 5 g; folic cid, 1 g; D-biotin, 2 mg; meso-inositol, 3 g. All ingredients were diluted with -cellulose. isolipidic (16 %) with 8 % soyben lecithin nd 8 % fresh or oxidised slmon oil. Oxidised lipid ws obtined by bubbling ir through fish oil (L Lorientise, Frnce; specilly prepred from crude slmon oil, dditive free) for 9 h t 58C. Fresh nd oxidised oils were stbilised immeditely fter reception or oxidtion with 3 prts per million ethoxyquin s in common usge for fish oil for niml nutrition, resulting in finl concentrtion of 2 prts per million ethoxyquin in diets, in order to spre the other nutrients such s vitmins nd test only the effect of oxidised lipid nd not of oxidised diet. Oils were both ssyed for oxidtive stte before incorportion into the diets (Tble 2). Chemicl nlyses of diets nd oils Proximte composition of diets ws determined ccording to the following procedures: DM fter drying t 158C for 2 h, protein (N 6 25) by the Kjeldhl method fter cid digestion, sh by incinertion t 558C for 16 h nd gross energy in n dibtic bomb clorimeter. Totl lipid ws extrcted nd mesured grvimetriclly ccording to Folch et l. (13) using dichloromethne insted of chloroform. Ftty cid methyl esters were prepred by cid-ctlysed trnsmethyltion of totl lipids ccording to Shnth & Ackmn (1) nd nlysed in Vrin Chrompck CP-38 gs chromtogrph equipped with DB Wx fused silic cpillry column (3 m 25 mm internl dimeter, film thickness 25 mm; Vrin, Les Ulis, Frnce) using He s the crrier gs (1 ml/min). The therml grdient ws 1 to 188C t88c/min, 18 to 228C t8c/min nd constnt temperture of 228C during 2 min. Injector nd flme ionistion detector tempertures were 26 nd 258C, respectively. The unsturtion index (UI) ws clculted ccording to the formul: UI ¼ sum (ftty cid percentge) (number of double bonds). Peroxide vlue of fish oil ws determined by colorimetric determintion of Fe-thiocynte ccording to Shnth & Decker (15). Conjugted dienes nd trienes were mesured s specific extinctions t the wvelengths of 232 nd 268 nm, respectively (16). Anisidine vlue ws determined ccording to the Europen Committee for Stndrdiztion (17). Thiobrbituric cid-rective substnces were mesured ccording to Slih et l. (18) with modifictions. Briefly, smples were homogenised in 2 % TCA (w/v) contining 2 % of butylted hydroxytoluene s ntioxidnt using ultr-turrx nd centrifuged t 5g for 2 min t 8C. The resulting superntnt frctions were incubted with 8 % thiobrbituric cid solution (w/v) t 18C for 3 min, cooled in ice nd centrifuged t 8 g for 1 min. Absorbnce ws mesured t 532 nm nd the quntifiction ws chieved by comprison with stndrd curve of mlondildehyde equivlents generted by cid-ctlysed hydrolysis of 1,1,3,3-tetrethoxypropne. Smple collection Smples were tken on, 21, nd 7 dpf stges nd from ech tnk on 81, 98 nd 133 dpf stges fter strvtion for 2 h. These stges correspond respectively to oocytes, embryos, htched fry, swim-up fry, complete yolk-sc resorbed fry, 1-month-fed fry nd 2-month-fed fry. Fish were nesthetised

3 1 S. Fontgné et l. Tble 2. Oxidtive sttus nd ftty cid composition of crude slmon oil nd experimentl diets* (Men vlues nd stndrd devitions) Slmon oil Diet Fresh Oxidised CO OX Men SD Men SD Men SD Men SD Evlution of lipid oxidtion Peroxide vlue (meq peroxides/kg) 3 3 b b 32 Conjugted dienes (extinction t 232 nm) 11 8 b b Conjugted trienes (extinction t 268 nm) 5 b b 6 Anisidine vlue 6 b b TBARS (mmol/kg) 86 b b Ftty cid composition (g/1 g totl ftty cids) SFA Monoenes n n b b 5 Unsturtion index b b CO, semi-purified diet with % oxidised lipid; OX, semi-purified diet with 8 % oxidised lipid; TBARS, thiobrbituric cid-rective substnces. * Two replictes for ftty cids, three replictes for peroxide vlue, conjugted dienes nd trienes nd nisidine vlue, or six replictes for TBARS.,b Men vlues within row nd for ech compound ctegory (oil or diet) with unlike superscript letters re significntly different (P, 5). in diluted 2-phenoxyethnol for wet weight determintion, frozen in liquid N 2 nd stored t 288C until nlysis. Determintion of totl 8-isoprostne levels nd lipid-soluble fluorescent products The level of oxidtive stress ws ssessed by mesuring lrvl concentrtion of 8-isoprostnes, the products of non-enzymic peroxidtion of rchidonic cid by rective oxygen species. Isoprostnes were ssyed in ll withdrwn smples except 21 d embryos (due to the smll size of smples) by enzyme immunossy (EIA) using the Cymn Chemicl 8-isoprostne EIA kit (SPI-BIO, Mssy, Frnce) s previously described (19). For mesurement of lipid-soluble fluorescent products (LSFP), totl lipid of oocytes nd fry from the swim-up stge onwrds ws extrcted ccording to Folch et l. (13) nd diluted in chloroform methnol (7:3, v/v). Fluorescence intensity ws determined in spectrofluorometer Trid Dynex (Serlbo Technologies, Bonneuil sur Mrne, Frnce) using excittion/emission wvelengths of 36/65 nm nd quinine sulfte ws used s stndrd t concentrtion of 1 mg/ml in 5 M-sulfuric cid. Determintion of retinoid levels Retinoid extrction ws conducted by homogenising 2 5 g of oocytes, swim-up fry, 1-month fry or 2-month fry in 1 volumes of 1 mm-pbs. The homogente ws divided into two equivlent volumes (mixtures A nd B). The ph of mixture B ws djusted to 2 with cetic cid before soniction for 3 min. Proteins were precipitted by dding 5 ml ethnol contining 2 % pyrogllol (w/v) s ntioxidnt. After ddition of 1 ml hexne (mixture A) or ethyl cette methyl cette (8:1, v/v) (mixture B), mixtures were centrifuged (1 min; 1 g; 8C). Smples were extrcted two other times with ml hexne or ethyl cette methyl cette (8:1, v/v) nd the upper orgnic phses were pooled for ech mixture nd evported to dryness under N 2. The residues were then dissolved in 2 ml isopropnol methnol cetonitrile tetrhydrofurn (:3:15:15, by vol.). After centrifugtion t 1 g for 3 min, 1 ml smple ws subjected to HPLC on 2695 Allince Seprtion Module equipped with Wters 287 dul l bsorbnce detector nd Wters 275 multi-wvelength fluorescence detector (Wters, Sint-Quentin-en-Yvelines, Frnce). Instrument control, nd dt cquisition nd processing were chieved by the use of Wters Empower softwre. Retinol nd retinyl plmitte were determined by injection of mixture A into Spherisorb ODS2 C 18 reversed-phse column (25 6 mm, with prticle size of 5 mm; Wters) fitted with security gurd crtridge system. Retinoic cid nd retinl were determined by injection of mixture B into the sme column. The solvent system consisted of wter cetonitrile methnol (57:37:6, by vol.) contining 1 mmmmonium cette (ph 2) (solvent A), methnol (1 %) (solvent B) nd cetonitrile methnol isopropnol (6:35:5, by vol.) (solvent C). A liner grdient from solvent A (1 %) to solvent B (1 %) ws pplied over period of 2 min, followed by isocrtic elution with solvent B (1 %) for 5 min nd isocrtic elution with solvent C (1 %) for 5 min. Then liner grdient from solvent C (1 %) to solvent A (1 %) ws pplied for 5 min. The flow rte ws set t 1 ml/min nd the detection wvelength t 35 nm for the detection of retinoic cid nd retinl nd 325 nm for the detection of retinol nd retinyl plmitte. Retinoids were identified by retention times of pure stndrds (Sigm, Sint-Quentin-Fllvier, Frnce). Determintion of ntioxidnt enzyme ctivities The whole embryos or lrve smples were homogenised in 7 volumes of ice-cold 2 mm-phosphte buffer (ph 7 ) contining 1 mm-edta using ultr-turrx. The homogentes were centrifuged t 1g for 1 min t 28C to remove debris. The resultnt superntnt frctions were incubted for 1 h with 2 volumes of 2 mm-phosphte buffer (ph 7 ) contining

4 Antioxidnt functions in rinbow trout fry 15 1mM-EDTA nd 5 % Triton X-1 (v/v) before use for ntioxidnt enzyme ssys. The ctivity of totl SOD (EC ) ws ssyed using regent kit nd SOD from bovine liver s stndrd (Sigm). The rection ws bsed on its inhibitory effect on the rte of superoxide-dependent reduction of wter-soluble tetrzolium slt (WST-1) by xnthine xnthine oxidse (2). The rection ws monitored t 5 nm nd 378C. One SOD unit ws defined s the mount of enzyme required to inhibit the reduction of WST-1 to WST-1 formzn in the presence of superoxide by 5 %. CAT ctivity (EC ) ws ssyed in qurtz microplte with 5 ml smple solution in finl volume of 25 ml contining 67 mm-phosphte buffer (ph 7), 1 mm-edta nd 2 mm-h 2 O 2. Activity ws determined by following the reduction of H 2 O 2 t 38C nd 2 nm using the extinction coefficient M 21 /cm (21). One unit of CAT represents the mount of enzyme tht decomposes 1 mmol H 2 O 2 per min. GPX ctivity (EC ) ws ssyed by following the rte of NADPH oxidtion t 3 nm nd 38C by the coupled rection with glutthione reductse using the extinction coefficient 6 22 mm 21 /cm (22). Cumene hydroperoxide nd H 2 O 2 were the substrtes for mesuring totl GPX nd Se-dependent GPX (Se-GPX), respectively. The ssy ws relised in microplte with 2 ml smple solution in finl volume of 2 ml contining 5 mm-phosphte buffer (ph 7 ), 1 mm-edta, 2 mmsodium zide, 2 mm-reduced glutthione, 1 mm-nadph, 2 units glutthione reductse nd 2 mm-cumene hydroperoxide or 5 mm-h 2 O 2. One unit of GPX is defined s the mount of enzyme tht ctlyses the oxidtion of 1 mmol NADPH per min. Protein concentrtion ws determined ccording to Lowry et l. (23), using bovine serum lbumin s stndrd. Design of polymerse chin rection primers nd probes PCR primers used for the quntifiction of the different genes were designed using Primer 3 softwre (Tble 3). The cdna sequences of the elongtion fctor 1 (EF1) nd the cytosolic Cu/Zn superoxide dismutse (SOD1) were obtined from GenBnk sequences AF9832 nd AF69663, respectively. The cdna sequences of CAT, mitochondril Mn superoxide dismutse (SOD2), phospholipid-hydroperoxide glutthione peroxidse (HPGPX) nd cytosolic glutthione peroxidse (GPX1) were obtined from The Institute for Genomic Reserch (TIGR) sequences TC996, TC1653, TC95828 nd TC12669, respectively. The PCR products were run on 2 % grose gel to check tht only one frgment ws mplified (i.e. bsence of genomic DNA mplifiction) nd sequenced to ensure tht the correct mrna sequences were quntified. Rel-time quntittive reverse trnscriptse-polymerse chin rection Totl RNA ws extrcted from embryos nd lrve using Trizol regent (Invitrogen, Cergy-Pontoise, Frnce) ccording to the mnufcturer s instructions, nd stored in nuclese-free wter (Promeg, Chrbonnières, Frnce). Genomic DNA ws eliminted from the smples using RQ1 Rnse-Free DNse (Promeg) nd purified RNA ws then stored t 228C. Smples were subjected to electrophoresis on 1 % grose gels to confirm the integrity of the 28S nd 18S rrna bnds nd RNA qulity ws ssessed s the 26:28 nm bsorbnce rtio. cdna ws generted from 1 mg DNse-treted totl RNA using 2 U SuperSripte III RT (Invitrogen) nd 5 ng oligo(dt)15 primers (Promeg) in totl volume of 2 ml. The therml cycle used for RNA smples ws: 658C for 3 min, 258C for 1 min, 28C for 1 h nd then 998C for 5 min. For ech smple, reverse trnscription ws performed in duplicte. Rel-time PCR ws performed using the icycler iqe (Bio- Rd, Mrnes-l-Coquette, Frnce) with iqe SYBR w Green Supermix (Bio-Rd). All PCR rections were set up in ninety-six-well pltes using 2 nmol/l of ech primer nd 1 ml cdna (dilution fctor ¼ 32) in rection volume of 25 ml. Therml cycling ws initited with incubtion t 958C for 3 min for hot-strt itqe DNA polymerse ctivtion. Thirty-five steps of PCR were performed, ech one consisting of heting t 958C for 2 s nd t the nneling temperture for 3 s (Tble 3). Following the finl cycle of the PCR, melting curves were systemticlly monitored (increse set point temperture from 55 to 98C by 58C/1 s) to confirm production of single product. Ech cdna smple ws ssyed in duplicte. Controls were included in ech plte to test the bsence of contmintion by genomic DNA or ssy regents. Stndrd curves were obtined for ech cdna templte by plotting the cycle threshold (CT) vlues ginst the log 1 of five different dilutions (in triplicte) of cdna smple solutions. CT vlues corresponded to the number of cycles t which the fluorescence emission monitored in rel-time exceeded the threshold limit. Rel-time mplifiction PCR efficiency ws determined from stndrd curves ccording to E ¼ 1 (2 1/slope). The reltive expression rtio (R) of ech trget gene ws clculted bsed on PCR efficiency nd CT devition between smple Tble 3. Sequences of the polymerse chin rection primers used to ssy gene expression by rel-time quntittive polymerse chin rection Gene Forwrd primer Reverse primer Product size (bp) Anneling temperture (8C) EF1 TCCTCTTGGTCGTTTCGCTG ACCCGAGGGACATCCTGTG SOD1 TGGTCCTGTGAAGCTGATTG TTGTCAGCTCCTGCAGTCAC SOD2 TCCCTGACCTGACCTACGAC GGCCTCCTCCATTAAACCTC CAT TGATGTCACACAGGTGCGTA GTGGGCTCAGTGTTGTTGAG GPX1 CGAGCTCCATGAACGGTACG TGCTTCCCGTTCACATCCAC HPGPX TTGGAGGTCAGGAGCCAGGT ACCCTTTCCCTTGGGCTGTT EF1, elongtion fctor 1; SOD, superoxide dismutse; CAT, ctlse; GPX, glutthione peroxidse; HPGPX, phospholipid-hydroperoxide glutthione peroxidse.

5 16 S. Fontgné et l. nd control using the Reltive Expression Softwre Tool (RESTq) (2). R ws expressed in comprison with normlised EF1 s the reference gene ccording to Essex-Frser et l. (25) s no reference gene (EF1, b-ctin nd glycerldehyde- 3-phosphte dehydrogense) could be used directly. The level expression of EF1 within ech group ws normlised to selected control group (7 dpf) s follows: individul vlue within group/(men vlue within group/men vlue of control group). The swim-up fry stge ws chosen s the control s the men CT vlue of this group ws close to the men CT vlue of ll smples for EF1. Sttisticl nlyses Results re given s men vlues nd stndrd devitions. Sttisticl nlyses were performed with the computing progrm Sttbox (Grimmer Logiciels, Pris, Frnce) nd differences were considered significnt when P vlues were, 5. Sttisticl differences in gene expression between the control group nd smples were evluted in group mens by 5 rndomistion tests using REST softwre (2) nd differences were considered significnt t P, 5. Results Growth performnce Fertilistion rte ws very good (96 6 %) nd survivl remined high from the eyed stge (32 dpf) onwrds (Tble ). Men wet weight incresed bout 2-fold from the oocyte stge to the 2-month-fed fry stge. No significnt differences of survivl or growth were observed between fry fed CO nd fry fed OX. Levels of lipid peroxidtion products The levels of 8-isoprostne were the highest in oocytes but no significnt effect of dietry oxidised lipid ws recorded (Tble 5). On the other hnd, the levels of LSFP were consistently higher in fry fed OX thn in fry fed CO for given stge. No cler effect of fry development on the evolution of these products of lipid peroxidtion ws noted. Retinoid contents in oocytes nd fry Retinoic cid ws found to be higher in oocytes thn in fry; it decresed during development nd by 2 months ws higher in fry fed CO thn in fry fed OX (Tble 6). Like retinoic cid, retinol ws in higher concentrtions in oocytes thn in fry. It decresed during development nd ws significntly lower in 2-month fry fed OX compred with fry fed CO. Retinl contents decresed in 2-month fry fed OX but trends during development were less cler. Retinyl plmitte ppered to be the min storge form of vitmin A in oocytes nd fry, except in fry fed OX. It decresed during development nd ws significntly lower in 2-month fry fed OX compred with fry fed CO. Antioxidnt enzymes SOD ctivity ws detectble in 21 dpf embryos (Fig. 1(A)). It incresed slowly during development but no significnt Tble. Survivl (%) nd men wet weight (mg) of oocytes, embryos nd fry of rinbow trout (Oncorhynchus mykiss) during the experiment (Men vlues nd stndrd devitions of three replictes) or 1* CO 81 OX 98 CO 98 OX 133 CO 133 OX Stge (dpf) Men SD Men SD Men SD Men SD Men SD Men SD Men SD Men SD Men SD Men SD Survivl (%) ,b 1 8,b 1 8,b b 1 78,b 1 67 b 3 69 b 2 66 b 3 65 b Weight (mg) 71 e e d 183 c c b b dpf, Dys post-fertilistion; CO, semi-purified diet with % oxidised lipid; OX, semi-purified diet with 8 % oxidised lipid. * The stge indicted is 1 dpf for survivl nd dpf for men wet weight. e Men vlues within row with unlike superscript letters re significntly different (P, 5).

6 Antioxidnt functions in rinbow trout fry 17 Tble 5. Levels of lipid peroxidtion products in rinbow trout (Oncorhynchus mykiss) oocytes nd fry fed different diets* (Men vlues nd stndrd devitions) 7 81CO 81OX 98CO 98OX 133CO 133OX Stge (dpf) Men SD Men SD Men SD Men SD Men SD Men SD Men SD Men SD Men SD 8-Isoprostne (ng/g) b 3 3,b ,b ,b 2 3 3,b ,b ,b ,b 2 1 LSFP (%) 12 6 b,c 3 7 d b,c d c b dpf, Dys post-fertilistion; CO, semi-purified diet with % oxidised lipid; OX, semi-purified diet with 8 % oxidised lipid; LSFP, lipid-soluble fluorescent products. * Three replictes for 8-isoprostne nd six replictes for LSFP. d Men vlues within row with unlike superscript letters re significntly different (P, 5). difference ws observed ccording to fry diet. SOD1 nd SOD2 genes were expressed from 21 dpf embryos to 2-months-fed fry (Figs. 2(A) nd (B)). SOD1 gene expression ws not significntly different during development except for 1-month nd 2-month fry fed OX where n increse ws noted. SOD1 gene expression ws significntly higher in fry fed OX thn in fry fed CO (1 29-, nd 1 35-fold for 81, 98 nd 133 dpf fry). SOD2 gene expression incresed during development prticulrly during the erly stges of development (21 nd dpf) nd this expression ws significntly higher (1 3-fold) in 2-month fry fed OX thn in 2-month fry fed CO. CAT ctivity, which ws not detectble in 21 dpf embryos, gretly incresed during development prticulrly fter 2-month feeding (Fig. 1(B)). This ctivity ws ffected by dietry levels of oxidised lipid: 2-month fry fed OX showed higher ctivity thn fry fed CO. CAT gene expression ws detectble in 21 dpf embryos with n expression significntly higher thn in newly htched fry. CAT gene expression incresed during development from htching to 2-month-fed fry (Fig. 2(C)). This expression ws significntly higher (1 33-fold) in 1-month fry fed OX thn in 1-month fry fed CO. Among GPX, Se-GPX ctivity ws higher thn non-se- GPX ctivity (Figs. 1(C) nd (D)). Non-Se-GPX ctivity ws detectble from 7 dpf nd styed low, without significnt difference mong dietry groups. However, Se-GPX ctivity ws detectble from htching nd incresed during development. Two Se-GPX were studied by RT-PCR: HPGPX nd GPX1 (Figs. 2(D) nd (E)). HPGPX mrna bundnce ws more or less constnt during development. It ws significntly higher t the 21 dpf stge nd 2-month fry fed OX. The HPGPX gene ws 1 31-fold more expressed in fry fed OX thn in fry fed CO fter 1 month of feeding. GPX1 gene expression decresed from 21 dpf to htching before incresing significntly from the swim-up stge to the end of the experiment. The GPX1 gene ws 1 32-fold more expressed in fry fed OX thn in fry fed CO fter 2 months of feeding. Discussion Evolution of ntioxidnt defences during lrvl development The present results show tht both the ctivity nd expression of genes coding for ntioxidnt enzymes incresed during rinbow trout development. The evolution of the three ntioxidnt enzymes SOD, CAT nd GPX confirm previous results obtined by Aceto et l. (26) in rinbow trout embryos. The sme tendencies hve lso been reported for CAT nd GPX in other fish species such s turbot (27) nd common dentex (28) wheres the reverse hs been observed for SOD. However, the present study hs shown tht only SOD presented redily mesurble ctivity in embryos, which seems to confirm tht like in turbot nd common dentex, SOD is needed in the very erly developmentl stges to reduce elevted tissue concentrtion of O 2(27) 2. According to Vernier (29), kidney nd liver re present t the rinbow trout embryonic stge nlysed in the present study nd SOD hs been reported to be highly ctive in these two tissues (26). The present study is the first one to mesure the expression of genes coding for ntioxidnt enzymes during the erly

7 18 S. Fontgné et l. Tble 6. Levels of different retinoids in rinbow trout (Oncorhynchus mykiss) oocytes nd fry (ng/g) (Men vlues nd stndrd devitions of three replictes) 7 98 CO 98 OX 133 CO 133 OX Stge (dpf) Men SD Men SD Men SD Men SD Men SD Men SD Retinoic cid b 8 22 b b 3 1 c Retinol b 8 26 c,d c d,e 51 2 e 12 Retinl 116,b ,b 19 5 c 5 23 c b 18 Retinyl plmitte b c c c d 2 dpf, Dys post-fertilistion; CO, semi-purified diet with % oxidised lipid; OX, semi-purified diet with 8 % oxidised lipid. e Men vlues within row with unlike superscript letters re significntly different (P, 5). development of fish. The results of gene expression nlyses confirm dt of ntioxidnt enzyme ctivities. The increse of SOD2 gene expression occurred during the very erly stges, between the embryo nd swim-up stges, wheres the increses of CAT nd GPX1 gene expression were noted lter, between htching nd complete yolk-sc resorption. All studied genes coding for ntioxidnt enzymes hve been shown to be expressed from the embryonic stge. The genes coding for HPGPX nd GPX1 were even more expressed in rinbow trout embryos compred with swim-up fry. Contrry to ntioxidnt enzymes, retinoids declined during rinbow trout erly development. A decrese of retinol during embryonic development hs lso been reported for lke trout (3). This pttern in fish lrvl stges is similr to wht hs been described for other ntioxidnt vitmins such s vitmin E (12,28). These non-enzymic ntioxidnts in fish eggs re essentil to ensure erly ntioxidnt protection. (A) Activity of SOD (U/mg protein) c bc bc bc bc b However, retinoids, especilly retinoic cids, re lso recognised s highly ctive molecules in developmentl processes (31). In higher vertebrte cells, retinoic cids exist in severl stereoisomeric forms: predominntly ll-trns-retinoic cid nd 13-cis-retinoic cid, but lso s less-stble isomers such s 9-cis-retinoic cid (32). In the present study, 9-cis-retinoic cid ws not detected in ny of the developmentl stges nd 13-cis-retinoic cid ws detected only in fry nd in very low mounts (dt not shown). As in higher vertebrtes, ll-trns-retinoic cid ws the min form of retinoic cid in rinbow trout oocytes nd fry. Oocytes displyed significnt levels of retinoic cid nd these levels declined during embryonic development. Retinyl plmitte ws the mjor retinoid in rinbow trout oocytes nd fry with levels rnging from % in fry fed diet CO to 96 % in oocytes. Retinl ws reported to be the essentil mode of retinoid storge in eggs of teleosts wheres retinyl esters were described s (B) Activity of ctlse (U/mg protein) f e de cd cd c c b (C) 2 (D) 2 Activity of Se-GPX (mu/mg protein) b b b b c Activity of NS-GPX (mu/mg protein) Dys post-fertilistion Fig. 1. Activity of superoxide dismutse (SOD) (A), ctlse (B), Se-dependent glutthione peroxidse (Se-GPX) (C) nd non-se-gpx (NS-GPX) (D) in rinbow trout (Oncorhynchus mykiss) embryos nd fry fed different diets: ( ) before exogenous feeding; (A) fry fed semi-purified diet with % oxidised lipid; ( ) fry fed semi-purified diet with 8 % oxidised lipid. Vlues re mens (n 3), with stndrd devitions represented by verticl brs.,b,c,d Men vlues with unlike letters re significntly different (P, 5).

8 Antioxidnt functions in rinbow trout fry 19 (A) (B) Reltive SOD1 mrna bundnce 2 2 * * Reltive SOD2 mrna bundnce Dys post-fertilistion Dys post-fertilistion (C) Reltive CAT mrna bundnce 2 2 ** ** * Dys post-fertilistion (E) Reltive GPX1 mrna bundnce 2 ** 2 * (D) 2 2 Reltive HPGPX mrna bundnce ** ** ** Dys post-fertilistion ** ** Dys post-fertilistion Fig. 2. Reltive expression of superoxide dismutse-1 (SOD1) (A), SOD2 (B), ctlse (CAT) (C), phospholipid-hydroperoxide glutthione peroxidse (HPGPX) (D) nd glutthione peroxidse-1 (GPX1) (E) genes normlised with elongtion fctor 1 in rinbow trout (Oncorhynchus mykiss) embryos nd fry fed different diets: ( ) before exogenous feeding; (A) fry fed semi-purified diet with % oxidised lipid; ( ) fry fed semi-purified diet with 8 % oxidised lipid. Men vlue ws significntly different from tht of the control group, the swim-up fry stge (7 dys post-fertilistion): * P, 5, ** P, 1, P, 1. dditionl retinoids tht ccompny the ccumultion of lipid substnces (33). In the present study, totl lipid ccounted for 12 % of oocyte wet weight nd % of 2-month fry wet weight nd could not explin totlly the observed difference between the present results with very low levels of retinl in oocytes (bout 2 % of totl retinoids) nd the results obtined on Chum slmon eggs by Irie & Seki (3). The high levels of retinol nd retinyl plmitte in rinbow trout oocytes could ensure the erly ntioxidnt protection by stbilising peroxyl rdicls produced in the developing embryo s suggested by Plce & Werner (12). Response of ntioxidnt defences to dietry oxidised lipid Feeding rinbow trout fry with oxidised lipid resulted in decresed vitmin A lrvl contents nd incresed levels of lipid peroxidtion products s well s incresed ntioxidnt enzyme ctivity nd gene expression. However, fry fed oxidised

9 11 S. Fontgné et l. lipid did not disply ny significnt decrese of growth or survivl compred with fry fed the control diet in greement with wht hs been reported in juvenile rinbow trout (35,36), Europen se bss (37), gilthed se brem (38) nd Atlntic hlibut (39). In the lst study, some skeletl mlformtions were noticed. Other mlformtions such s musculr dystrophy or Sekoke disese hve been reported in juvenile common crp nd Siberin sturgeon lrve fed oxidised lipid (7,19). In the present study, no obvious mlformtion ws evidenced wheres the sme level nd degree of oxidised lipid s in our previous study (19) with Siberin sturgeon lrve were tested. So, ccording to growth performnce nd response of ntioxidnt defences, rinbow trout fry fed oxidised lipid displyed moderte oxidtive stress. No deleterious effect ws noted probbly due to the cler response of the enzyme-dependent ntioxidnt defence system t the moleculr level. Also Tocher et l. () showed in three mrine species tht the extent of peroxidtive stress nd deleterious effects ppered inversely proportionl to the responses of heptic ntioxidnt defence enzyme ctivities. In the present study, mong ntioxidnt enzymes, CAT displyed the most pronounced increse of ctivity fter 2 months of feeding with dietry oxidised lipid. The increse in gene expression occurred erlier, fter 1 month of feeding. The response of other ntioxidnt enzymes to dietry oxidised lipid ws noticed t the moleculr level with n increse in gene expression s soon s 11 d feeding for cytosolic Cu/Zn SOD nd 2 months of feeding for GPX1. The gene expression nlysis of the two SOD isoforms reveled tht SOD1 ws more sensitive to dietry oxidised lipid thn SOD2. The mrna levels of ntioxidnt enzymes constitute vlid biomrker of oxidtive stress s suggested by Olsvik et l. (1). Levels of lipid peroxidtion products such s LSFP nd 8-isoprostne positively correlted to ntioxidnt enzyme ctivities nd gene expression nd negtively correlted to retinoid levels. However, high level of 8-isoprostne ws found in oocytes compred with fry wheres no significnt difference of LSFP ws noted between oocytes nd fry. This discrepncy between results could be due to n overestimtion of isoprostnes in oocytes, which then msked significnt differences between fry groups. Lipid peroxidtion is difficult to evlute nd since none of the different nlyticl methods tken individully is idel (2), the use of combintion of different mesurements is preferble. In conclusion, the present results suggest tht rinbow trout fry ntioxidnt defence systems re ctive ll through development with predominnce of ntioxidnt vitmins in the erliest stges nd then predominnce of ntioxidnt enzymes. The ntioxidnt defence systems cn be modulted by feeding oxidised lipid. The ctivtion of ntioxidnt enzymes nd the use of ntioxidnt vitmins such s vitmin A to eliminte free rdicls in rinbow trout fry llow counterction in prt of the oxidtive stress which cn be then described s moderte. Dietry oxidised lipid resulted in incresed levels of lrvl lipid peroxidtion products leding to decrese flesh qulity, but no depression of growth or survivl or high occurrence of deformed fish ws recorded. Acknowledgements The present study ws supported in prt by Action Incittive INRA-IFREMER. S. F. designed the reserch with dvice from S. K.; E. L. nd J. B. performed the reserch nd contributed new nlyticl tools; S. F., E. L. nd J. B. nlysed the dt; S. F., E. L. nd J. B. wrote the pper nd S. K. revised it. The uthors wish to thnk L Lorientise (Lorient, Frnce) for the kind supply of slmon oil without ny ntioxidnt. They re very grteful to P. Aguirre, P. Muns, J.-P. Fouriot, F. Terrier, F. Sndres nd Y. Hontng for the preprtion of lrvl diets nd cre of fish. Due cknowledgements re lso mde to M.-J. Borthire, C. Vchot, S. Berhonde, G. Beyries nd S. Huguenrd for their technicl ssistnce nd S. Pnsert nd E. Plgnes-Jun for dvice in gene expression nlysis. There is no conflict of interest tht the uthors should disclose. References 1. Fridovich I (1998) Oxygen toxicity: rdicl explntion. J Exp Biol 21, Hlliwell B & Gutteridge JMC (27) Free Rdicls in Biology nd Medicine, th ed., Oxford: Oxford University Press. 3. Hsieh RJ & Kinsell JE (1989) Oxidtion of polyunsturted ftty cids: mechnisms, products, nd inhibition with emphsis on fish. Adv Food Nutr Res 33, Wtnbe T & Hshimoto Y (1968) Toxic components of oxidized sury oil inducing musculr dystrophy in crp. Bull Jpn Soc Sci Fish 3, Ht K, Fujimoto K & Kned T (1986) Absorption of lipid hydroperoxides in crp. Bull Jpn Soc Sci Fish 52, Srgent JR, Tocher DR & Bell JG (22) The lipids. In Fish Nutrition, 3rd ed. pp [JE Hlver nd RW Hrdy, editors]. London: Acdemic Press. 7. Ht K & Kned T (198) Effect of utoxidized oil on crp. Bull Jpn Soc Sci Fish 6, Fridovich I (1997) Superoxide nion rdicl ðo 2 2 Þ, superoxide dismutses, nd relted mtters. J Biol Chem 272, Plcios A, Piergicomi VA & Ctl A (1996) Vitmin A supplementtion inhibits chemiluminescence nd lipid peroxidtion in isolted rt liver microsomes nd mitochondri. Mol Cell Biochem 15, Plce VP, Khper N, Qin QI & Singl PK (1999) Antioxidnt potentils of vitmin A nd crotenoids nd their relevnce to hert disese. Free Rdic Biol Med 26, Ahlemeyer B, Buerbch E, Plth M, Steuber M, Heers C, Tegtmeier F & Krieglstein J (21) Retinoic cid reduces poptosis nd oxidtive stress by preservtion of SOD protein level. Free Rdic Biol Med 3, Plce VP & Werner J (26) Vitmins A nd E in the mternl diet influence egg qulity nd erly life stge development in fish: review. Sci Mr 7S2, Folch J, Lees M & Slone Stnley GH (1957) A simple method for the isoltion nd purifiction of totl lipides from niml tissues. J Biol Chem 226, Shnth NC & Ackmn RG (199) Nervonic cid versus tricosnoic cid s internl stndrds in quntittive gs chromtogrphic nlyses of fish oil longer-chin n-3 polyunsturted ftty cid methyl esters. J Chromtogr 533, Shnth NC & Decker EA (199) Rpid, sensitive, iron-bsed spectrophotometric methods for determintion of peroxide vlues of food lipids. J AOAC Int 77, Europen Committee for Stndrdiztion (22) Animl nd Vegetble Fts nd Oils Determintion of Ultrviolet Absorbnce Expressed s Specific UV Extinction. ISO 3656:22. Brussels: CEN.

10 Antioxidnt functions in rinbow trout fry Europen Committee for Stndrdiztion (2) Animl nd Vegetble Fts nd Oils Determintion of Anisidine Vlue. ISO 6885:2. Brussels: CEN. 18. Slih AM, Smith DM, Price JF & Dwson LE (1987) Modified extrction 2-thiobrbituric cid method for mesuring lipid oxidtion in poultry. Poult Sci 66, Fontgné S, Bzin D, Brèque J, Vchot C, Bernrde C, Rouult T & Bergot P (26) Effects of dietry oxidized lipid nd vitmin A on the erly development nd ntioxidnt sttus of Siberin sturgeon (Acipenser beri) lrve. Aquculture 257, Uked H, Kwn D, Med S & Swmur M (1999) Spectrophotometric ssy for superoxide dismutse bsed on the reduction of highly wter-soluble tetrzolium slts by xnthine xnthine oxidse. Biosci Biotechnol Biochem 63, Beers RF & Sizer IW (1952) Spectrophotometric method for mesuring the brekdown of hydrogen peroxide by ctlse. J Biol Chem 195, Bell JG, Cowey CB, Adron JW & Shnks AM (1985) Some effects of vitmin E nd selenium deprivtion on tissue enzyme levels nd indices of tissue peroxidtion in rinbow trout (Slmo girdneri). Br J Nutr 53, Lowry OH, Rosebrough NJ, Frr AL & Rndll RJ (1951) Protein mesurement with the Folin-phenol regent. J Biol Chem 193, Pfffl MW, Horgn GW & Dempfle L (22) Reltive expression softwre tool (RESTq) for group-wise comprison nd sttisticl nlysis of reltive expression results in reltime PCR. Nucl Acids Res 3, e Essex-Frser PA, Steele SL, Bernier NJ, Murry BW, Stevens ED & Wright PA (25) Expression of four glutmine synthetse genes in the erly stges of development of rinbow trout (Oncorhynchus mykiss) in reltionship to nitrogen excretion. J Biol Chem 28, Aceto A, Amicrelli F, Scchett P, Drgni B, Buccirelli T, Msciocco L, Mirnd M & Di Ilio C (199) Developmentl spects of detoxifying enzymes in fish (Slmo irideus). Free Rdic Res 21, Peters LD & Livingstone DR (1996) Antioxidnt enzyme ctivities in embryologic nd erly lrvl stges of turbot. J Fish Biol 9, Mourente G, Tocher DR, Diz E, Gru A & Pstor E (1999) Reltionships between ntioxidnts, ntioxidnt enzyme ctivities nd lipid peroxidtion products during erly development in Dentex dentex eggs nd lrve. Aquculture 179, Vernier JM (1969) Tble chronologique du développement embryonnire de l truite rc-en-ciel, Slmo girdneri Rich (Chronologicl tble of embyonic development of rinbow trout, Slmo girdneri Rich. 1836). Ann Embryol Morph 2, Plce VP, Brown SB, Bron CL, Fitzsimons J, Woodin B, Stegemn JJ & Klverkmp JF (1998) An evlution of the reltionships mong oxidtive stress, ntioxidnt vitmins nd erly mortlity syndrome (EMS) of lke trout (Slvelinus nmycush) from Lke Ontrio. Aqut Toxicol 3, Zile MH (1998) Vitmin A nd embryonic development: n overview. J Nutr 128, 55S 58S. 32. Armstrong JL, Redfern CPF & Vel GJ (25) 13-cis Retinoic cid nd isomeristion in peditric oncology is chnging shpe the key to success? Biochem Phrmcol 69, Rühl R, Plum C, Elmzr MMA & Nu H (21) Embryonic subcellulr distribution of 13-cis- nd ll-trns-retinoic cid indictes differentil cytosolic/nucler locliztion. Toxicol Sci 63, Irie T & Seki T (22) Retinoid composition nd retinl locliztion in the eggs of teleost fishes. Comp Biochem Physiol 131B, Hung SSO, Cho CY & Slinger SJ (1981) Effect of oxidized fish oil, DL--tocopheryl cette nd ethoxyquin supplementtion on the vitmin E nutrition of rinbow trout (Slmo girdneri) fed prcticl diets. J Nutr 111, Cowey CB, Degener E, Tcon AGJ, Youngson A & Bell JG (198) The effect of vitmin E nd oxidised fish oil on the nutrition of rinbow trout (Slmo girdneri) grown t nturl, vrying wter tempertures. Br J Nutr 51, Messger JL, Stephn G, Quentel C & Budin Lurencin F (1992) Effects of dietry oxidized fish oil nd ntioxidnt deficiency on histopthology, hemtology, tissue nd plsm biochemistry of se bss Dicentrrchus lbrx. Aqut Living Resour 5, Mourente G, Diz-Slvgo E, Bell JG & Tocher DR (22) Incresed ctivities of heptic ntioxidnt defence enzymes in juvenile gilthed se brem (Sprus urt L.) fed dietry oxidised oil: ttenution by dietry vitmin E. Aquculture 21, Lewis-McCre LM & Lll SP (27) Effects of modertely oxidized dietry lipid nd the role of vitmin E on the development of skeletl bnormlities in juvenile Atlntic hlibut (Hippoglossus hippoglossus). Aquculture 262, Tocher DR, Mourente G, Vn der Eecken A, Evjemo JO, Diz E, Wille M, Bell JG & Olsen Y (23) Comprtive study of ntioxidnt defence mechnisms in mrine fish fed vrible levels of oxidised oil nd vitmin E. Aqucult Int 11, Olsvik PA, Kristensen T, Wgbø R, Rosselnd BO, Tollefsen K-E, Beverfjord G & Berntssen MHG (25) mrna expression of ntioxidnt enzymes (SOD, CAT nd GSH-Px) nd lipid peroxidtive stress in liver of Atlntic slmon (Slmo slr) exposed to hyperoxic wter during smoltifiction. Comp Biochem Physiol 11C,