Effect of dietary linseed supplements on ω-3 PUFA content and on IGF-1 expression in broiler tissues

Transcription

1 Vol. 18 (2009): Effect of dietry linseed supplements on ω-3 PUFA content nd on IGF-1 expression in broiler tissues Zinid Sprõkin 1 *, Avo Krus 1, Sirje Kuusik 4, Hrld Tikk 2, Peeter Järv 3, Riin Soidl 3, Aleksnder Lember 2, Helgi Kldmäe 4, Virge Krus 1 nd Mti Rosto 3 1 Chemistry, Institute of Veterinry Medicine nd Animl Science, Estonin University of Life Sciences, Kreutzwldi 1A, Trtu, Estoni 2 Deprtment of Smll Frm Animl nd Poultry Husbndry, Institute of Veterinry Medicine nd Animl Sciences, Estonin University of Life Sciences, Trtu, Estoni 3 Deprtment of Food Sciences, Institute of Veterinry Medicine nd Animl Sciences, Estonin University of Life Sciences, Trtu, Estoni 4 Deprtment of Nutrition, Institute of Veterinry Medicine nd Animl Sciences, Estonin University of Life Sciences, Trtu, Estoni *e-mil: zinid.sprokin@emu.ee The im of this study ws to evlute the effect of ω-3 PUFA-rich linseed-supplemented diet on the ω-6/ω-3 PUFA content nd IGF-I mrna expression in broiler tissues. Broilers (50 of 21 d old nd 90 of 42 d old) were divided into groups ccording to dietry dditives: 1.5% linseed oil (LO), 3.0% LO, 15% linseed cke (LC) nd 30% LC nd to the durtion of modified feeding (1 21, 1 42 nd dys). PUFA content in brest muscles ws ssyed by gs chromtogrphy nd IGF-I mrna content in liver, muscle nd leukocytes ws mesured by one step RT-PCR. The experimentl diets improved the ω-6/ω-3 PUFA rtio through threefold increse in the ω-3 PUFA content in the brest muscle. The chnges in PUFA content were ccompnied by chnges in IGF-1 gene expression levels in tissues. Therefore, both prcrine nd utocrine mnner of IGF-1 ction re likely to be involved. 15% LC t strting period or 1.5% LO in finl diet cn be dvised s optiml for enriching broiler met with ω-3 ftty cids. Key-words: broiler, nutrition, linseed, PUFA, IGF-1 expression Agriculturl nd Food Science Mnuscript received December

2 Sprõkin, Z. et l. Dietry linseed supplement effect on broiler IGF-1 expression Introduction In the lst severl yers, crdiovsculr diseses hve become more frequent in Estoni nd the rest of world. At the sme time, the consumption of polyunsturted ω-3 ftty cid (ω-3 ftty cids or ω-3 PUFA) hs been shown to reduce the risk of rteriosclerosis. Unfortuntely, s the humn orgnism is unble to produce PUFAs; it is necessry to pick them up from food. The richest source of ω-3 ftty cids is the ft of cold-wter fish s well s flx, hemp, rpe nd linseed (Lopez-Ferrer et l. 2001). However most of the people do not like to use these products directly for food. Moreover oil cpsules rich in ω-3 ftty cids, produced by mny compnies re reltively expensive. The lterntive is to consume niml nd bird products whose orgns re enriched with ω-3 PUFA. The effect of trnsmitted ftty cids from dietry vegetble sources on poultry tissues is known (Lopez-Ferrer et l. 2001, Hämml 2004, Mzzuco et l. 2005, nd Lember et l. 2006). In our previous study, ω-3 ftty cid levels in brest muscle of quils were responding well to chnges in dietry mel composition (Krus et l. 2007). It therefore cn be presumed tht the enrichment of broiler met with ω-3 ftty cid cn be chieved by feeding the birds with linseed (Linum usittissinum) mel. However, the optiml content nd durtion of the supplementtion tht scertin proper development nd growth of broilers re not known t present. We hve sought to nswer these questions by mesuring the mrna level of IGF-1 (insulin like growth fctor-1). It hs been suggested tht higher ω-3 PUFA diets could ffect IGF-1 expression becuse IGF-1 mrna level in liver nd muscle ws depended on the nutrition sttus (Heck et l. 2003, Guernec et l. 2004). Therefore, IGF-1 mrna content in those tissues could give vluble informtion for estblishing optiml linseed diets for enriching broiler muscles tissues with ω-3 ftty cids. In ddition, we lso studied the mechnism of IGF-1 ction: endocrine, prcrine or utocrine, s this too cn be importnt for incresing the ω-3 ftty cid content nd in improving ω-6/ω-3 PUFA rtio in tissues using linseed mel (McMurtry et l. 1997, Beccvin et l. 2001, Heck et l. 2003, Gichetto et l. 2004). Mteril nd Methods Experiments were crried out ccording to Estonin Animl Protection Act ( /RT I 2004). The tril ws conducted t A/S Tllegg in Test groups were locted on privte frms. In totl 140 Ross 208 broilers were studied. As recommended (Tikk nd Lember 2004), broilers were divided into 14 groups (5 mles nd 5 femles in ech) ccording to following dietry dditives: 1.5 nd 3.0% linseed oil, 15 nd 30% linseed cke groups, feeding periods (1 21, 1 42 nd dys) with dditive nutrition plus two control groups (broilers t the ge of 21 d nd 42 d old). The dietry dditives were given with grnulted mixed concentrted feed s the bsl feed contining 21.2% crude protein nd 13.2MJ/kg metbolizble energy. The content of crude ft nd ω-3 PUFA in diet re presented in Tble 1. Tble 1. Content of crude ft nd ω-3 PUFA in diet. Crude ft content ω-3 PUFA in crude ft 36 ω-3 PUFA content in 1 g of feed ω-3 PUFA content in dily (30 g) diet Feeds % % mg mg Linseed cke Linseed oil Mixed feed

3 Vol. 18 (2009): Tissue smples were tken immeditely fter slughter (blood smples were tken from living birds before slughtering), instntly frozen in dry ice nd stored (bout two hours) t 20 C until use. Brest muscles were seprted from the crcss, weighed nd smples were tken for ftty cid nlysis. Ftty cids were determined by gs chromtogrphy in the form of methyl esters on 30 m Crbowx column (for more detils see Krus 2007). The totl content of sturted ftty cids, monounsturted ftty cids, ω-3 polyunsturted ftty cids (PUFA) nd ω-6 PUFAs were clculted (Hämml 2004, Tikk nd Lember 2004, Lember et l. 2006, Krus et l. 2007). Blood ws collected from V. jugulris into disposble non-heprinised test tubes for IGF-1 nlysis nd into EDTA-diN tubes for mrna studies. Leukocyte mrna ws isolted using mrna isoltion kit for bone/blood mrrow (Roche Applied Science). Muscle nd liver smples were disrupted nd homogenized tissue using mortr nd pestle. mrna ws isolted from mg of homogenized using mrna isoltion kit (Roche Applied Science). Anlysis of mrna ws performed with hot strt one-step RT-PCR using LightCycler RNA Mster SYBR Green I kit (Roche Applied Science) nd LightCycler 1.2 Instrument. The PCR protocol ws optimised on the bsis of previous work (Pfffl et l. 2002, Heck et l. 2003, Gichetto et l. 2004, Smolkin nd Krus 2004) nd the Roche LightCycler RNA mster SYBR Green I method mnul. The complimentry DNA sequences were the sme s reported by Pfffl (2001, 2002) nd were pretested in birds (Krus et l. 2007). The primers were synthesised by TIB MOLBIOL ( Primer informtion nd the TIB reference numbers re listed in Tble 2. GAPDH housekeeping gene ws used for IGF-1 mrna quntifiction (Smolkin nd Krus 2004). Crossing points for IGF-1 expression nlysis were estimted using the Fit Points option (LightCycler softwre version 3.5). Sttisticl Anlyses Vrition of polyunsturted ftty cid content in prllel mesurements of feeds hs been negligibly smll (Hämml 2004). Therefore, the pooled smples were used for nlyses nd the vlues in Tble 3 re presented s verges without stndrd devition. Sttisticl nlysis ws performed using SYSTAT 10.0 softwre (SPSS) nd R pckge (version ). The dt of IGF-1 mrna re represented s men ± SD. The homogeneity of vrince for IGF-1 mrna dt ws tested by the one-wy ANOVA. When vrinces were comprble, the differences in IGF-1 gene expression regrding the chnges in consuming durtion or in dditive yield were estimted by T-test with unequl vrinces. One-wy ANOVA dispersion nlysis followed by Tukey posthoc test ws performed to determine the effects of linseed mel on reltionship between IGF-1 mrna levels nd ω-6/ω-3 PUFA rtio. Furthermore Person s correltion coefficients between verges of IGF-1 mrna nd ω-6/ω-3 PUFA rtio were clculted. Differences of p<0.05 were regrded s significnt. Tble 2. The sequences, position nd G/C content of the RT PCR primers Primer Sequence (5 3`) GC (%) GAPDH f CATTGACCTTCACTACATGGT 42.9 GAPDH r ACCCTTCAAGTGAGCCCCAG 60.0 IGF-1 f TCGCATCTCTTCTATCTGGCCCTGT 52.0 IGF-1 r GCAGTACATCTCCAGCCTCCTCAGA 56.0 f = forwrd; r = reverse 37

4 Sprõkin, Z. et l. Dietry linseed supplement effect on broiler IGF-1 expression Results Effect of dietry linseed dditives on PUFA content in broiler brest muscle The broiler brest muscle ftty cid content dt re presented in Tble 3. We estblished tht in comprison with control group, the linseed diet led to higher content of ω-3 PUFA nd lower ω-6/ω-3 PUFA rtio in broiler brest muscle. In comprison with control group, the experimentl diets on verge incresed ω-3 PUFA content by 3.3-fold nd decresed the rtio of ω-6/ω-3 PUFA pproximtely 3.5-fold. ω -6/ω-3 PUFA rtio reveled flling trend during the first 3 weeks of feeding tril (1 21 dy), but this could be extended by completing the diet. The highest vlues of ω-3 PUFA content nd the lowest rtios of ω-6/ω-3 PUFA in brest muscles were observed with diet contining 30% linseed cke during the lst two weeks of study. In the cse of longer feeding periods (1 42 dy) the trend ws similr linseed cke dditives improved ω-6/ω-3 PUFA rtio in brest muscle even further. Effect of linseed rich diet on IGF-1 expression level in different broilers tissues In order to investigte the effects of linseed mel in broiler, we mesured broiler leukocytes, liver nd brest muscle IGF-1 mrna level t different points in nutrition time (Tble 4). Despite reltively high vrition, the IGF-1 expression level differs quntittively between tissues. The reltive content of IGF-1 mrna in leukocytes tends to decrese in broilers fed with 30% linseed cke in first three weeks (p<0.05) (different upper-cse letters in Tble 4). After strting the diet (1 21 d), slight increse in muscle IGF-1 mrna level ws observed. However, the IGF-1 expression level differed significntly from tht of the control group (p<0.05) in the 15% linseed cke tretment group only. IGF-1 expression in liver during the first 21- dy diet period ws not ffected by linseed mel. However, there ws evidence suggesting decrese in the heptic IGF-1 expression within higher linseed cke group (p<0.05). Compred with the control group, the differences in IGF-1 expression in white blood cells fter longer nutrition period Tble 3. Ftty cid composition (% of totl) in broiler brest muscle t different experimentl diets. Ftty cids Control group 1.5% linseed oil 3.0% linseed oil 15% linseed cke 30% linseed cke SAT MUFA ω PUFA ω PUFA ω-6/ω-3 PUFA Men vlues (n=10) re percent of totl ftty cids: SAT, sum of 14:0, 15:0, 16:0, 17:0, 18:0 nd 20:0. MUFA, sum of 16:1, 17:1, 18:1 nd 20:1. ω-3 PUFA, sum of 18:3n3, 20:5n3, 22:5n3 nd 22:6n3. ω-6 PUFA sum of 18:2n6 nd 20:4n6. 38

5 Vol. 18 (2009): Tble 4. IGF-1 mrna reltive content in broiler leukocytes, liver nd brest muscle Bird group Period of nutrition IGF-1 in blood IGF-1 in liver IGF-1 in muscle Control ±0.3 A 14±25 0.7±0.5 A ±0.1 A 1.3±1.3 A 0.1±0.2 A 1.5% linseed oil group ±1.2 A 0.3± ± ±0.2 b 0.2±0.2 B 0.4±0.4 Ab ±0.6 B 2.7±2.2 B 0.7± % linseed oil group ±0.6 A 0.6± ± ±0.1 b 1.0± ±0.9 B ±0.1 Ab 1.5± ±0.1 Ab 15% linseed cke group ±2.0 A 0.6±0.4 A 7.0±9.3 B ±1.4 b 0.4± ±0.1 A ±0.2 Bb 3.0± ±0.7 A 30% linseed cke group ±0.0 B 0.3±0.2 B 1.0±1.0 b ±0.1 Bb 4.0± ±0.1 A ±0.2 Bb 5.6± ±1.3 A The IGF-1 mrna ws mesured by rel time RT-PCR nd normlized by GAPDH mrna levels. Rtios (rbitrry unit) re mens±sd, by using test of homogeneity of vrinces. The number of birds in groups rnged from n=5 10. Different upper-cse letters designte significnt differences (p<0.05) between different bird groups t the sme nutrition periods. Different lower-cse letters designte significnt differences (p<0.05) between nutrition period t the sme bird group. (1 42 dys) were observed in 30% linseed cke group (p<0.05). In muscle, the highest level of IGF-1 trnscription ws observed in 3.0% linseed oil group (p<0.05). Finlizing feeding with 3.0% linseed oil t dys decresed the IGF-1 mrna content in leukocytes compred with other supplements. Nevertheless, smll effect on IGF-1 nbolism ws found in reltion to others diets (p<0.05). In muscle, the most significnt effect ws observed in 1.5% linseed oil group (p<0.05). Double increse of IGF-1 mrna in liver during the sme period ws not sttisticlly significnt. The effect of linseed dditives on IGF-1 depends on the formultion nd dosing (different lower cse letters in Tble 4). Continuous effects on IGF-1 expression were observed with 1.5% linseed oil diets in blood nd muscle: IGF-1 mrna ws higher in dy nutrition period compred with 1 42 dy period (p<0.05). In cse of other diets, the initil 21-dy feeding hd stronger effect thn 1 42 or dy periods for IGF-1 mrna reltive content in leukocytes. The difference in the IGF-1 mrna content in leukocytes mong femle nd mle broilers t ge of 3 weeks ws detected only in the control group (p<0.05). In other groups no significnt genderbsed differences were found (p>0.1). The effect of linseed rich diet on the reltionship between IGF-1 expression nd ω-6/ ω-3 PUFA rtio We clculted the correltion coefficients between IGF-1 expression level nd ω-6/ω-3 PUFA rtio in broilers (Tble 5). 39

6 Sprõkin, Z. et l. Dietry linseed supplement effect on broiler IGF-1 expression Tble 5. The correltion between IGF-1 mrna reltive content nd ω-6/ω-3 PUFA rtio in different feeding groups 1. Additive IGF-1 in Blood IGF-1 in Liver IGF-1 in Muscle 1.5% LO % LO (7)** 15 % LC (7)** 30 % LC 0.99* 0.99(8)** 0.55 *p<0.1; **p<0.05; (Person correltion coefficient, p vlue two tiled) 1 the mens from different feeding groups for ω-6/ω-3 PUFA rtio nd IGF-1 mrna ws compred LO = Linseed oil, LC = Linseed cke IGF-1 mrna reltive content 5 1.5% linseed oil % linseed oil b 3 2 b 1 b b b b b b % linseed cke 30% linseed cke b 1 b b b b b b blood liver muscle Fig. 1. The effect of different experimentl diets on the reltionship between bsorbed ω-6/ω-3 PUFA rtio in broiler tissues nd IGF-1 mrna reltive content observed from blood, muscle nd liver tissues. On x-xis there fe five feeding groups: control 1 21 d, control 1 42 d, supplemented 1 21 d, supplemented 1 42 d, supplemented d. The levels of IGF-1 mrna were normlized using GAPDH level. Ech br represents the men ± SEM. b Different letters denote difference (p<0.05) in mens mong diets * Ech br tht hs SEM scled out, does not represent sttisticl importnce The effects of linseed supplements were studied dditionlly by ANOVA dispersion nlysis (Fig. 1). Significnt reltionship between muscle IGF-1 mrna reltive content nd ω-6/ω-3 PUFA rtio ws demonstrted in the cse of 1.5% linseed oil 40

7 Vol. 18 (2009): nd 15% linseed cke diets (p<0.05). It ws confirmed by Person correltion coefficient vlues. IGF-1 mrna level in leukocytes ffected the ω-6/ω-3 PUFA rtio most in cse of 1.5% linseed oil diet during the first three weeks of 42-dy experiment period (p<0.05). Doubled dietry oil groups showed (comprehensive) dditive effect. There ws lso positive correltion between leukocyte IGF-1 mrna nd ω-6/ω-3 PUFA rtio in different linseed oil supplemented diets. Negtive correltion, observed between IGF- 1 gene expression in leukocytes nd ω-6/ω-3 PUFA rtio in cse of 30% linseed cke rich diet (p<0.1) ws in greement with findings from ANOVA control group vlues were ffected by diet (p<0.05). No correltion ws detected between IGF-1 expression in liver nd ω-6/ω-3 PUFA rtio. Discussion We hve demonstrted tht linseed-supplements (Linum usittissinum) cn enhnce the nutritionl qulity of broiler met through better ω-6/ω-3 PUFA rtio which results from threefold ω-3 PUFA content increse in brest muscle. The possibility of ftty cids trnsfer from linseed mel to broiler tissue is in greement with previous studies (Lopez-Ferrer et l. 2001, Hämml 2004, Lember et l. 2006, Tikk nd Lember 2004, Krus et l. 2007). Our findings, tht shorter feeding periods (in our cse dy) re preferble for diets with higher concentrtion of ω-3 PUFA, re supported by literture (Tikk nd Lember 2004, Wldroup nd Wldroup 2005, Lember et l. 2006). In ddition, we estblished tht smller mounts of linseed oil or cke dditives gve better results in the cse of 42-dy diet. In the present study the clculted ω-6/ω-3 PUFA rtio in broiler brest muscles from different experimentl diets ws round the 1:1, which my be ttributed to the optiml metbolism of fts nd proportionl production of different prostglndin s (Wtkins et l. 1997). In order to understnd better the possibility of ftty cids being bsorbed from linseed mel to broiler tissues, nd to explin whether linseed product is preferble for broiler brest muscle enrichment with ω-3 PUFA, we lso studied IGF-1 expression. An ttempt hd lso been previously mde to replce linseed oil with cheper feeds of locl origin e.g. linseed cke (Lember et l. 2006), s oil is expensive nd feeding with it would increse the cost of broiler met. Linseed mel cn ffect the morphology of poultry body nd crcss chrcteriztion (Lopez- Ferrer et l. 2001, Lember et l. 2006) nd IGF-1 (McMurtry et l. 1997, Beccvin et l. 2001, Gichetto et l. 2004, Guernec et l. 2004). Although the effect of high ω-3 PUFA diets on the IGF-1 mrna levels observed in the current study is difficult to interpret, we hve shown tht neither IGF-1 gene expression nor PUFA content re ssocited with sex. This result is similr to the findings of Yun et l. (2005) nd Lember et l. (2006) nd suggests tht PUFA utiliztion could be relted to IGF- 1. Moreover, we found tht despite reltively high vrition in IGF-1 mrna in different tissues, IGF- 1 mrna reltive content depends on the source of linseed oil s well s the feeding regimen. The frction of PUFA bsorbed from the feed into brest muscles ws similr in broilers fed with either 3% linseed oil or 30% linseed cke during the first 3-week period. Wheres IGF-1 expression in liver nd in muscle showed tendency to depend on the diet, significnt difference observed in leukocytes t 30% linseed cke diet showing lower mrna content. It should be lso mentioned tht in totl, IGF-1 mrna content in leukocytes correlted negtively with ω-6/ω-3 PUFA rtio in broilers fed with the elevted linseed cke content. Bsed on the finding tht 30% linseed cke diet during first three weeks of posthtch growth does not led to subsequent enrichment of broiler met with ω-3 PUFA nd on the results by McMurtry et l. (1997) it ppers tht better vilbility of PUFA does not result in elevted IGF-1 expression. Previous reserch hs lso pointed out tht the production nd ction of IGF-1 re selectively influenced by the dietry supply of proteins (Mc- Murtry et l. 1997, Ktsumt et l. 2002), whose deficiency ws ssocited with low circulting con- 41

8 Sprõkin, Z. et l. Dietry linseed supplement effect on broiler IGF-1 expression centrtion of IGF-1 in blood nd reduced production in liver (cited in Ktsumt et l. 2002). In ddition, plsm IGF-1 concentrtion nd heptic IGF-1 mrna gene expression in young chickens re lowered by feed restriction nd vice verse (cited in Mzucco et l. 2005). The consequences on muscle IGFs mrna levels remin undetermined in chickens (cited in Guernec et l. 2004). In the current study, the IGF-1 mrna level in brest muscle smples of broilers ws mesured s being significntly higher fter initil three weeks consumption of 15% linseed cke, when compred with the control group. The precise role of IGF-1 in the monitoring of nutritionl chnges is still mtter of debte, but we propose tht with low linseed cke consumption in the strting diet, the endocrine mnner of IGF-1 ction ws diminished or chnged very little. Moreover, the significnt effect of 15% linseed cke diet on the reltionship between muscle IGF-1 mrna level nd ω-6/ω-3 PUFA rtio ws confirmed by positive correltion. This reflects tht prcrine nd/or utocrine mechnism of IGF-1 re of higher importnce. Our hypothesis is supported by recent dt: lrger mounts of linseed cke cn depress growth of poultry (Cicern 2004), which is usully ssocited with IGF-1 in endocrine mnner (Yun et l. 2005). Withl (cited in Guernec et l. 2004) hs lso noted tht prcrine IGF-I my be more importnt for de novo ftty synthesis nd muscle growth thn endocrine or circulting IGF-I. As discussed bove, the trend towrds IGF-1 gene expression increse in chicken brest muscle cn be seen not only in three weeks (Yun et l. 2005) but even 4 weeks nd it remined high t 6 weeks of chicken ge (Guernec et l. 2004). In the current study, the elevtion in IGF-1 mrna in broiler brest muscle ws observed t the ge of 42 dys fter 1.5% linseed oil of finl diet (22 42 dy). The influence of low linseed oil diet on reltionship between muscle IGF-1 gene expression nd ω-6/ω-3 PUFA rtio ws even more significnt. Our findings suggest tht IGF-1 ction in prcrine mnner my be situted with ω-6/ω-3 PUFA rtio improvement nd with ω-3 PUFA incresing. The report by Dunn et l. (2003) suggests tht negtive effect of flxseed on IGF-1 mrna content in the longissimus dorsi muscle of cttle my be cused by differences in IGF-1 gene expression, species differences or even differences between tissues. The postulte tht IGF-1 cn ct in prcrine nd utocrine mnner in PUFA bsorption from ω-3 PUFA rich feed is lso confirmed by insignificnt chnges in liver IGF-1 mrna of ll broiler groups. The only significnt differences in heptic IGF-1 mrna, compred with the control group, were observed in broilers fter continuous 42-dy long 1.5% linseed oil consumption. The fct tht the response of chicken to chnges in dietry ft composition is quite rpid (Wldroup nd Wldroup 2005), supports opinion tht using longer period is not necessry nd even not recommended. However, the totl correltion mong heptic IGF-1 mrna nd ω-6/ω-3 PUFA rtio ws negtive. Becuse most of the circulting IGF-1 (bout 80%) is synthesized in liver nd relesed into the bloodstrem, there is positive correltion between heptic IGF-I mrna level nd the plsm IGF-I profile during post-htching development in the chicken (Burnside nd Cogburn 1992). IGF-1 concentrtion in plsm increses with the ge of the birds (Beccvin et l. 2001, Yun et l. 2005) s well s the heptic expression of IGF-I tht peks t 28 dys of ge (Burnside nd Cogburn 1992), nd my even increse until 7 weeks of ge (Gichetto et l. 2004, Yun et l. 2005). Therefore, the slight oscilltions in heptic IGF-1 mrna level observed in the current study suggest tht circulting IGF- 1 cn be minimized or in unchngeble level by consumption of linseed mel for the ims of enriching broiler met with ω-3 PUFA. This suggestion grees with the conclusions by Gichetto et l. (2004): dditionl temporl regultory mechnisms relted to nutrition re involved in modulting the expression of heptic IGF-I mrna nd the consequent increse in plsm IGF-I levels. Additionlly, Ghoshl et l. (2000) hs found tht in rts the mrna level of IGF-1 in liver nd IGF-1 concentrtion in serum re less ffected by the diet contining 20% corn oil (CO) compred with those fed 5% CO. Similrly, in lter report (Mzucco et l. 2005) hve shown tht in white leghorns, 5% linseed oil hd no effect on heptic IGF-1 mrna or circulting IGF-1 fter 5 weeks long diet. Dunn 42

9 Vol. 18 (2009): et l. (2003) hve shown tht flx hs no ffect on circulting IGF-1 concentrtions in cttle. This is in fct somewht surprising, given Wtkins et l. (1997) observtion, tht dietry lipid tretment could positively lter the IGF-1 concentrtion in blood nd liver of the chicken t the ge of 21 dys. However, they used different ftty cid obtined from soybens, menhden nd corn. To the best of our knowledge the level of blood serum IGF-1 tends to decrese nd to suppress quil leukocyte IGF-1 gene expression upon feeding with the mix of linseed nd rpeseed mel s the finl diet (Krus et l., 2007). In contrst, there is smll but significnt increse in IGF-1 gene expression in leukocytes of broilers of the ge of 42 dys, fter three weeks feeding with linseed mel. Therefore, our results do not completely rule out the endocrine mode of IGF-1 ction. In conclusion, the results of the current study demonstrte tht vrious supplements of linseed mel enhnce the nutritionl qulity of broiler met. Under our experimentl conditions, the effect of bsorbed PUFA cids is quntittively relted to IGF-1 gene expression level in severl tissues. However, the exct mechnism through which PUFA ffects IGF-1 gene expression is still not known. We suggest tht prcrine nd/or utocrine functions of IGF-1 re involved in the bsorption of ftty cids from linseed mel. Our results show tht 15% linseed cke t strting period or the 1.5% linseed oil consumption t finl diet results in the enrichment of broiler met with ω-3 PUFA. Acknowledgements. This work ws supported by the pilot project P0091LATD04 nd by the grnt No 5734 from the Estonin Science Foundtion. References Beccvin, C., Chevlier, B., Cogburn, L.A., Simon, J. & Duclos, M. J Insulin-like growth fctors nd body growth in chickens divergently selected for high nd low growth rte. Journl of Endocrinology 168: Burnside, J. & Cogburn, L.A Developmentl expression of heptic growth hormone receptor nd insulin-like growth fctor-i mrna in the chicken. Moleculr nd Cellolr Endocrinology 89: Cicern, M Common flx - Linum usittissimum. Flowers. Cited 01 November Updted 03 Jnury Avilble on the Internet: istri/flor/flowers/linum-usittissimum.htm Dunn, J.D., Johnson, B.J., Kyser, J.P., Wyln, A.T., Sissom E.K. & Drouillrd, J.S Effects of flx supplementtion nd combined trenbolone cette nd estrdiol implnt on circulting insulin-like growth fctor-i nd muscle insulin-like growth fctor-i messenger RNA levels in beef cttle. Journl of Animl Science 81: Ghoshl, A., Xu, Z., Wood, G. & Archer, M Induction of heptic insulin-like growth fctor binding protein-1 (IGFBP-1) in rts by dietry n-6 polyunsturted ftty cids. Proceedings of the Society for Experimentl Biology nd Medicine 225: Gichetto, P., Riedel, E., Gbriel, J., Ferro, M., Di Muro S., Mcri, M. & Ferro, J Heptic mrna expression nd plsm levels of insulin-like growth fctor-i (IGF-I) in broiler chickens selected for different growth rtes. Genetics nd Moleculr Biology 27: Guernec, A., Chevlier, B. & Duclos, M.J Nutrient supply enhnces both IGF-I nd MSTN mrna levels in chicken skeletl muscle. Domestic Animl Endocrinology 26: Heck, A., Metyer, S., Ongbesn, O. M. & Willims, J mrna expression of components of the IGF system nd of GH nd insulin receptors in ovries of broiler breeder hens fed d libitum or restricted from 4 to 16 weeks of ge. Domestic Animl Endocrinology 25: Hämml J Possibilities to enrich poultry products with Ω-3 ftty cids nd influence of these cids to the humn helth. PhD thesis, EAU, Trtu, 143 p. Krus, A., Sprõkin, Z., Tikk, A., Järv, P., Soidl, R., Lember, A., Kuusik, S., Krus, V, Krus., Kldmäe, H., Rosto, M. & Rei, M Effect of Dietry Linseed on Insulin-Like Growth Fctor-1 nd Tissue Ft Composition in Quils. Archiv für Geflügelkunde/Europen Poultry Science 71: Ktsumt, M., Kwkmi, S., Kji, Y., Tkd, R. & Duncey, M. J Differentil Regultion of Porcine Heptic IGF-I mrna Expression nd Plsm IGF-I Concentrtion by Low Lysine Diet. Journl of Nutrition. 132: Lopez-Ferrer, S., Bucells, M.D., Brroet, A.C., Globrt, J. & Grshorn, M.A n-3 Enrichment of Chicken Met. 2. Use of Precursors of Long-Chin Polyunsturted Ftty Acids: Linseed Oil. Poultry Science 80: Lember, A., Tikk, H., Tikk, V., Tmm, K., Krus, A., Kuusik, S. & Rei, M The use of linseed oil in enriching the lipids of hen broiler, quil nd rbbit mel with ω-3 Ftty cids. Agrrtedus/Journl of Agriculturl Sciences XVII: Mzzuco, H., McMurtry, J.P. & Hester, P.Y Effect of moulting nd pre- nd post-molt diets high in omeg-3 ftty cids on circulting insulin-like growth fctor-1 in White Leghorns (bstrct). Poultry Science 84: 110. McMurtry, J.P., Frncis, G.L. & Upton, Z Insulin-like growth fctors in poultry. Domestic Animl Endocrinology 14:

10 Sprõkin, Z. et l. Dietry linseed supplement effect on broiler IGF-1 expression Pfffl, M Development nd vlidtion of n externlly stndrdised quntittive insulin-like growth fctor-1 RT- PCR using LightCycler SYBR Green I Technology. In: Meuer, S., Wittwer, C. & Nkgwr, K. (eds.). Rpid cycle Rel-Time PCR. Berlin: Springer, p Pfffl, M., Mirchev Georgiev, T., Penchev Georgiev, I., Ontsouk, E., Hgeleit, M. & Blum, J Rel-time RT-PCR quntifiction of the insulin-like growth fctor (IGF)-1, IGF-1 receptor, IGF-2, IGF-2 receptor, insulin receptor, growth hormone receptor, IGF-binding proteins 1, 2 nd 3 in the bovine species. Domestic Animl Endocrinology 24: Smolkin, Z. & Krus, A IGF-1 nd some housekeeping gene cndidtes for rel-time RT-PCR expression studies in cttle. Agrrtedus/Journl of Agriculturl Sciences XV: Tikk, H. & Lember, A Incresing the content of the ω-3-ftty cids in the chicken met. Agrrtedus/Journl of Agriculturl Sciences XV: Wldroup, P.W. & Wldroup, A.L Ftty Acid Effect on Crcss: the Influence of Vrious Blends of Dietry Fts Added to Corn-Soyben Mel Bsed Diets on the Ftty Acid Composition of Broilers. Interntionl Journl of Poultry Sciences 4: Wtkins, B., Shen, C., McMurtry, J., Xu, H., Bin, S., Allen, K. & Seifert, M Dietry Lipids Modulte Bone Prostglndin E2 Production, Insulin-Like Growth Fctor-I Concentrtion nd Formtion Rte in Chicks. The Journl of Nutrition 127: Yun, J.S., Seo, D.S., Kim, W.K. & Ko, Y Expression nd reltionship of the insulin-like growth fctor system with posthtch growth in the Koren Ntive Ogol chicken. Poultry Science 84: