Involvement of MAPKs in ICAM-1 Expression in Glomerular Endothelial Cells in Diabetic Nephropathy
|
|
- Lora Williams
- 5 years ago
- Views:
Transcription
1 Involvement of MPKs in ICM-1 Expression in Glomerular Endothelial Cells in Diabetic Nephropathy a a,b* a a a a c a a a c b
2 5
3 11 9
4 5 Watanabe et al. cta Med. Okayama Vol. 5, No. cholate, and 1mM mercaptoethanol at 7 C for 3min. fter four 1-min washes with TS-T, membranes were incubated with another primary antibody and then visualized again. The amount of detected proteins was analyzed using Image Quant (Molecular Dynamics, Chicago, IL, US) software. Results are expressed as means ± SD of 3 to independent experiments. Stimulated samples were compared with controls by unpaired Studentʼs test. For multiple-group comparisons, one-way analysis of variance (NOV) followed by the post hoc Fisherʼs test was performed using StatView software..5 was considered statistically significant. Results Hb1c and urinary albumin excretion (UE) are significantly higher in diabetic rats compared with nondiabetic rats (Hb1c; 13.オ vs 3.オ, UE; 9 μg/day vs 5. μg/day,.5). In diabetic rats, ICM-1 expression was increased in glomeruli compared with nondiabetic rats (Fig. 1). On immunofluorescence microscopy, ICM-1 was seen in a fine granular pattern on the surface of GE cells. lthough / To examine whether ERK1/ phosphorylation is mediated by HG and HM in GE cells, the activation of these kinases was assayed by Western blot using an antibody specific for the phosphorylated, active forms of ERK1/. oth HG and HM stimulated phosphorylation of ERK1/ in GE cells (Fig. ). The maximal response was obtained within 1min and then declined. To determine whether p3 phosphorylation is mediated by HG and HM in GE cells, activation of this kinase was assayed by Western blot using an antibody specific for the phosphorylated, active forms of p3. oth HG and HM stimulated phosphorylation of p3 in GE cells (Fig. normal Fig. 1 ICM-1 was expressed at low levels in the basal state (NG), its expression was significantly increased in HG and HM (Fig. ). Western blot analysis also revealed that exposure to HG and HM induced ICM-1 protein expression in a time-dependent manner in GE cells (Fig. 3). Exposure to HG increased ICM-1 protein expression.1 ±.-fold after 1h and 5.3±1.-fold after h compared with that at baseline (Fig. 3). Similarly, exposure to HM increased ICM-1 protein.39 ±. 3-fold after 1h and 5.3 ± 1.51-fold after h (Fig. 3). DM Immunofluorescence staining for ICM-1 in the glomeruli of nondiabetic () and diabetic rats ().
5 ugust 11 MPKs in Diabetic Glomerulus 51 control (NG) C HG HM Fig. Immunofluorescence staining for ICM-1 in GE cells. GE cells were incubated with 5.5 mm D-glucose (), 3 mm D-glucose () and 5.5 mm D-glucose plus.5 mm D-mannitol (C) for h. 5). The maximal response was achieved within 1min and then slightly declined. To examine whether JNK1 phosphorylation is mediated by HG and HM in GE cells, activation of this kinase was assayed by Western blot using an antibody specific for the phosphorylated, active forms of JNK1. oth HG and HM stimulated phosphorylation of JNK1 in GE cells (Fig. ), and the maximal response was obtained within 1 min and then declined. To determine whether ERK, p3 and JNK are involved in HG-induced ICM-1 expression in GE cells, ERK inhibitor II, p3 inhibitor (S35)
6
7
8
9 11 55
10
11
RENAL HISTOPATHOLOGY
RENAL HISTOPATHOLOGY Peter McCue, M.D. Department of Pathology, Anatomy & Cell Biology Sidney Kimmel Medical College There are no conflicts of interest. 1 Goals and Objectives! Goals Provide introduction
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationEffect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis
212 66 4 329334 Effect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis a,c a* b b a a b a a b c 33 66 4 ʼ 6 6 6 28 6 5 5 5 28 45 ʼ ʼ ʼ
More informationImpact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationSurgical Pathology Report
Louisiana State University Health Sciences Center Department of Pathology Shreveport, Louisiana Accession #: Collected: Received: Reported: 6/1/2012 09:18 6/2/2012 09:02 6/2/2012 Patient Name: Med. Rec.
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationSupplemental Materials
Supplemental Methods Spin trap and electron paramagnetic resonance spectroscopy Hypoxanthine (1 mmol=l) plus xanthine oxidase (.1 u=ml) were incubated in Krebs solution at 378C bubbled with 95% O 2 and
More informationMichigan/Chicago unit
Michigan/Chicago unit Modifications in Mouse Models to Enhance Nephropathy/Neuropathy- GLUT1 overexpression Increased oxidative stress Increased glucose metabolic flux or alteration in GLUT expression
More informationElectrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB
Electrical Stimulation Control Nerve Regeneration via the p38 Mitogen-activated Protein Kinase and CREB Kenji Kawamura, Yoshio Kano. Kibi International University, Takahashi-city, Japan. Disclosures: K.
More informationFig. S1. High K+ increases intracellular calcium level.
Fig. S1. High K + increases intracellular calcium level. (A) Neuronal activation measured by calcium imaging using Fura-2. Intracellular calcium levels were continuously monitored by the fura-2 florescence
More informationWJEC. Kidney. Question
WJEC Kidney Question 7 Examiner Arholwr yn unig (d) Humans can be affected by a condition known as multiple sclerosis (MS). In this condition T cells of the immune system attack and destroy the
More informationFigure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
More informationSupplementary Figure S1
Supplementary Figure S1 12 1 8 6 4 2 1-3 1-2 1-1 1 1 1 1 2 1 3 PF-364422 (µm) U87 (EC 5 = 52.2 ± 8.8 µm) 12 1 8 6 4 2 1-4 1-3 1-2 1-1 1 1 1 1 2 CMPD1 (µm) Primary GM (EC 5 = 1.55 ±.3 µm) U138 (EC 5 = 1.7
More informationperk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
More informationInvited Revie W. Diabetic nephropathy: the modulating influence of glucose on transforming factor D production
Histol Histopathol (1 998) 13: 565-574 Histology and Histopathology Invited Revie W Diabetic nephropathy: the modulating influence of glucose on transforming factor D production A.O. Phillips lnstitute
More informationSupplemental Figure 1. Vasoconstrictor responses of renal interlobular arteries to ATP. Responses of interlobular renal arterioles to ATP were
Supplemental Figure 1. Vasoconstrictor responses of renal interlobular arteries to ATP. Responses of interlobular renal arterioles to ATP were compared in SS rats fed 1% salt diet (black circles) and WKY
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
More informationAnti-Apoptotic Effects of Cellular Therapy
Anti-Apoptotic Effects of Cellular Therapy Jason Lapetoda 1, Lee K Landeen, PhD 1, George K Michalopoulos, MD 2, Patricia W Bedard, PhD 1 1 Vital Therapies, Inc., San Diego, CA, USA 2 University of Pittsburgh
More informationSupplementary Figure 1. Western blot of hippocampal lysates from WT and Adcy1 KO mice demonstrates the specificity of the ADCY1 antibody.
ADCY1 13 kda β-actin 45 kda Supplementary Figure 1. Western blot of hippocampal lysates from and mice demonstrates the specificity of the ADCY1 antibody. a DHPG perk1/2 ERK1/2 Relative level min 1.6 *
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationNature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.
Supplementary Figure 1 IC261 inhibits a virus-induced type I interferon response. (a) HEK293T cells were cultured in 384 wells and transiently transfected with 50 ng of the IFN-β promoter-luc construct
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationSUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
More informationSupplemental Figure S1A Notch1
Supplemental Figure S1A Notch1 erage) epth of Cove ormalized De Log1(No Notch exons Figure S1: A) Relative coverage of Notch1 and Notch 2 exons in HCC2218, HCC1187, MB157, MDA-MB157 cell lines. Blue color
More informationDiabetic Nephropathy in Spontaneously Diabetic Torii (SDT) Rats
The Open Diabetes Journal, 2011, 4, 45-49 45 Diabetic Nephropathy in Spontaneously Diabetic Torii (SDT) Rats Takeshi Ohta * and Tomohiko Sasase Open Access Biological/Pharmacological Research Laboratories,
More informationSupplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
More informationCollin County Community College RENAL PHYSIOLOGY
Collin County Community College BIOL. 2402 Anatomy & Physiology WEEK 12 Urinary System 1 RENAL PHYSIOLOGY Glomerular Filtration Filtration process that occurs in Bowman s Capsule Blood is filtered and
More informationSUPPLEMENTARY FIG. S5. ROS regulated the signaling responses of A. gambiae 4a3B cells to human insulin. (A) 4a3B cells were stimulated with 6000
Supplementary Data SUPPLEMENTARY FIG. S1. Exogenous H 2 O 2 induced rapid activation of ERK in Anopheles stephensi cells. ASE cells were treated with PBS or with 500 mmh 2 O 2 for 5, 30, 60, and 180 min.
More informationHistopathology: Glomerulonephritis and other renal pathology
Histopathology: Glomerulonephritis and other renal pathology These presentations are to help you identify basic histopathological features. They do not contain the additional factual information that you
More informationCONTRAST-INDUCED NEPHROPATHY Y HỌC CHỨNG CỨ VÀ BIỆN PHÁP DỰ PHÒNG
CONTRAST-INDUCED NEPHROPATHY Y HỌC CHỨNG CỨ VÀ BIỆN PHÁP DỰ PHÒNG DEFINITION Reversible form of acute kidney injury that occurs soon after the administration of radiocontrast media. PATHOGENESIS RISK FACTORS
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral
More informationGlomerular pathology in systemic disease
Glomerular pathology in systemic disease Lecture outline Lupus nephritis Diabetic nephropathy Glomerulonephritis Associated with Bacterial Endocarditis and Other Systemic Infections Henoch-Schonlein Purpura
More informationIncreased oxidative and glyco-oxidative stress has
Overexpression of Cu 2 /Zn 2 Superoxide Dismutase Protects Against Early Diabetic Glomerular Injury in Transgenic Mice Patricia A. Craven, 1 Mona F. Melhem, 2 Stephen L. Phillips, 3 and Frederick R. DeRubertis
More informationIntroduction. Acute sodium overload produces renal tubulointerstitial inflammation in normal rats
Acute sodium overload produces renal tubulointerstitial inflammation in normal rats MI Roson, et al. Kidney International (2006) Introduction Present by Kanya Bunnan and Wiraporn paebua Tubular sodium
More informationInfect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SAM library or vector. Introduce AKT reporter
Infect MCF-7 cells carrying dcas9-vp64 + psm2-p65-hsf1 with SM library or vector Introduce reporter Grow cells in presence of puromycin for 5 days Vector control SM library fewer surviving cells More surviving
More informationLab 3, case 1. Is this an example of nephrotic or nephritic syndrome? Why? Which portion of the nephron would you expect to be abnormal?
Lab 3, case 1 12-year-old Costa Rican boy is brought into clinic by his parents because of dark brownish-red urine over the last 24 hours. The family has been visiting friends in Indianapolis for two weeks.
More informationTitle: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events
Title: Smooth muscle cell-specific Tgfbr1 deficiency promotes aortic aneurysm formation by stimulating multiple signaling events Pu Yang 1, 3, radley M. Schmit 1, Chunhua Fu 1, Kenneth DeSart 1, S. Paul
More informationEffects of sitagliptin on cardiac metabolism in mice
Effects of sitagliptin on cardiac metabolism in mice M. Lenski, J.-C. Reil, M. Böhm, U. Laufs Saarland University Hospital Department of Internal Medicine III, Cardiology Homburg - Germany Disclosures
More informationSupplementary Figure 1
Supplementary Figure 1. (A) Representative confocal analysis of cardiac mesenchymal cells from nondiabetic (ND-CMSC) and diabetic (D-CMSC) immunostained with anti-h3k9ac and anti-h3k27me3 antibodies. Analysis
More informationReferences. Plasma renin activity (PRA) PRA was measured by a radioimmunoassay kit (Wallac, Tokyo, Japan).
Detailed Methods Experiment I enos / mice were purchased from Jackson Laboratory (Bar Harbor, USA). C57BL/6J mice on the same genetic background were purchased from KBT Oriental (Hamamatsu, Japan). Eleven-week-old
More informationRecruitment of HBO1 Histone Acetylase and Blocks
Molecular Cell, Volume 44 Supplemental Information JNK1 Phosphorylation of Cdt1 Inhibits Recruitment of HO1 Histone cetylase and locks Replication Licensing in Response to Stress enoit Miotto and Kevin
More informationSupplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
More informationMANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function
MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationW/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
More informationIntroduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationROS as targets for therapeutic intervention of diabetic nephropathy
36 th Autumn Congress of Korean Diabetes Association September 16-17, 2010, BEXCO, Busan, Korea ROS as targets for therapeutic intervention of diabetic nephropathy Hunjoo Ha Department of Bioinspired Science
More informationExpanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
More informationMorbidity & Mortality from Chronic Kidney Disease
Morbidity & Mortality from Chronic Kidney Disease Dr. Lam Man-Fai ( 林萬斐醫生 ) Honorary Clinical Assistant Professor MBBS, MRCP, FHKCP, FHKAM, PDipID (HK), FRCP (Edin, Glasg) Hong Kong Renal Registry Report
More informationCollin College. BIOL Anatomy & Physiology. Urinary System. Summary of Glomerular Filtrate
Collin College BIOL. 2402 Anatomy & Physiology Urinary System 1 Summary of Glomerular Filtrate Glomerular filtration produces fluid similar to plasma without proteins GFR ~ 125 ml per min If nothing else
More informationAppendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13
Appendix Table of Contents. Appendix Figure legends S-S3 and Appendix Table S and S. Appendix Figures S-S3 . Appendix Figure legends S-S3 and Appendix Table S and S Appendix Figure S. Western blot analysis
More informationDiabetic Nephropathy
Diabetic Nephropathy Outline Introduction of diabetic nephropathy Manifestations of diabetic nephropathy Staging of diabetic nephropathy Microalbuminuria Diagnosis of diabetic nephropathy Treatment of
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/389/ra79/dc1 Supplementary Materials for HDL-bound sphingosine 1-phosphate acts as a biased agonist for the endothelial cell receptor S1P 1 to limit vascular
More informationTHE URINARY SYSTEM. The cases we will cover are:
THE URINARY SYSTEM The focus of this week s lab will be pathology of the urinary system. Diseases of the kidney can be broken down into diseases that affect the glomeruli, tubules, interstitium, and blood
More informationTHE URINARY SYSTEM. The cases we will cover are:
THE URINARY SYSTEM The focus of this week s lab will be pathology of the urinary system. Diseases of the kidney can be broken down into diseases that affect the glomeruli, tubules, interstitium, and blood
More informationPrevention And Treatment of Diabetic Nephropathy. MOH Clinical Practice Guidelines 3/2006 Dr Stephen Chew Tec Huan
Prevention And Treatment of Diabetic Nephropathy MOH Clinical Practice Guidelines 3/2006 Dr Stephen Chew Tec Huan Prevention Tight glucose control reduces the development of diabetic nephropathy Progression
More informationALLHAT RENAL DISEASE OUTCOMES IN HYPERTENSIVE PATIENTS STRATIFIED INTO 4 GROUPS BY BASELINE GLOMERULAR FILTRATION RATE (GFR)
1 RENAL DISEASE OUTCOMES IN HYPERTENSIVE PATIENTS STRATIFIED INTO 4 GROUPS BY BASELINE GLOMERULAR FILTRATION RATE (GFR) 6 / 5 / 1006-1 2 Introduction Hypertension is the second most common cause of end-stage
More informationJournal Club. 03/04/2012 Lama Nazzal
Journal Club 03/04/2012 Lama Nazzal NOTCH and the kidneys Is an evolutionarily conserved cell cell communication mechanism. Is a regulator of cell specification, differentiation, and tissue patterning.
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationSupplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times.
Supplemental Figure 1. (A) Western blot for the expression of RIPK1 in HK-2 cells treated with or without LPS (1 µg/ml) for indicated times. Western blots shown are representative results from 3 independent
More informationMAJOR FUNCTIONS OF THE KIDNEY
MAJOR FUNCTIONS OF THE KIDNEY REGULATION OF BODY FLUID VOLUME REGULATION OF OSMOTIC BALANCE REGULATION OF ELECTROLYTE COMPOSITION REGULATION OF ACID-BASE BALANCE REGULATION OF BLOOD PRESSURE ERYTHROPOIESIS
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationCopyright 2009 Pearson Education, Inc. Copyright 2009 Pearson Education, Inc. Figure 19-1c. Efferent arteriole. Juxtaglomerular apparatus
/6/0 About this Chapter Functions of the Kidneys Anatomy of the urinary system Overview of kidney function Secretion Micturition Regulation of extracellular fluid volume and blood pressure Regulation of
More informationSupplemental Table I
Supplemental Table I Cortex Hippocampus Age (weeks) Genotype STE 61 pste 61 STE 61 pste 61 8 100.0 ± 4.4 96.2 ± 6.0 99.8 ± 8.7 167.5 ± 7.8* 100.0 ± 7.0 90.5 ± 13.8 100.0 ± 12.8 260.4 ± 33.9** 12 100.0
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: immunoprecipitation with anti-casr antibody The Casr protein was expressed in transiently transfected HEK cells. Cell lysates from HEK cells were subjected
More informationNephritic vs. Nephrotic Syndrome
Page 1 of 18 Nephritic vs. Nephrotic Syndrome Terminology: Glomerulus: A network of blood capillaries contained within the cuplike end (Bowman s capsule) of a nephron. Glomerular filtration rate: The rate
More informationSupplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
More informationUNRAVELING THE MECHANISM OF CELL DEATH IN BIO- ARTIFICIAL SKELETAL MUSCLE CAUSED BY MECHANICAL COMPRESSION
UNRAVELING THE MECHANISM OF CELL DEATH IN BIO- ARTIFICIAL SKELETAL MUSCLE CAUSED BY MECHANICAL COMPRESSION Unraveling the Mechanism of Cell Death in Bio-Artificial Skeletal Muscle Caused by Mechanical
More informationBody fluid volume is small (~5L (blood + serum)) Composition can change rapidly e.g. due to increase in metabolic rate
Renal physiology The kidneys Allow us to live on dry land. Body fluid volume is small (~5L (blood + serum)) Composition can change rapidly e.g. due to increase in metabolic rate Kidneys maintain composition
More informationLECTURE 25: FILTRATION AND CLEARANCE NEPHRON FILTRATION
LECTURE 25: FILTRATION AND CLEARANCE NEPHRON FILTRATION 1. Everything in the plasma is filtered except large proteins and red blood cells. The filtrate in Bowman s capsule is an isosmotic fluid that is
More information1. Disorders of glomerular filtration
RENAL DISEASES 1. Disorders of glomerular filtration 2. Nephrotic syndrome 3. Disorders of tubular transport 4. Oliguria and polyuria 5. Nephrolithiasis 6. Disturbances of renal blood flow 7. Acute renal
More informationNature Medicine: doi: /nm.3891
Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,
More informationREVIEW ARTICLE NEWER BIOMARKERS IN EARLY DIABETIC NEPHROPATHY
JCD REVIEW ARTICLE NEWER BIOMARKERS IN EARLY DIABETIC NEPHROPATHY SAPTARSHI MUKHOPADHYAY* *FACULTY (DEPARTMENT OF MEDICINE), B R SINGH HOSPITAL (EASTERN RAILWAY), KOLKATA. INTRODUCTION renal disease. It
More informationFine structural appearances of glomerular capillaries in a case of malignant hypertension
J. clin. Path. (1969), 22, 579-583 Fine structural appearances of glomerular capillaries in a case of malignant hypertension R. F. MACADAM From the University Department of Pathology, Western Infirmary,
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationThe principal functions of the kidneys
Renal physiology The principal functions of the kidneys Formation and excretion of urine Excretion of waste products, drugs, and toxins Regulation of body water and mineral content of the body Maintenance
More informationUnderstanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma
Understanding Signaling Pathways by Modifying Sensitivity to PLX4720 in B-RAF V600E Melanoma Muska Hassan NCI-ICBP Summer Fellow Broad Institute of MIT and Harvard: Cancer Program Mentor: Cory Johannessen,
More informationCONTRACTING ORGANIZATION: Rush University Medical Center Chicago, IL 60612
AD Award Number: W81XWH-11-1-0302 TITLE: Yin and Yang of Heparanase in breast Tumor Initiation PRINCIPAL INVESTIGATOR: Xiulong Xu, Ph.D. CONTRACTING ORGANIZATION: Rush University Medical Center Chicago,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/471/eaah5085/dc1 Supplementary Materials for Phosphorylation of the exocyst protein Exo84 by TBK1 promotes insulin-stimulated GLUT4 trafficking Maeran Uhm,
More informationStudy of Micro Albuminuria and Other Parameters in NIDDM Individuals
IOSR Journal of Dental and Medical Sciences (IOSRJDMS) eissn: 22790853, pissn: 22790861.Volume 15, Issue 2 Ver. I (Feb. 2016), PP 1418 www.iosrjournals.org Study of Albuminuria and Other Parameters in
More informationFibroblast Growth Factor 21 Improves Insulin Resistance and Ameliorates Renal Injury in db/db Mice
Fibroblast Growth Factor 21 Improves Insulin Resistance and Ameliorates Renal Injury in db/db Mice Hyunwook Kim Department of Medicine The Graduate School, Yonsei University Fibroblast Growth Factor 21
More informationH I S T O L O G Y O F T H E U R I N A R Y S Y S T E M
SCPA 602- Anatomical Basis For Pathological Study H I S T O L O G Y O F T H E U R I N A R Y S Y S T E M S O M P H O N G N A R K P I N I T, M. D. D E P A R T M E N T O F P A T H O B I O L O G Y F A C U
More informationOrdering Physician. Collected REVISED REPORT. Performed. IgG IF, Renal MCR. Lambda IF, Renal MCR. C1q IF, Renal. MCR Albumin IF, Renal MCR
RenalPath Level IV Wet Ts IgA I Renal IgM I Renal Kappa I Renal Renal Bx Electron Microscopy IgG I Renal Lambda I Renal C1q I Renal C3 I Renal Albumin I Renal ibrinogen I Renal Mayo Clinic Dept. of Lab
More informationUrinary system. Lab-7
Urinary system Lab-7 Excretion: processes that remove wastes and excess materials from the body Urinary system (kidneys): excretes nitrogenous wastes, excess solutes, and water The Kidneys Regulate Water
More informationConstruction of Nephron by Fusion of Adult Glomeruli to Ureteric Buds with Type V Collagen. Yusuke Murasawa, Pi-chao Wang
Construction of Nephron by Fusion of Adult Glomeruli to Ureteric Buds with Type V Collagen Yusuke Murasawa, Pi-chao Wang Abstract Although tissue engineering of artificial organs such as skin or cartilage
More informationCyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells
Research article Cyclin I activates Cdk5 and regulates expression of Bcl-2 and Bcl-XL in postmitotic mouse cells Paul T. Brinkkoetter, 1 Paul Olivier, 2 Jimmy S. Wu, 1 Scott Henderson, 1 Ronald D. Krofft,
More informationNEPHROTIC SYNDROME OF ACQUIRED SYPHILIS-A MORPHOLOGICAL AND ULTRASTRUCTURAL STUDY
NEPHROTIC SYNDROME OF ACQUIRED SYPHILIS-A MORPHOLOGICAL AND ULTRASTRUCTURAL STUDY Abstract Pages with reference to book, From 3 To 7 A.H. Nagi, I.A. Naveed, A. Rashid ( Department of Pathology, Allama
More informationGlomerular Pathology- 1 Nephrotic Syndrome. Dr. Nisreen Abu Shahin
Glomerular Pathology- 1 Nephrotic Syndrome Dr. Nisreen Abu Shahin The Nephrotic Syndrome a clinical complex resulting from glomerular disease & includes the following: (1) massive proteinuria (3.5 gm /day
More informationLaboratory Training. Summer Internship 2015 ACRM
Laboratory Training Summer Internship 2015 ACRM Pipetting Volumes: 1000µL, 100µL, 10µL 15 repeats each Acceptable variation 5% Method Pipette distilled H20 onto a balance and record the weight Microbeads
More informationRenal System Physiology
M58_MARI0000_00_SE_EX09.qxd 7/18/11 2:37 PM Page 399 E X E R C I S E 9 Renal System Physiology Advance Preparation/Comments 1. Prior to the lab, suggest to the students that they become familiar with the
More informationSUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
More informationDiabetic Nephropathy 2009
Diabetic Nephropathy 2009 Michael T McDermott MD Director, Endocrinology and Diabetes Practice University of Colorado Hospital Michael.mcdermott@ucdenver.edu Diabetic Nephropathy Clinical Stages Hyperfunction
More informationMicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
More informationQuestions? Homework due in lab 6. PreLab #6 HW 15 & 16 (follow directions, 6 points!)
Questions? Homework due in lab 6 PreLab #6 HW 15 & 16 (follow directions, 6 points!) Part 3 Variations in Urine Formation Composition varies Fluid volume Solute concentration Variations in Urine Formation
More informationEXPERIMENTAL AND THERAPEUTIC MEDICINE 7: , 2014
EXPERIMENTL ND THERPEUTIC MEDICINE 7: 1767-1771, 2014 JW regulates human esophageal squamous cell carcinoma and human esophageal cells through different mitogen activated protein kinase signaling pathways
More informationProf. Andrzej Wiecek Department of Nephrology, Endocrinology and Metabolic Diseases Medical University of Silesia Katowice, Poland.
What could be the role of renal denervation in chronic kidney disease? Andrzej Wiecek, Katowice, Poland Chairs: Peter J. Blankestijn, Utrecht, The Netherlands Jonathan Moss, Glasgow, UK Prof. Andrzej Wiecek
More informationDr P Sigwadi 30 May 2012
Dr P Sigwadi 30 May 2012 Introduction Haematuria Positive blood on urine dipstick 5 red blood cells/ microliter of urine Prevalence Gross haematuria ( macroscopic) 0.13 % Microscopic- 1.5% Haematuria +
More information