Supplementary Figure 1
|
|
|
- Sheryl George
- 5 years ago
- Views:
Transcription
1 Supplementary Figure 1. (A) Representative confocal analysis of cardiac mesenchymal cells from nondiabetic (ND-CMSC) and diabetic (D-CMSC) immunostained with anti-h3k9ac and anti-h3k27me3 antibodies. Analysis was performed after 7 days of culture in growth medium, (n=3). (B) Representative confocal analysis of HL-1 cells immunostained with anti-h3k9ac antibodies. Cells were cultured in basal condition (U) or in the presence of high glucose (G) or Mannitol (M) (25mM). The far-right pictures (upper and lower) show the effect of Glucose (G) withdrawal and culture in the presence of growth medium (GM) for 48 hours (G+48h GM).
2 Supplementary Figure 2. (A) Cell proliferation evaluated in HUVEC with Glucose or Mannitol (25 mm) for 6 days.(b) Representative pictures of capillary like structure formation assay evaluated after 7 hours from plating HUVEC on Cultrex. Cell were cultured for 6 days in normal condition (N) or in the presence or Glucose (G) or Mannitol (M) (25 μm). The graph bar shows average microtubules length mesuared after after 7 hours from plating, (n=3, *P 0.05).
3 Supplementary Figure 3. (A) The upper panel shows a representative result of western blotting analysis performed to evaluate H3K9Ac levels in HUVEC kept in normal condition (N) or grown in the presence or absence of Glucose (G) or Mannitol (M) (25 μm). The relative band density is shown in the lower graph panel.the same filter was immunostained with anti β-actin, to show equal total protein loading, (n=3, *P 0.05).(B) Confocal immunofluorescence analysis to evaulate H3K9Ac levels in HUVEC treated with Glucose and Mannitol. Hoechst (H) was used to stain DNA in the cell nuclei.(c) Total HAT and (D) HDAC activity measured in HUVEC exposed to Glucose or Mannitol for 7 days (25 μm) (n=3, P* 0.05).
4 Supplementary Figure 4. (A) Western blotting analysis of HUVEC total extracts. The expression of H3K9Ac has been determined in normal condition (N) or in cells treated with Glucose (G) and Mannitol (M) in the presence or absence of SPV106 (1 or 10 μm) (n=3, *P 0.05). (B) Representative pictures obtaine by confocal microscopy performed in HUVEC stained with H3K9Ac antibodies before and after after treatment with SPV106 (10 μm) (C) Total HAT activity determined in HUVEC in the presence or absence of Mannitol or Glucose (25μM) with or withour SPV106 (10 μm),,(n=3, P* 0.05). (D) Proliferation assay performed at day 0 and 6 of cell culture in HUVEC grown in the presence of Mannitol or Glucose (25 mm). (E) Capillary like structure formation evaluated in HUVEC cultured in the presence or absence of with SPV106 (10μM). The bar graph represent the average value determined in cells exposed to normal growth condition or cultured in the presence of Mannitol or Glucose (25 μm) with or without SPV106 (10μM); (n=3, *P 0.05).
5 Supplementary Figure 5. Metabolic profile of normoglycaemic (ND-CMSC), type-2 diabetic (D- CMSC) and SPV106-treated type-2 diabetic CMSCs (D-CMSC + SPV106). (A) : Schematic description of oxygen consumption rate (OCR) and (B) extracellular acidification rate (ECAR) determination by the Seahorse Bioscience XF e 96 Analyzer. (C) Determination of OCR by injecting oligomycin (ATP coupler; proton leak and ATP production) at rate 5, FCCP (ETC accelerator; max. respiration) at rate 10 and antimycine A and rotenone (mito inhibitor A and B) at rate 15 in ND-CMSC, D-CMSC and SPV106 treated D-CMSC.(D)Area under curve (AUC) of basal and (E)maximal respiration in ND-CMSC, D- CMSC and SPV106 treated D-CMSC. (F) Determination of ECAR) by injecting glucose (glycolysis substrate) at rate 5, oligomycin (ATP Coupler; max. glycolytic capacity) at rate 10 and 2-DG (glycolysis inhibitor) at rate 15 in ND-CMSC, D-CMSC and SPV106 treated D-CMSC. (G) Area under curve (AUC) of basal and(h) maximal glycolysis in ND-CMSC, D-CMSC and SPV106 treated D-CMSC. Data presented as mean + SEM of 5 ND-CMSC, and 4 D-CMSC; p 0.05, determined by students t- test.(i)evaluation of ATP content in ND-CMSC and D-CMSC. The graph shows the relative luminescence (RLU) determined by ATP content. Data are represented as mean±sd. *P 0.05; #=not significant.
6
7 Supplementary Table 1. List of patients enrolled in the study and relevant clinical features. Patients were divided in two groups according to the presence or absence of diabetes. Patients 1, 3, 4, 5 and 9 suffered of T2-diabetes since 10, 13, 5, 6 and 16 years respectively. The mean glycaemia value for non-diabetic individuals was ± 17.6; Diabetic patients ± 56.3; p 0,005. Intervention Patie Clinical conditions nts # Age Gender Diabetes Dislipidemya Hypertension AMI CABG VAO VMI Aneurysm 1 75 M M M F M M M M M F F M M M M F M F M M F F AMI: Acute Myocardial Infarction; CABG: Coronary Artery By;pass Graft; VAO: Aortic Valve Replacement; VMI: Mitral Valve Replacement; +: present, -: not present
8 Supplementary Table 2. Therapies Anti-diabetic drugs β- ACE Angiotens. II # blockers Statins Ca- 2+ -ant. inhib. ant. Diuretics 1 GLICLAZIDE GLICLAZIDE METFORMIN, GLICLAZIDE HUMAN INSULIN METFORMIN, GLICLAZIDE ND METFORMIN INSULIN GLARGINE, GLIMEPIRIDE, METFORMIN GLICLAZIDE REPAGLINIDE GLICLAZIDE METFORMIN N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A: not applicable; ND: not determined. +=treated; -= not treated
9 Supplementary Table 3. Antibody Manufacturer Dilution rabbit anti human pcaf Abcam 1:250 rabbit anti human MeCP-2 Abcam 1:300 mouse anti human GCN5a Abcam 1:250 rabbit anti human HP-1 Abcam 1:300 mouse anti human -Actin Abcam 1:1000 rabbit anti human c-kit DAKO 1:500 rabbit anti human VEGFR2 Abcam 1:500 mouse anti human MDR-1 Sigma Aldrich 1:500 goat ant human Nucleostemin Cell Signaling 1:500 rabbit anti human H3K9Ac Abcam 1:1000 rabbit anti human H3K9Me Abcam 1:500 rabbit anti human H3K9Me2 Abcam 1:1000 rabbit anti human H3K9Me3 Abcam 1:500 rabbit anti human H3K14Ac Abcam 1:1000 rabbit anti human H3K27Me3 Abcam 1:500 rabbit anti human H3S10P Abcam 1:1000 rabbit anti human H4K16Ac Abcam 1:1000 rabbit anti human H3K4Me Abcam 1:1000 rabbit anti human H3K4Me2 Abcam 1:500 rabbit anti human H3K4Me3 Abcam 1:500 rabbit anti human H4K20Me Abcam 1:500 rabbit anti human H4K20Me3 Abcam 1:500 rabbit anti human H3.3 Abcam 1:500 rabbit anti human pan H3 Ac Active Motif 1:300 rabbit anti human H3 Total Abcam 1:1000 rabbit anti human H4 Total Abcam 1:1000
Performing Bioenergetic Analysis: Seahorse XFe96 Analyzer
icell Cardiomyocytes 2 Application Protocol Performing Bioenergetic Analysis: Seahorse XFe96 Analyzer Introduction The myocardium is the most metabolically active tissue in the body and is highly sensitive
Application Note. Introduction
Simultaneously Measuring Oxidation of Exogenous and Endogenous Fatty Acids Using the XF Palmitate-BSA FAO Substrate with the Agilent Seahorse XF Cell Mito Stress Test Application Note Introduction The
Cell Metabolism Assays. for. Immunology. Research
the immunity-metabolism link Cell Metabolism Assays for Immunology Research GOLD STANDARD ASSAYS FOR MEASURING METABOLIC RePROGRAMMING Metabolic Signatures Cell activation, amplification, and effector
Cell Metabolism Assays. for OMICS. Research
Gene-Protein-metabolism links Cell Metabolism Assays for OMICS Research STANDARD Parameters of Functional METABOLIsm Genomics Cells use gene expression to synthesize proteins and other products that are
XF Data Normalization by the Agilent Seahorse XF Imaging and Normalization System
Application Note Normalization XF Data Normalization by the Agilent Seahorse XF Imaging and Normalization System Authors Yoonseok Kam Kellie Chadwick Ned Jastromb Brian P. Dranka Agilent Technologies,
Nature Medicine: doi: /nm.3891
Supplementary Figure 1. Subjective responses. Thermal sensation, thermal comfort and self-reported shivering, determined at several time points (from t = min until t = 36 min) after entering the cold room,
Identifying Metabolic Phenotype Switches in Cancer Cells Using the Agilent Seahorse XF Analyzer in an Hypoxic Environment
Identifying Metabolic Phenotype Switches in Cancer Cells Using the Agilent Seahorse XF Analyzer in an Hypoxic Environment Application Note Introduction Decreased oxygen levels, or hypoxia, and hypoxic-mediated
Agilent Technologies: Seahorse XF Introduction
Agilent Technologies: Seahorse XF Introduction Tools for investigating cell metabolism diagnostic procedures. 1 The Engines Cells Generate Energy via Two Metabolic Pathways Glycolysis [ H + ] Respiration
Quantifying Cellular ATP Production Rate Using Agilent Seahorse XF Technology
White Paper Quantifying Cellular ATP Production Rate Using Agilent Seahorse XF Technology Authors Natalia Romero George Rogers Andy Neilson Brian P. Dranka Agilent Technologies, Inc., Lexington, MA, USA
Supporting Information
Supporting Information van der Windt et al. 10.1073/pnas.1221740110 SI Materials and Methods Mice and Reagents. C57BL/6 and major histocompatibility complex class I-restricted OVA-specific T-cell receptor
Human induced pluripotent stem cell derived cardiomyocytes are a more relevant model for assessing drug-induced effects on mitochondrial function
Human induced pluripotent stem cell derived cardiomyocytes are a more relevant model for assessing drug-induced effects on mitochondrial function than H9C2 cells 16 January 2013 SLAS2013 Presentation Outline
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream signals in in vitro Symbol Gene ID RefSeqID Clone ID
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 Supplementary Table 1 Gene clone ID for ShRNA-mediated gene silencing TNFα downstream
SOD1 inhibition reduces non-small cell lung cancer by inducing cell death
SUPPLEMENTAL INFORMATION SOD1 inhibition reduces non-small cell lung cancer by inducing cell death Andrea Glasauer, Laura A. Sena, Lauren P. Diebold, Andrew P. Mazar & Navdeep S. Chandel Inventory of Supplemental
McWilliams et al., http :// /cgi /content /full /jcb /DC1
Supplemental material JCB McWilliams et al., http ://www.jcb.org /cgi /content /full /jcb.201603039 /DC1 THE JOURNAL OF CELL BIOLOGY Figure S1. In vitro characterization of mito-qc. (A and B) Analysis
Ryan McGarrigle, Ph.D.
Cardiomyocyte function characterised through combined analysis of metabolic flux, beat rate and cellular oxygenation and its application in in vitro ischemia reperfusion modelling Ryan McGarrigle, Ph.D.
Islet Assay Using the Agilent Seahorse XF24 Islet Capture Microplate
Islet Assay Using the Agilent Seahorse XF24 Islet Capture Microplate Technical Overview Introduction Agilent Seahorse XF Analyzers are most commonly used with an adherent monolayer of cells attached to
Metabolism and the extracellular flux bioanalyzer. Bioenergetics and Metabolism
7/3/8 Metabolism and the extracellular flux bioanalyzer Jianhua Zhang Department of Pathology University of Alabama at Birmingham 8 Bioenergetics and Metabolism Neurodegeneration: Parkinson s, Huntington
Time after injection (hours) ns ns
Platelet life span (% iotinylated platelets) 1 8 6 4 2 4 24 48 72 96 Time after injection (hours) 6 4 2 IgG GPIα GPIβ GPII GPVI Receptor expression (GeoMean, fluorescence inteity) Supplementary figure
doi: /nature14508 Rappsilber et al.
SUPPLEMENTARY INFORMATION doi:1.138/nature1458 Grosso et al. Barbosa et al. 74 72 45 33 47 7 51 Rappsilber et al. Supplementary Figure 1 a, Venn-Diagram of identified splice factors in the work of Barbossa
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
Rapid Analysis of Glycolytic and Oxidative Substrate Flux of Cancer Cells in a Microplate
Rapid Analysis of Glycolytic and Oxidative Substrate Flux of Cancer Cells in a Microplate Lisa S. Pike Winer, Min Wu* Seahorse Bioscience Inc., North Billerica, Massachusetts, United States of America
AWARD NUMBER: W81XWH TITLE: BIOENERGETICS OF STROMAL CELLS AS A PREDICTOR OF AGGRESSIVE PROSTATE CANCER
AWARD NUMBER: W81XWH-14-1-0255 TITLE: BIOENERGETICS OF STROMAL CELLS AS A PREDICTOR OF AGGRESSIVE PROSTATE CANCER PRINCIPAL INVESTIGATOR: Praveen K. Vayalil RECIPIENT: University of Alabama at Birmingham
Supplementary Figure 1
Supplementary Figure 1 The average sigmoid parametric curves of capillary dilation time courses and average time to 50% peak capillary diameter dilation computed from individual capillary responses averaged
Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
CELLULAR BIOENERGETICS FOR THE 21st CENTURY
CELLULAR BIOENERGETICS FOR THE 21st CENTURY Seahorse XF Extracellular Flux Analyzers XF Extracellular Flux Analyzer PROVIDING A NEW WINDOW INTO CELLULAR BIOENERGETICS Before Seahorse developed With an
Islet Oxygen Consumption Assay using the XF24 Islet Capture Microplate Shirihai Lab and Seahorse Bioscience Aug
1 Islet Oxygen Consumption Assay using the XF24 Islet Capture Microplate Shirihai Lab and Seahorse Bioscience Aug 6 2009 XF Analyzers are most commonly used with an adherent monolayer of cells attached
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
Boucher et al NCOMMS B
1 Supplementary Figure 1 (linked to Figure 1). mvegfr1 constitutively internalizes in endothelial cells. (a) Immunoblot of mflt1 from undifferentiated mouse embryonic stem (ES) cells with indicated genotypes;
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/385/ra70/dc1 Supplementary Materials for The interaction of heparan sulfate proteoglycans with endothelial transglutaminase-2 limits VEGF 165 -induced angiogenesis
Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
Supporting Information. Non-thermal plasma with 2-deoxy-D-glucose synergistically induces cell death by targeting glycolysis in blood cancer cells
Supporting Information Non-thermal plasma with 2-deoxy-D-glucose synergistically induces cell death by targeting glycolysis in blood cancer cells Neha Kaushik, 1 Su Jae Lee, 2 Tae Gyu Choi 3, Ku Youn Baik,
Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
SUPPLEMENTARY DATA. Biologie and Pathology, Grenoble, France,
SUPPLEMENTARY DATA MitoCeption as a new tool to assess the effects of mesenchymal stem/stromal cell mitochondria on cancer cell metabolism and functions Andrés Caicedo a,b, Vanessa Fritz c, Jean-Marc Brondello
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
Supplement materials:
Supplement materials: Table S1: ICD-9 codes used to define prevalent comorbid conditions and incident conditions Comorbid condition ICD-9 code Hypertension 401-405 Diabetes mellitus 250.x Myocardial infarction
Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
Supplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
Fatty Acid Oxidation Assay on the XF24 Analyzer
Fatty Acid Oxidation Assay on the XF24 Analyzer Mitochondria oxidize a variety of fuels to generate ATP through oxidative phosphorylation. Cells can utilize fatty acid, glucose and amino acids as their
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
Metabolism of Herpes Simplex Virus 1 infected RAW macrophages
Metabolism of Herpes Simplex Virus 1 infected RAW 264.7 macrophages A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science By Mary Kathryn Jenkins B.S., Bowling
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Expanded View Figures
PEX13 functions in selective autophagy Ming Y Lee et al Expanded View Figures Figure EV1. PEX13 is required for Sindbis virophagy. A, B Quantification of mcherry-capsid puncta per cell (A) and GFP-LC3
Galactose Enhances Oxidative Metabolism and Reveals Mitochondrial Dysfunction in Human Primary Muscle Cells
Galactose Enhances Oxidative Metabolism and Reveals Mitochondrial Dysfunction in Human Primary Muscle Cells Céline Aguer 1, Daniela Gambarotta 1, Ryan J. Mailloux 1, Cynthia Moffat 1, Robert Dent 2, Ruth
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
Supplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
The Journal of Physiology
J Physiol 594.24 (216) pp 7197 7213 7197 TECHNIQUES FOR PHYSIOLOGY Development of a high-throughput method for real-time assessment of cellular metabolism in intact long skeletal muscle fibre bundles Rui
HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,
GLUT3 upregulation promotes metabolic reprogramming associated with antiangiogenic therapy resistance
GLUT3 upregulation promotes metabolic reprogramming associated with antiangiogenic therapy resistance Ruby Kuang,, Suneil Koliwad, Manish K. Aghi JCI Insight. 2017;2(2):e88815. https://doi.org/10.1172/jci.insight.88815.
LPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
ABSTRACT INTRODUCTION
/, 2017, Vol. 8, (No.50), pp: 87860-87877 Extracellular ATP, as an energy and phosphorylating molecule, induces different types of drug resistances in cancer cells through ATP internalization and intracellular
ClinicalTrials.gov Identifier: NCT Sponsor/company: Sanofi-Aventis. Date: 08/02/ 2008
These results are supplied for informational purposes only. Prescribing decisions should be made based on the approved package insert in the country of prescription Sponsor/company: Sanofi-Aventis ClinicalTrials.gov
Cardiovascular Nursing Practice: A Comprehensive Resource Manual and Study Guide for Clinical Nurses 2 nd Edition
Cardiovascular Nursing Practice: A Comprehensive Resource Manual and Study Guide for Clinical Nurses 2 nd Edition Table of Contents Volume 1 Chapter 1: Cardiovascular Anatomy and Physiology Basic Cardiac
Randomized comparison of single versus double mammary coronary artery bypass grafting: 5 year outcomes of the Arterial Revascularization Trial
Randomized comparison of single versus double mammary coronary artery bypass grafting: 5 year outcomes of the Arterial Revascularization Trial Embargoed until 10:45 a.m. CT, Monday, Nov. 14, 2016 David
Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied.
Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied. (a) Western blotting analysis showing degradation of
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65
SUPPLEMENTARY INFORMATION TITLE: PKCζ Promotes Breast Cancer Invasion by Regulating Expression of E-cadherin and Zonula Occludens-1 (ZO-1) via NFκB-p65 RUNNING TITLE: PKCζ-NFκB Signaling in Breast Cancer
Yoshifusa Abe, 1,2 Toru Sakairi, 3 Craig Beeson, 4 and Jeffrey B. Kopp 2 1
Am J Physiol Renal Physiol 35: F1477 F149, 13. First published September 18, 13; doi:1.1152/ajprenal.182.13. TGF- 1 stimulates mitochondrial oxidative phosphorylation and generation of reactive oxygen
a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.
a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study
Supplementary Table 1. Antibodies and dilutions used in the immunohistochemical study Antigen Species Clone Source Dilution Insulin Guinea pig - Dako, Carpinteria, 1:200 Glucagon Rabbit - Dako, Carpinteria,
p = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
Cellular metabolism made easy: Microplate assays for mitochondrial function & glycolytic flux
Cellular metabolism made easy: Microplate assays for mitochondrial function & glycolytic flux Convenient Microplate Based Analysis of Cell Metabolism Resuspend Add Reagent Measure A simple push-button
HIV-1 pathogenicity and virion production are dependent on the metabolic phenotype of activated CD4+ T cells
Hegedus et al. Retrovirology 2014, 11:98 RESEARCH Open Access HIV-1 pathogenicity and virion production are dependent on the metabolic phenotype of activated CD4+ T cells Andrea Hegedus, Maia Kavanagh
Appendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13
Appendix Table of Contents. Appendix Figure legends S-S3 and Appendix Table S and S. Appendix Figures S-S3 . Appendix Figure legends S-S3 and Appendix Table S and S Appendix Figure S. Western blot analysis
Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
Supplementary Materials for
advances.sciencemag.org/cgi/content/full/1/9/e1500781/dc1 Supplementary Materials for pnaktide inhibits Na/K-ATPase reactive oxygen species amplification and attenuates adipogenesis Komal Sodhi, Kyle Maxwell,
Supporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
LKB1 Deficient Non-small Cell Lung Cancer Cells are Vulnerable to Energy Stress Induced by ATP Depletion
Texas Medical Center Library DigitalCommons@TMC UT GSBS Dissertations and Theses (Open Access) Graduate School of Biomedical Sciences 12-2014 LKB1 Deficient Non-small Cell Lung Cancer Cells are Vulnerable
Bioenergetic characterization of mouse podocytes
Am J Physiol Cell Physiol 299: C464 C476, 2010. First published May 5, 2010; doi:10.1152/ajpcell.00563.2009. Bioenergetic characterization of mouse podocytes Yoshifusa Abe, 1,2 Toru Sakairi, 1 Hiroshi
Supplementary Information
Supplementary Information Title Degeneration and impaired regeneration of gray matter oligodendrocytes in amyotrophic lateral sclerosis Authors Shin H. Kang, Ying Li, Masahiro Fukaya, Ileana Lorenzini,
Nature Neuroscience: doi: /nn.2275
Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.
TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
ab Glycolysis Stress Test Companion Assay
Version 1 Last updated 12 July 2017 ab222945 Glycolysis Stress Test Companion Assay For the characterization of glycolytic stress in live cells when used in combination with Glycolysis Assay [Extracellular
SUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
Valve Disease. Valve Surgery. Total Volume. In 2016, Cleveland Clinic surgeons performed 3039 valve surgeries.
Valve Surgery Total Volume 1 1 Volume 35 3 5 15 1 5 1 13 1 N = 773 5 79 15 93 1 339 In 1, surgeons performed 339 valve surgeries. surgeons have implanted more than 1, bioprosthetic aortic valves since
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
Rapid parallel measurements of macroautophagy and mitophagy in
Supplemental Figures Rapid parallel measurements of macroautophagy and mitophagy in mammalian cells using a single fluorescent biosensor Sargsyan A, Cai J, Fandino LB, Labasky ME, Forostyan T, Colosimo
The subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was
Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was performed on a total of 85 SS patients. Data filtration
Epithelial cell death is an important contributor to oxidant-mediated acute lung injury SUPPORTING INFORMATION 60611, USA
Epithelial cell death is an important contributor to oxidant-mediated acute lung injury SUPPORTING INFORMATION G.R. Scott Budinger 1,2 *, Gökhan M. Mutlu 1 *, Daniela Urich 2, Saul Soberanes 1, Leonard
Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines
CORRECTION NOTICE Nat. Med. doi:10.1038/nm.3547; corrected online 25 August 2014 Aggregated neutrophil extracellular traps limit inflammation by degrading cytokines and chemokines Christine Schauer, Christina
Ischemic Heart Disease Interventional Treatment
Ischemic Heart Disease Interventional Treatment Cardiac Catheterization Laboratory Procedures (N = 11,61) is a regional and national referral center for percutaneous coronary intervention (PCI). A total
1 Respiration is a vital process in living organisms. All organisms carry out glycolysis. The Krebs cycle also occurs in some organisms.
1 Respiration is a vital process in living organisms. All organisms carry out glycolysis. The Krebs cycle also occurs in some organisms. (a) The diagram below shows some of the stages in glycolysis, using
SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
Endothelial PGC 1 - α 1 mediates vascular dysfunction in diabetes
Endothelial PGC-1α mediates vascular dysfunction in diabetes Reporter: Yaqi Zhou Date: 04/14/2014 Outline I. Introduction II. Research route & Results III. Summary Diabetes the Epidemic of the 21st Century
A. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
Intraoperative application of Cytosorb in cardiac surgery
Intraoperative application of Cytosorb in cardiac surgery Dr. Carolyn Weber Heart Center of the University of Cologne Dept. of Cardiothoracic Surgery Cologne, Germany SIRS & Cardiopulmonary Bypass (CPB)