Leptin, an adipocyte-derived hormone, contributes

Transcription

1 Original Article Metformin Restores Leptin Sensitivity in High-Fat Fed Obese Rats With Leptin Resistance Yong-Woon Kim, 1 Jong-Yeon Kim, 1 Yong-Hoon Park, 2 So-Young Park, 1,3 Kyu-Chang Won, 4 Kwang-Hae Choi, 2 Jung-Yoon Huh, 1 and Ki-Hak Moon 5 To evaluate whether metformin enhances leptin sensitivity, we measured leptin sensitivity after 4 weeks of metformin treatment (300 mg/kg daily) in both standard chow and high-fat fed obese rats. Anorexic and fat-losing responses after intracerebroventricular leptin infusion for 7 days (15 g daily per rat) in standard chow rats were enhanced by metformin treatment, and these responses to leptin were attenuated in high-fat fed obese rats compared with age-matched standard chow rats. However, these responses to leptin were corrected by metformin treatment in high-fat fed obese rats. Moreover, serum concentrations of leptin and insulin were decreased dramatically by leptin in metformin-treated standard chow and high-fat fed obese rats. The hypothalamic phosphorylated AMP-activated protein kinase level was decreased by lower leptin dose in metformin-treated rats than in untreated rats. In an acute study, metformin treatment also increased the anorexic effect of leptin (5 g), and this was accompanied by an increased level of phosphorylated signal transducer and activator of transcription 3 in the hypothalamus. These results suggest that metformin enhances leptin sensitivity and corrects leptin resistance in high-fat fed obese rats and that a combination therapy including metformin and leptin would be helpful in the treatment of obesity. Diabetes 55: , 2006 Leptin, an adipocyte-derived hormone, contributes to body weight homeostasis by regulating food intake and energy expenditure (1). However, leptin is not widely used in the clinical field because obesity is accompanied by elevated serum leptin and responds poorly to the pharmacological administration of From the 1 Department of Physiology, College of Medicine, Yeungnam University, Daegu, Republic of Korea; 2 Department of Pediatrics, College of Medicine, Yeungnam University, Daegu, Republic of Korea; 3 Aging-Associated Vascular Disease Research Center, College of Medicine, Yeungnam University, Daegu, Republic of Korea; 4 Department of Internal Medicine, College of Medicine, Yeungnam University, Daegu, Republic of Korea; 5 Department of Urology, College of Medicine, Yeungnam University, Daegu, Republic of Korea. Address correspondence and reprint requests to Yong-Woon Kim, MD, PhD, Department of Physiology, College of Medicine, Yeungnam University, #317-1, Daemyungdong, Namgu, Daegu , Republic of Korea. ywkim@med.yu.ac.kr. Received for publication 19 July 2005 and accepted in revised form 29 November AMPK, AMP-activated protein kinase; CRF, corticotrophin releasing factor; CSF, cerebrospinal fluid; pacc, phosphorylated acetyl-coa carboxylase; pampk, phosphorylated AMPK; pstat3, phosphorylated signal transducer and activator of transcription 3; STAT, signal transducer and activator of transcription by the American Diabetes Association. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. exogenous leptin, which ordinarily potently promotes fat mass loss and body weight reduction in lean subjects (2,3); moreover, this poor response of obese subjects is a characteristic of leptin resistance. Thus, the correction of leptin resistance in obese individuals would allow leptin to be used to treat obesity. Metformin, an oral biguanide insulin-sensitizing agent, inhibits hepatic glucose production, enhances the effects of insulin on glucose uptake in skeletal muscles and adipocytes, and decreases intestinal absorption of glucose (4 7). It is also well known that metformin administration reduces body weight (8,9). Moreover, metformin decreases leptin concentration in morbidly obese subjects (9,10) and in normal-weight healthy men (11). Although leptin concentration is closely related to body fat mass, the leptin-reducing effect of metformin cannot be fully explained by body weight reduction because metformin reduces leptin level even without changing body weight in normal-weight healthy men (11). However, the mechanisms by which metformin reduces body weight and leptin concentration are poorly understood. In addition, it has been recently reported that metformin targets AMP-activated protein kinase (AMPK), which is also activated by leptin (12 14). The above findings imply that a more delicate interaction takes place between metformin and leptin. We hypothesized that metformin increases leptin sensitivity and that the anorexic and leptin-reducing effects of metformin are a result of increased leptin sensitivity. RESEARCH DESIGN AND METHODS Male Sprague-Dawley rats were purchased from the Daehan Experimental Animal Center (Seoul, Korea) in a postweaning state. After 1 week of adaptation, the rats were divided into two groups, i.e., standard chow and high-fat fed groups. The animals were cared for in accordance with the principles of the Guide to the Care and Use of Experimental Animals of the Yeungnam Medical Center. The rats were housed individually under a 12-h light/dark cycle (from 0700 to 1900). Experimental design Experiment 1. To evaluate the leptin sensitizing effect of metformin, the standard chow rats were divided into three groups at 4 months of age: ad libitum fed (untreated) rats, metformin-treated (treated) rats, and a group of rats pair-fed with the treated rats. The pair-fed rats began the experiment 1 week later than the treated rats, and the amount of food consumed by the treated group was then provided to the pair-fed group in the morning. Each of these three animal groups were further divided into two experimental groups: the artificial cerebrospinal fluid (CSF)-infused group (vehicle) and the leptininfused group, which were matched for body weight and daily caloric intake (n 8 in each group). In addition to the above six experimental groups, different dosages of leptin (0, 0.6, 3, or 15 g leptin daily for treated rats and 0, 0.6, or 15 g leptin daily for untreated rats) were infused into standard chow rats to examine leptin dose responsiveness. We also measured the effects of short-term metformin treatment (300 mg/kg s.c. daily for 2 days) on the anorexic effect of leptin. Leptin (5 g) was 716 DIABETES, VOL. 55, MARCH 2006

2 Y.-W. KIM AND ASSOCIATES injected into the lateral ventricle through a chronically implanted catheter in unrestrained rats on the second day of metformin treatment. Food intake was measured at 6, 12, and 24 h after leptin injection. The body weights before leptin injection in metformin-treated and untreated rats were and g, respectively. To evaluate leptin signaling, the phosphorylated signal transducer and activator of transcription 3 (pstat3) level was measured in the hypothalamus 1 h after an intracerebroventricular injection of leptin (0, 0.1, or 1 g) in rats treated with metformin (300 mg/kg s.c. daily, two consecutive mornings) or saline. Leptin was injected 2 h after the second treatment of metformin. Experiment 2. To evaluate whether metformin can correct leptin resistance in a leptin-resistant rat model, high-fat fed obese rats were treated with metformin for 4 weeks. A leptin-resistant obese rat model was produced by a high-fat diet for 4 months. The high-fat diet was composed of butter, corn oil, sucrose, and casein (38, 21, 23, and 17%, respectively, of total calories) supplemented with vitamins (0.8%), minerals (1.9%), and methionine (0.15%). To confirm leptin resistance before starting metformin treatment, we took blood ( 400 l) from a tail vein under ethrane anesthesia to measure the serum leptin level after 12 weeks on a high-fat or standard chow diet. The serum leptin concentration was significantly elevated in high-fat fed obese rats compared with standard chow rats ( vs ng/ml, respectively; P 0.01). The high-fat fed obese rats were then divided into three groups as described above for standard chow rats (i.e., untreated, treated, and pair-fed rats) and these three animal groups were similarly further divided into vehicle and leptin groups (n 8 in each group). Experiment 3. To evaluate whether metformin has the same effect in a genetically obese animal model, metformin was administered to 7-month-old Otsuka Long-Evans Tokushima Fatty (OLETF) rats and their wild-type LETO rats for 3 weeks. Changes in food intake, body weight, leptin concentration were documented. The pathogenic defect in OLETF rats is a cholecystokinin A receptor defect in the hypothalamus, and these rats show severe fat depositions in visceral regions. Metformin treatment. Metformin (300 mg/kg daily) was dissolved in drinking water and administered orally for 4 weeks. Metformin concentrations in water were readjusted twice a week after measuring daily water intake. The untreated and pair-fed rats received drinking water without metformin ad libitum. Leptin or vehicle administration. Rats were infused with either vehicle or leptin (15 g daily) for 7 days into the lateral ventricle, using an osmotic minipump. On the morning of the experiment, rats were anesthetized with xylazine hydrochloride (8 mg/kg s.c.) and ketamine (90 mg/kg i.p.). A brain infusion cannula (Alzet, Cupertino, CA) was stereotaxically placed into the lateral ventricle, using the following coordinates: 1.3 mm posterior to bregma, 1.9 mm lateral to the midsagittal suture, and to a depth of 4.0 mm. A subcutaneous pocket was created using blunt dissection on the dorsal surface and an osmotic minipump (Alzet) was inserted. A catheter tube was connected from the brain infusion cannula to the osmotic minipump, and the brain infusion cannula was secured to the surface of the skull using a jeweler s screw and acrylic dental cement. The incision was closed with sutures, and rats were kept warm until fully recovered. The infusion rate used was 1 l/h. Tissue harvesting and preparation. Rats were anesthetized with pentobarbital (85 mg/kg i.p.). CSF was taken through a puncture into the fourth ventricle under stereotaxic fixation, blood samples were collected by heart puncture, and serum was harvested by a 10-min centrifugation in serum separator tubes. The circulatory system was perfused with 50 ml of cold saline, and retroperitoneal white adipose tissue and hypothalamus were excised. Tissues and serum were quick-frozen with liquid nitrogen and stored at 70 C. RT-PCR. Total RNA was extracted from hypothalamus, using a modification of the method of Chomczynski and Sacchi (15). Then, 1 g total RNA was reverse-transcribed into cdna using a Qiagen one-step RT-PCR kit (Hilden, Germany). The POMC sense primer sequence was CCCGAGAAACAGCAG CAGTG, and the antisense primer sequence was AGGGGGCCTTGGA GTGAGAA. The amplification was initiated at 50 C for 30 min, followed by 30 cycles consisting of denaturation at 94 C for 1 min, annealing at the appropriate primer-pair annealing temperature for 1 min, extension at 72 C for 1 min, and a final extension step of 10 min at 72 C. -Actin (sense: TCTACAAT GAGCTGCGTGTG, and antisense: GGTCAGGATCTTCATGAGGT) was used as an internal standard. The RT-PCR products were electrophoresed in 11.5% agarose gels and visualized by ethidium bromide staining. Western blot analysis. Protein (30 g) in hypothalamic lysate was separated on 10% polyacylamide gels and then transferred onto nitrocellulose membranes. Phosphorylated AMPK (pampk), phosphorylated acetyl-coa carboxylase (pacc), and pstat3 level were determined by blotting with their specific antibodies (Cell Signaling, Danvers, MA), and total levels of AMPK, ACC, and signal transducer and activator of transcription 3 (STAT3) were estimated in separate blots. In each case, anti-rabbit antibody linked to TABLE 1 The serum concentrations of leptin, insulin, and CRF in the experimental groups Leptin (ng/ml) Insulin (ng/ml) CRF (ng/ml) Standard chow Untreated Vehicle Leptin * Treated Vehicle Leptin Pair-fed Vehicle Leptin High-fat diet Untreated Vehicle * * Leptin Treated Vehicle Leptin Pair-fed Vehicle Leptin Data are means SE of eight rats per group. *P 0.05 vs. untreated vehicle standard chow rats; P 0.01 vs. untreated vehicle standard chow rats; P 0.01 vs. their vehicle rats; P 0.05 vs. their vehicle rats; P 0.05 vs. their treated leptin rats; P 0.05 vs. untreated vehicle high-fat fed obese rats. horseradish peroxidase was used as the secondary antibody. Blots were developed by enhanced chemiluminescence (Amersham Biosciences, Little Chalfont, Buckinghamshire, U.K.), and quantification was performed using Scion Image software. Measurements of leptin, insulin, and corticotrophin releasing factor. Serum leptin level was measured using a rat leptin radioimmunoassay kit (Linco Research, St. Charles, MO), CSF leptin using a leptin immunoassay kit (Quankine M; R&D Systems, Minneapolis, MN), serum insulin using a rat insulin enzyme immunosorbent assay kit (SPI-BIO, Massy, France), and serum corticotrophin releasing factor (CRF) level using a rat CRF enzyme immunosorbent assay kit (Phoenix Pharmaceuticals, Belmont, CA). Statistical analysis. Data are the means SE. Differences between the groups were analyzed by ANOVA, followed by a post hoc test for group comparisons. P 0.05 was considered statically significant. RESULTS Characteristics of the high-fat fed obese rats. The high-fat diet increased body weight significantly compared with the standard chow rats (P 0.05) from 4 weeks until the end of the experiment. The cumulative caloric intake in the high-fat fed obese rats at 4 months was 134% of that of standard chow rats. The retroperitoneal white adipose tissue mass of high-fat fed obese rats was increased by 2.5 times (P 0.001) that of standard chow rats. Serum leptin and insulin concentrations were also significantly higher in high-fat fed obese rats (P 0.01) (Table 1). The effect of metformin in the leptin-infused rats. Metformin treatment alone decreased the caloric intake and body weights of standard chow and high-fat fed obese rats, although these effects were more prominent in highfat fed obese rats (Fig. 1). The leptin treatment in standard chow rats significantly decreased daily caloric intake until day 7 compared with vehicle-administered rats. Moreover, tachyphylaxis developed in the metformin-un- DIABETES, VOL. 55, MARCH

3 METFORMIN ENHANCES LEPTIN SENSITIVITY FIG. 1. Body weight (A) and daily calorie intake (B) in the standard chow and high-fat fed obese rats. Metformin treatment (300 mg/kg daily) was started 14 weeks after high-fat or standard chow dieting. Data are the means SE of eight rats per group., untreated standard chow; f, treated standard chow; E, untreated high-fat fed; F, treated high-fat fed. treated leptin-treated rats from day 5. In high-fat fed obese rats, leptin also suppressed daily caloric intake, although this suppression of appetite was less than that seen in standard chow rats. Leptin treatment reduced body weight by 10% in standard chow rats and by 5% in high-fat fed obese rats (Fig. 3). Metformin treatment was observed to enhance leptin s anorexic and body weight losing effects in standard chow rats and to suppress the development of tachyphylaxis. Metformin treatment also enhanced the anorexic and body weight losing effects of leptin in high-fat fed obese rats. Caloric intake and body weight were also measured after intracerebroventricular leptin infusion in pair-fed rats, excluding the effect of food restriction on the leptin effect. Body weight decreased more slowly in pair-fed rats than in metformin-treated standard chow rats, but the suppression of appetite due to leptin treatment in pair-fed rats did not reach the level of that observed in metformin-treated rats. Leptin treatment reduced retroperitoneal white adipose tissue mass in standard chow rats; however, it did not reduce this mass in high-fat fed obese rats, which is a characteristic of leptin resistance. Metformin treatment reduced retroperitoneal white adipose tissue mass in high-fat fed obese rats and in standard chow rats. Noticeably, retroperitoneal white adipose tissue mass was markedly reduced by leptin treatment in both standard chow and high-fat fed obese rats treated with metformin compared with their untreated counterparts and pair-fed rats. To clarify the leptin-sensitizing effect of metformin, we measured the dose-responsiveness of leptin in standard chow rats. Accordingly, different dosages of leptin were infused into metformin-treated and untreated standard chow rats. In treated rats, leptin s anorexic and body weight losing effects were apparent from 0.6 g leptin daily, and these effects were increased on increasing the dose. However, 0.6 g leptin daily failed to reduce the daily caloric intake as well as body weight in untreated rats. Moreover, visceral fat mass was reduced dramatically by leptin treatment even at 0.6 g daily in metformintreated standard chow rats; however, this dose had no significant effect on untreated standard chow rats. Cumulative caloric intake and body weight decreased in metformin-treated standard chow rats in a leptin dose dependent manner (Fig. 2). Serum levels of leptin, insulin, and CRF and the CSF leptin concentration. The serum levels of leptin and insulin were elevated in high-fat fed obese rats, which did not respond to leptin treatment. Metformin treatment per se decreased serum concentrations of leptin and insulin in high-fat fed obese rats, and these levels were further decreased by leptin treatment. Combined treatment with metformin and leptin dramatically decreased serum concentrations of leptin and insulin in standard chow rats. The serum CRF concentration was higher in high-fat fed obese rats than in standard chow rats, and this was not changed by leptin treatment in high-fat fed obese rats, but it was reduced by leptin in standard chow rats. Metformin did not change the CRF level in standard chow rats, but it reduced the CRF level in high-fat fed obese rats. Leptin treatment reduced the serum leptin level in pair-fed highfat fed obese rats, but no significant change in CRF level was observed in these rats (Table 1). No significant difference was observed between the CSF leptin concentrations in standard chow and high-fat fed obese rats, despite hyperleptinemia in high-fat fed obese rats. Metformin treatment significantly increased the CSF leptin level in both standard chow and high-fat fed obese rats (P 0.05), and the CSF-to-serum leptin ratio was increased in treated rats (Fig. 4). Proopiomelanocortin mrna expressions and the levels of pampk and pacc in the hypothalamus. Proopiomelanocortin (POMC) expression was significantly decreased in the hypothalamus of high-fat fed obese rats compared with standard chow rats, and no significant elevation in POMC expression was observed when intracerebroventricular leptin was administered to high-fat fed obese rats, whereas leptin increased hypothalamic POMC expression in standard chow rats. However, hypothalamic POMC expression was elevated by leptin treatment in the metformin-treated high-fat fed obese rats, which provided further evidence of a correction of leptin resistance in the hypothalamus. Expressions of neuropeptide Y and agoutirelated protein in the hypothalamus were not changed significantly among the experimental groups (data not shown). Hypothalamic pampk level was decreased by leptin treatment but not by metformin treatment in standard chow rats. However, a lower dose of leptin was required to decrease the hypothalamic pampk level in metformin-treated rats than in untreated rats. High-fat feeding did not affect pampk level in the hypothalamus 718 DIABETES, VOL. 55, MARCH 2006

4 Y.-W. KIM AND ASSOCIATES with untreated rats. Moreover, the anorexic effect of leptin was maintained until 24 h in metformin-treated rats, whereas its anorexic effect was blunted from 6 h after leptin injection in untreated rats. We measured the pstat3 level in the hypothalamus 1 h after intracerebroventricular leptin injection (0, 0.1, or 1 g) to analyze leptin signaling. It was found that the pstat3 level after injection of 0 or 0.1 g leptin increased more in treated rats than in untreated rats. However, the maximal pstat3 level (at 1 g leptin) was no different in metformin-treated and untreated rats (Fig. 6). The effects of metformin in OLETF and LETO rats. Metformin administered for 3 weeks decreased the mean cumulative caloric intake, body weight, and visceral fat mass by 46.9, 19.4, and 41.4%, respectively, in OLETF rats. These represent augmented responses to metformin compared with similar responses observed in LETO rats, in which the mean cumulative caloric intake, body weight, and visceral fat mass were reduced by 24.5, 12.5, and 29.4%, respectively, versus untreated LETO rats. Metformin treatment decreased serum leptin concentrations in both OLETF and LETO rats compared with their untreated counterparts ( vs , P 0.01; and vs ng/ml, P 0.01; respectively). Moreover, serum leptin levels in metformin-treated OLETF and LETO rats showed positive correlations with percentage reductions in food intake (Fig. 7). FIG. 2. Effects of different dosages of leptin (L) on body weight (A), cumulative caloric intake (B), and retroperitoneal white adipose tissue (RT-WAT) weights (C) in metformin-treated or untreated standard chow rats. Different dosages of leptin (0, 0.6, 3, or 15 g daily) were infused for 7 days. Data are the means SE of eight rats per group., untreated/0 g leptin; f, untreated/0.6 g leptin;, untreated/15 g leptin; E, treated/0 g leptin; F, treated/0.6 g leptin;, treated/ 3 g leptin; Œ, treated/15 g leptin. *P < 0.05; **P < 0.01; ***P < BW, body weight; Lep, leptin; Veh, vehicle. (data not shown). Changes in hypothalamic pacc level, a downstream target of AMPK, revealed the same pattern as described for pampk (Fig. 5). The effects of short-term metformin treatment on the anorexic effect of leptin and leptin signaling. Metformin treatment for 2 days enhanced the anorexic effect of the intracerebroventricular leptin injection compared DISCUSSION The current study demonstrates that the anorexic and fat-losing effects of intracerebroventricular leptin are more prominent and that a lower dose of leptin is required to induce these effects in metformin-treated rats than in untreated rats. The observed dramatic decrease in the serum levels of leptin and insulin after combination therapy with metformin and leptin support our findings. Moreover, metformin corrected leptin resistance in dietinduced obese rats. It is well known that metformin has an anorexic effect (16); however, the mechanism underlying this effect is not clear. Several studies (8,9,17) have reported that the anorexic effect of metformin is attributable to an enhanced insulin effect. Although chronic intracerebroventricular infusion of insulin induces anorexia (18,19) and insulin is associated with anorexic signaling in the hypothalamus (20 22), our findings suggest that leptin is more responsible for the anorexic effect of metformin than insulin for the following reasons. First, a greater reduction in insulin concentration occurred after combined treatment with metformin and leptin than after leptin treatment alone, while appetite was suppressed more profoundly in the combined therapy group. Second, percentage reductions in food intake showed no significant correlation with serum insulin concentrations (data not shown) but were positively correlated with serum leptin levels in OLETF and LETO rats. Third, metformin treatment increased CSF leptin concentrations in both standard chow and high-fat fed obese rats compared with the untreated rats. Because defective leptin transport through the blood-brain barrier is a possible mechanism of leptin resistance (23 25), which was also shown by the current study, the increase in CSF leptin level may mediate the anorexic effect of metformin. Leptin signal transduction involves the phosphorylation of STAT3 in the hypothalamus (26,27), which is associated DIABETES, VOL. 55, MARCH

5 METFORMIN ENHANCES LEPTIN SENSITIVITY FIG. 3. Comparisons of the effects of metformin (followed by intracerebroventricular leptin infusion) in standard chow (SC) and high-fat fed obese (HFO) rats on body weight (A and D), cumulative caloric intake (B and E), and retroperitoneal white adipose tissue (RT-WAT) weights (C and F). Leptin (15 g daily) or vehicle (artificial CSF) was infused for 7 days. Data are the means SE of eight rats per group., untreated vehicle; f, untreated leptin; E, treated vehicle; F, treated leptin;, pair-fed vehicle; Œ, pair-fed leptin.*p < 0.05; **P < 0.01; ***P < Lep, leptin; Veh, vehicle. with elevated expression of POMC, an anorexigenic peptide. Moreover, impaired STAT signaling has been demonstrated in leptin-resistant aged obese rats and in db/db mice (28,29). To clarify the mechanism underlying the enhanced effect of leptin in metformin-treated rats, we measured the pstat3 level in the hypothalamus after short-term treatment with metformin and/or leptin injection. The hypothalamic pstat3 level was increased by metformin treatment alone and was increased more by leptin treatment. The phosphorylated STAT3 level was also increased by directly injecting metformin into the lateral ventricle. Consistent with this finding, the anorexic effect of intracerebroventricular leptin during 24 h was more profound in metformin-treated rats than in untreated rats. Although little information about the effect of metformin on the brain is available in the literature, we suggest that metformin s anorexic effect is mediated by the STAT3 signaling pathway. Increased pstat3 in the hypo- 720 DIABETES, VOL. 55, MARCH 2006

6 Y.-W. KIM AND ASSOCIATES FIG. 4. Concentrations of leptin in CSF (A), serum (B), and their ratios (C) in standard chow (SC) and high-fat fed obese (HFO) rats. Data are the means SE of eight rats per group. *P < 0.05 and **P < 0.01 vs. untreated standard chow rats; P < 0.05 and P < 0.01 vs. untreated high-fat fed obese rats., untreated; f, treated. thalamus by metformin may, at least in part, be attributable to the enhanced effect of leptin because we were unable to eliminate leptin from the CSF. Rouru et al. s (17) report describes the anorexic effect of metformin in Zucker rats, which do not have an intact leptin receptor, which suggests that the anorexic effect of metformin bypasses the leptin receptor. However, we observed a more remarkable anorexic effect in OLETF rats after administering the same dose (300 mg/kg daily) of metformin than was reported by Rouru et al. (17). Taken together, we believe that metformin and leptin may share a common energy balance signaling pathway. We also observed that a decrease in hypothalamic pampk level was induced by a lower dose of leptin in treated rats than in untreated rats, whereas metformin alone did not change the pampk level in the hypothalamus. Because pampk is related to the fuel-sensing mechanism in the hypothalamus, and because it is decreased by leptin in the hypothalamus (30,31), the reduced level of pampk in the hypothalamus observed in the current study FIG. 5. Expression of proopiomelanocortin (POMC) (A) and levels of pampk (B) and phosphorylated acetyl CoA carboxylase (pacc) (C) in the hypothalamus after leptin or vehicle infusion in metformin-treated or untreated standard chow (SC) and high-fat fed obese (HFO) rats. Representative blots are shown in each panel. Data are the means SE of eight rats per group. *P < 0.05 vs. their vehicle groups. Lep, leptin; Veh, vehicle. DIABETES, VOL. 55, MARCH

7 METFORMIN ENHANCES LEPTIN SENSITIVITY FIG. 6. Cumulative food intake during 24 h after intracerebroventricular (i.c.v) injection of leptin (5 g) in unrestrained rats (A) and pstat3 level in the hypothalamus 1 h after leptin injection (B). Data are the means SE of five rats per group. *P < 0.05 and **P < 0.01 vs. their untreated vehicle; P < 0.01 vs. treated vehicle. Met, metformin; SC and s.c., subcutaneous. might be associated with enhanced leptin sensitivity. Moreover, metformin increased hypothalamic POMC expression by leptin treatment in high-fat fed obese rats, whereas this was not observed in untreated high-fat fed obese rats. Because the effect of leptin is associated with the activation of POMC (32), failure to activate POMC expression by leptin is evidence of leptin resistance, as was shown by untreated high-fat fed obese rats in the current study. Moreover, recovery of the POMC activating effect of leptin suggests the correction of leptin resistance. In high-fat fed obese rats, metformin treatment reduced body weight and food intake more prominently than in standard chow rats. Moreover, although metformin treatment alone did not normalize visceral fat or serum leptin concentration completely in high-fat fed obese rats, a combination of metformin and intracerebroventricular leptin infusion did normalize these parameters. The elevated serum CRF level, a hypothalamic hormone involved in feeding regulation (33), was decreased by metformin alone in high-fat fed obese rats, and this was further decreased by metformin and leptin combination therapy, suggesting that the metformin/leptin combination could be useful in the treatment of obesity. We added the pair-fed group to this study to eliminate food restriction effects induced by metformin treatment. The anorexic and visceral fat shedding effects of leptin were slightly enhanced in pair-fed high-fat fed obese rats, which is consistent with other reports (34,35). However, this degree of enhancement did not reach that of metformin-treated high-fat fed obese rats. Moreover, a dramatic decrease in biochemical parameters was observed in metformin-treated high-fat fed obese rats but not in pair-fed rats. In summary, the anorexic effect of metformin appears to be related to the action of leptin. Moreover, metformin was found to enhance the anorexic and fat-losing effects of leptin in standard chow rats and to restore leptin sensitivity in high-fat fed obese rats with leptin resistance. Our findings indicate that metformin and leptin combination therapy could be useful for the treatment of obesity. 722 DIABETES, VOL. 55, MARCH 2006

8 Y.-W. KIM AND ASSOCIATES FIG. 7. Effects of metformin treatment (300 mg/kg daily) for 3 weeks on body weight (BW) (A), daily food intake (B), and retroperitoneal white adipose tissue weights (C) in OLETF and LETO rats. A significant correlation was found between serum leptin concentrations and percentage reductions in food intake (D). Data are the means SE of 7 8 rats per group. *P < 0.05 and **P < 0.01 vs. their untreated rats. ACKNOWLEDGMENTS This work was supported by the Korean Research Foundation Grant funded by the Korean Government (R ) and the Korea Science and Engineering Foundation (KOSEF; R ). REFERENCES 1. Halaas JL, Booze C, Blair-West J, Fidahusein N, Denton DA, Friedman JM: Physiological response to long term peripheral and central leptin infusion in lean and obese mice. Proc Natl Acad Sci 94: , Widdowson PS, Upton R, Buckingham R, Arch J, Williams G: Inhibition of food response to intracerebroventricular injection of leptin is attenuated in rats with diet-induced obesity. Diabetes 46: , Shek EW, Scarpace PJ: Resistance to the anorexic and thermogenic effects of centrally administrated leptin in obese aged rats. Regul Pept 92:65 71, Hundal HG, Ramlal T, Reyes R, Leiter LA: Cellular mechanism of metformin action involves glucose transporter translocation from an intracellular pool to the plasma membrane in L6 muscle cells. Endocrinology 131: , Klip A, Guma A, Ramlal T, Bilan PJ, Lam L, Leiter LA: Stimulation of hexose transport by metformin in L6 muscle cells in culture. Endocrinology 130: , Nestler JE, Jakubowicz DJ, Evans WS, Pasquali R: Effects of metformin on spontaneous and clomiphine-induced ovulation in the polycystic ovary syndrome. N Engl J Med 338: , Wiernsperger NF, Bailey CJ: The antihyperglycemic effect of metformin: therapeutic and cellular mechanisms. Drugs 58:31 39, Paolisso G, Amato L, Eccellente R, Gambardella A, Tagliamonte MR, Varricchio G, Carella C, Giugliano D, D Onofrio F: Effect of metformin on food intake in obese subjects. Eur J Clin Invest 28: , Kay JP, Alemzadeh R, Langley G, D Angelo L, Smith P, Holshouser S: Beneficial effects of metformin in normoglycemic morbidly obese adolescents. Metabolism 50: , Glueck CJ, Fontaine RN, Wang P, Subbiah MTR, Weber K, Illig E, Streicher P, Sieve-Smith L, Tracy T, Kang JE, McCullough P: Metformin reduces weight, centropedal obesity, insulin, leptin, and low-density lipoprotein cholesterol in nondiabetic, morbidly obese subjects with body mass index greater than 30. Metabolism 5097: , Fruehwald-Schultes B, Oltmanns KM, Toschek B, Sopke S, Kern W, Born KJ, Fehm HL, Peters A: Short-term treatment with metformin decreases DIABETES, VOL. 55, MARCH

9 METFORMIN ENHANCES LEPTIN SENSITIVITY serum leptin concentration without affecting body weight and body fat content in normal-weight healthy men. Metabolism 51: , Zhou G, Myers R, Li Y, Chen Y, Shen X, Fenyk-Melody J, Wu M, Ventre J, Doebber T, Fujii N, Musi N, Hirshman MF, Goodyear LJ, Moller DE: Role of AMP-activated kinase in mechanism of metformin action. J Clin Invest 108: , Hawley SA, Gadalla AE, Olsen GS, Hardie DG: The antidiabetic drug metformin activates the AMP-activated protein kinase cascade via an adenine nucleotide-independent mechanism. Diabetes 51: , Minokoshi Y, Kim YB, Peroni OD, Fryer LG, Muller C, Carling D, Kahn BB: Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415: , Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium-thiocyanate-phenolchloroform extraction. Anal Biochem 162: , Komori T, Yoshida F, Nakamura J, Miyazaki S, Miura H, Iguchi A: Metformin ameliorates treatment of obese type 2 diabetic patients with mental retardation; its effect on eating behavior and serum leptin levels. Exp Clin Endocrinol Diabetes 112: , Rouru J, Pesonen U, Koulu M, Huupponen R, Santti E, Virtanen K, Rouvari T, Jhanwar-Uniyal M: Anorexic effect of metformin in obese Zucker rats: lack of evidence for the involvement of neuropeptide Y. Eur J Pharmacol 273:99 106, Brief DJ, Davis JD: Reduction of food intake and body weight by chronic intraventricular insulin infusion. Brain Res Bull 12: , Ikeda H, West DB, Pustek JJ: Intraventricular insulin reduces food intake and body weight of lean but not obese Zucker rats. Appetite 7: , Kaiyala KJ, Woods SC, Schwartz MW: New model for the regulation of energy balance and adiposity by the central nervous system. Am J Clin Nutr 62 (5 Suppl.):1123S 1134S, Niswender KD, Morrison CD, Clegg DJ, Olson R, Baskin DG, Myers MG, Seeley RJ, Schwartz MW: Insulin activation of phosphatidyl 3-kinase in the hypothalamic arcuate nucleus: a key mediator of insulin-induced anorexia. Diabetes 52: , Niswender KD, Schwartz MW: Insulin and leptin revisited: adiposity signals with overlapping physiological and intracellular signaling capabilities. Front Neuroendocrinol 24:1 10, Caro JF, Kolaczynski JW, Nyce MR, Ohannesian JP, Opentanova I, Goldman WH, Lynn RB, Zhang PL, Sinha MK, Considine RV: Decreased cerebrospinal-fluid/serum leptin ratio in obesity, a possible mechanism for leptin resistance. Lancet 348: , Couce ME, Green D, Brunetto A, Achim C, Lloyd RV, Burguera B: Limited brain access for leptin in obesity. Pituitary 4: , Nam SY, Kratzsch J, Kim KW, Kim KR, Lim SK, Marcus C: Cerebrospinal fluid and plasma concentrations of leptin, NPY, and alpha-msh in obese women and their relationship to negative energy balance. J Clin Endocrinol Metab 86: , Vaisse C, Halaas JL, Horvath CM, Darnell JE, Stoffel M, Friedman JM: Leptin activation of Stat3 in the hypothalamus of wild-type and ob/ob mice but not db/db mice. Nat Genet 14:95 97, McCowen K, Chow J, Smith RJ: Leptin signaling in the hypothalamus of normal rats in vivo. Endocrinology 139: , Ghilardi N, Ziegler S, Wiestner A, Stoffel A, Heim MH, Skoda RC: Defective STAT signaling by the leptin receptor in diabetic mice. Proc Natl Acad Sci USA93: , Scarpace PJ, Matheny M, Tumer N: Hypothalamic leptin resistance is associated with impaired leptin signal transduction in aged obese rats. Neuroscience 104: , Andersson U, Filipsson K, Abbott CR, Woods A, Smith K, Bloom SR, Carling D, Small CJ: AMP-activated protein kinase plays a role in the control of food intake. J Biol Chem 279: , Minokoshi Y, Alquier T, Furukawa N, Kim YB, Lee A, Xue B, Mu J, Foufelle F, Ferre P, Birnbaum MJ, Stuck BJ, Kahn BB: AMP-kinase regulates food intake by responding to hormonal and nutrient signals in the hypothalamus. Nature 428: , Kim YW, Choi DW, Park YH, Huh JY, Won KC, Choi KH, Park SY, Kim JY, Lee SK: Leptin-like effects of MTII are augmented in MSG-obese rats. Regul Pept 127:63 70, Masaki T, Yoshimichi G, Chiba S, Yasuda T, Noguchi H, Kakuma T, Sakata T, Yoshimatsu H: Corticotropin-releasing hormone-mediated pathway of leptin to regulate feeding, adiposity, and uncoupling protein expression in mice. Endocrinology 144: , Fernandez-Galaz C, Fernandez-Agullo T, Perez C, Peralta S, Arribas C, Andres A, Carrascosa JM, Ros M: Long-term food restriction prevents ageing-associated central leptin resistance in Wistar rats. Diabetologia 45: , Levin BE, Dunn-Meynell AA: Reduced central leptin sensitivity in rats with diet-induced obesity. Am J Physiol Regul Integr Comp Physiol 283:R941 R948, DIABETES, VOL. 55, MARCH 2006