Angiotensin-(1-7) Prevents Cardiomyocyte Pathological Remodeling Through a Nitric Oxide/Guanosine 3,5 -Cyclic Monophosphate Dependent Pathway

Transcription

1 Angiotensin-(1-7) Prevents Cardiomyocyte Pathological Remodeling Through a Nitric Oxide/Guanosine 3,5 -Cyclic Monophosphate Dependent Pathway Enéas R.M. Gomes, Aline A. Lara, Pedro W.M. Almeida, Diogo Guimarães, Rodrigo R. Resende, Maria J. Campagnole-Santos, Michael Bader, Robson A.S. Santos, Silvia Guatimosim Downloaded from by guest on May 7, 2018 Abstract The renin-angiotensin (Ang) system plays a pivotal role in the pathogenesis of cardiovascular disease, with Ang II being the major effector of this system. Multiple lines of evidence have shown that exerts cardioprotective effects in the heart by counterregulating actions. The questions that remain are how and where exerts its effects. By using a combination of molecular biology, confocal microscopy, and a transgenic rat model with increased levels of circulating (R[A1-7]3292), we evaluated the signaling pathways involved in cardioprotection against induced pathological remodeling in ventricular cardiomyocytes. Rats were infused with for 2 weeks. We found that ventricular myocytes from R(A1-7)3292 rats are protected from pathological remodeling characterized by Ca 2 signaling dysfunction, hypertrophic fetal gene expression, glycogen synthase kinase 3 inactivation, and nuclear factor of activated T-cells nuclear accumulation. Moreover, cardiomyocytes from R(A1-7)3292 rats infused with presented increased expression levels of neuronal NO synthase. To provide a signaling pathway involved in the beneficial effects of, we treated neonatal cardiomyocytes with and for 36 hours. Treatment of cardiomyocytes with prevented induced hypertrophy by modulating calcineurin/nuclear factor of activated T-cell signaling cascade. Importantly, antihypertrophic effects of on treated cardiomyocytes were prevented by N G -nitro-l-arginine methyl ester and 1H- 1,2,4oxadiazolo4,2-aquinoxalin-1-one, suggesting that these effects are mediated by NO/cGMP. Taken together, these data reveal a key role for NO/cGMP as a mediator of beneficial effects in cardiac cells. (Hypertension. 2010; 55: ) Key Words: cardiomyocytes NO cgmp Ca 2 transient The renin-angiotensin (Ang) system plays a pivotal role in the pathogenesis of cardiovascular diseases. In this context, strategies directed to inhibit the Ang-converting enzyme or to block the corresponding receptors are used extensively in clinical practice, highlighting the importance of as the major effector of this system. 1 Of particular importance is the heptapeptide that has shown a key role in the regulation of the cardiovascular system 2 and as an oppositor of actions in the heart. Briefly, decreased the incidence and duration of ischemia-reperfusion arrhythmias, 3 improved the postischemic contractile function in isolated perfused rat hearts, and prevented induced cardiac remodeling. 4 Recently, Mercure et al 5 reported that a transgenic mice model with targeted overproduction of in the heart was protected from induced cardiac remodeling, corroborating the hypothesis that is an important modulator of heart function. Overall, these findings highlight the role of as a regulator of cardiac function; however, the specific signaling pathways underlying these beneficial effects in ventricular cardiomyocytes have not been investigated. Previously, we have demonstrated that /Mas axis activates a phosphatidylinositol 3 -kinase-protein kinase B (Akt) pathway leading to endothelial NO synthase (enos) activation and NO generation in ventricular cardiomyocytes, 6 demonstrating that actions occur directly in ventricular cells. In this study, our first goal was to investigate whether antipathological remodeling in the heart was mirrored by changes in ventricular cardiomyocytes by using a transgenic rat with increased circulating levels, R(A1-7) (), chronically infused with Ang II. Next we sought to determine the signaling pathway involved in antiremodeling effects in the cardiomyocytes. Here we showed that cardioprotective Received September 21, 2009; first decision October 9, 2009; revision accepted November 6, From the Department of Physiology and Biophysics (E.R.M.G., A.A.L., P.W.M.A., D.G., M.J.C.-S., R.A.S.S., S.G.), Federal University of Minas Gerais, Belo Horizonte, Brazil; Institute of Learning and Research Santa Casa of Belo Horizonte (R.R.R.), Belo Horizonte, Brazil; Max-Delbrück Center for Molecular Medicine (M.B.), Berlin, Germany. Correspondence to Silvia Guatimosim, Institute of Biological Sciences, Federal University of Minas Gerais, Av Antônio Carlos 6627, Belo Horizonte, MG-CEP: Brazil. guatimosim@icb.ufmg.br 2009 American Heart Association, Inc. Hypertension is available at DOI: /HYPERTENSIONAHA

2 154 Hypertension January 2010 Downloaded from by guest on May 7, 2018 A Systolic blood pressure (mmhg) C Relative mrna levels (a.u.) n=6 0.4 n= week 0 week 1 week 2 ANF BNP effects in the heart were paralleled by changes in ventricular cardiomyocytes that involved alteration of hypertrophic signaling pathways and Ca 2 handling. Moreover, we show evidence that cardioprotective effects against Ang II are mediated by an NO/cGMP signaling pathway. Methods -MHC Animals Neonatal cardiomyocytes isolated from 4- to 5-day old male Sprague-Dawley () rats were used in this study. We also used 19 male and 21 male transgenic rats that overexpress in plasma, and were obtained from the transgenic animal facilities of the Federal University of Minas Gerais Laboratory of Hypertension. Three- to 4-month old and rats were used in this study. All of the experimental protocols conform to the National Institutes of Health Guide for the Care and Use of Laboratory Animals and were approved by our institution. Phenotypic data about this transgenic rats were already published. 7 Primary Culture of Cardiomyocytes Neonatal cardiomyocytes were isolated from hearts of 4- to 5-day old rats, as described previously. 8 Cells were treated with peptides or pharmacological inhibitors for 36 hours, then the cells were fixed with paraformaldehyde 4%, and immunofluorescence experiments were performed. Freshly Isolated Ventricular Cardiomyocytes and Ca 2 Recording Adult ventricular myocytes were freshly isolated and stored in DMEM (Sigma) until they were used (within 6 hours), as described previously. 9 Intracellular Ca 2 ([Ca 2 ] i ) imaging experiments were performed in Fluo-4/AM loaded-cardiomyocytes. 10 Images were obtained using the Zeiss Meta Confocal Microscope (Zeiss Germany) from Cemel (Biological Sciences Institute, Federal University of Minas Gerais). Statistical Analysis Data are presented as mean SEM. Sample comparisons were performed using Student t test, 1-way or 2-way ANOVA, as B Heart weight/tibia length ratio (g/cm) D Peak Ca (F/F ) n=76 n=88 n=7 n=8 n=83 n=80 Figure 1. rats are protected against induced cardiac remodeling. A, Blood pressure recordings from and control rats. Rats were either sham operated or implanted with Ang-II infusing osmotic minipumps for 2 weeks. A significant increase in blood pressure was observed in rats infused with. n data from 4 rats per group. B, rats showed a significant hypertrophic response on stimulation, whereas rats were largely resistant against cardiac hypertrophy response. n number of hearts. C, Lack of hypertrophic fetal gene program upregulation in rats on stimulation. ANF indicates atrial natriuretic factor; BNP, B-type natriuretic peptide; -MHC, -myosin heavy chain. mrna levels were measured by real-time PCR. n data from 5 independent experiments. D, Significant reduction in peak Ca 2 transient amplitude is observed in ventricular cardiomyocytes from rats infused with. n number of cells analyzed. P 0.05 when compared with other groups. appropriate. In all of the statistical tests, P 0.05 was used as a measure of statistical significance. For an expanded Methods section, please see the online Data Supplement at Results Ventricular Cardiomyocytes From Rats Are Protected From Induced Cardiac Remodeling To investigate whether rats with increased plasma levels are protected from induced cardiac remodeling, we chronically infused controls and rats with (6 g/kg per day) for 2 weeks. As expected, infusion led to a significant increase in systolic blood pressure in rats (Figure 1A); however, this increase in blood pressure was blunted in rats infused with. Cardiac hypertrophy was evident in rats infused with, in contrast with rats that presented no cardiac hypertrophy, as shown in Figure 1B. To investigate whether protective effects were paralleled by molecular changes in ventricular cardiomyocytes, we performed experiments in freshly isolated ventricular cells. In agreement with the data showing cardiac hypertrophy in infused rats, measurements of cardiomyocyte area indicated that ventricular myocytes from rats undergo hypertrophy in response to infusion (Figure S1, available in the online Data Supplement at In contrast, cardiomyocytes from rats were protected from hypertrophic effects. Moreover, transcripts encoding atrial natriuretic factor, B-type natriuretic peptide, and -myosin heavy chain were upregulated in ventricular myocytes from infused rats. induced changes in cardiac fetal genes were not observed in rats (Figure 1C). Because Ang II has been shown to cause a significant increase in F-, 11 we also assessed F- mrna levels in cardiomyocyte samples. F- levels were similar in cardiomyocytes from

3 Gomes et al Protective Signaling in Cardiomyocytes 155 A II Ang II Ang B II Ang II Ang Downloaded from by guest on May 7, 2018 NFAT Histone 3 Density (a.u.) NFAT/Histone 3 C Density (a.u.) enos/gapdh enos GAPDH n=5 n=5 n=6 n=4 Ang n=4 II n=3 n=5 p-gsk3 GSK3 1.6 all of the groups, except in cells from rats treated with that showed a significant increase in F- transcripts (Figure S2). Changes in [Ca 2 ] i are a major feature in heart failure and myocyte pathology. To investigate whether cardioprotective effects were related to changes in Ca 2 handling in ventricular cells, we examined [Ca 2 ] i in Fluo-4 loaded cardiomyocytes. Ventricular cardiomyocytes from - rats presented a significantly reduced peak Ca 2 transient. The amplitude of the [Ca 2 ] i transient was reduced by 26% in - cardiomyocytes when compared with cells (Figure 1D), in contrast to cells from infused rats that showed preserved Ca 2 responses. The calcineurin/nuclear factor of activated T cells (NFAT) signaling pathway in particular is considered an important contributor to maladaptative remodeling A major pathway regulated by calcineurin is that involving the transcription factor NFAT, which, on dephosphorylation, translocates to the nucleus and eventually results in the transcription of a number of hypertrophic genes leading to cardiac hypertrophy. 15 To directly address whether blunts pathological remodeling by modulating calcineurin- NFAT signaling in cardiac cells, we investigated NFAT localization in cytoplasmic and nuclear fractions of ventricular cardiomyocytes by Western blotting. The results showed that treatment of rats caused accumulation of NFAT in the nuclear fraction of ventricular cardiomyocytes (Figure 2A). This feature was not observed in ventricular II Ang n=3 Density (a.u.) D Density (a.u.) p-gsk3 / GSK3 nnos/gapdh nnos GAPDH n=5 n=5 n=6 n=8 Ang n=10 II # n=6 n=5 II Ang # n=9 Figure 2. Cardioprotective signaling by in ventricular cardiomyocytes. A through D, Top, Representative Western blot. Bottom, Averaged-densitometry. Histone-3 or GAPDH expression levels were used as loading controls. A, Significant increase in nuclear NFAT was found in ventricular cardiomyocytes from rats infused with. prevented induced NFAT nuclear accumulation in rats. B, Increased GSK3 phosphorylation levels were observed in the nuclear fraction of cardiomyocytes from treated rats. C, enos protein levels were unaltered in cardiomyocytes from and rats treated or not with. D, nnos levels were significantly increased in ventricular cardiomyocytes from rats treated or not with, when compared with rats. n indicates the number of cardiomyocyte homogenates. P 0.05 when compared with other groups. #P 0.05 when compared with group treated or not with. cells from infused rats, confirming the ability of to suppress hypertrophic activation in these cells. Similar levels of NFAT were found in the nuclear fraction of ventricular cardiomyocytes from and rats (Figure 2A). The activity of the Ca 2 -calcineurin-nfat signaling pathway in cardiac myocytes is tightly controlled at multiple levels, and inhibitory mechanisms upstream and downstream from calcineurin have been described. 16 Glycogen synthase kinase 3 (GSK3 ), in particular, is considered a potent inhibitor of this pathway downstream of calcineurin. In the nucleus, GSK3 phosphorylates conserved serines in the N-terminal regulatory region of NFAT proteins, thereby promoting their nuclear export. 17 Moreover, GSK3 has been shown to regulate hypertrophy development by restraining gene expression. To gain further insight into the mechanism by which protects ventricular cardiomyocytes from induced remodeling, we next assessed GSK3 expression levels in nuclear fractions. Chronic infusion of Ang II induced a significant increase in GSK3 phosphorylation levels, leading to enzyme inactivation (Figure 2B). This effect was not observed in cardiomyocytes from rats treated with. Given the potential protective effect triggered by enos activation in cardiac cells 18 and our previous finding that enos is a downstream mediator of signaling pathway in cardiomyocytes, we hypothesized that these effects of on cardiac remodeling could be related to changes in enos. To investigate this issue, we assessed

4 156 Hypertension January 2010 A Downloaded from by guest on May 7, 2018 B CT ) 2 Cellular area ( m n=50 n=86 CT + enos expression levels in cardiomyocyte homogenates. Immunoblots revealed similar enos protein levels in cardiomyocytes from and rats infused with (Figure 2C). Other than enos, neuronal NO synthase (nnos) also leads to NO production in the heart and has been shown to participate in cardiac protection. 19,20 Figure 2D shows pronounced changes in nnos in cardiomyocytes from rats when compared with cells from rats treated or not with. Moreover, nnos expression was also higher in cardiomyocytes from infused rats. Taken together, our data show strong evidence that the protective effect in the heart is paralleled by activation of antipathological remodeling pathways in ventricular cardiomyocytes. Blunts Cellular Hypertrophy Triggered by in Neonatal Cardiomyocytes The lack of effect of on blood pressure in rats raised the question of whether cardioprotective signaling observed in these rats was the sole result of reduced mechanical overload. To make this distinction and to provide the mechanism by which exerts its cardioprotective effects in cardiac cells we treated neonatal rat cardiac myocytes (NRCMs) with and or a combination of both peptides for 36 hours. Figure 3A shows representative immunofluorescence images from -actinin stained NRCMs. Neonatal cells treated with (100 nmol/l) demonstrated an increased cell surface area of 65%, whereas treatment with alone did not significantly alter the cell surface area of NRCMs (Figure 3B). In contrast, treatment of the cells with 100 nmol/l of significantly reduced induced hypertrophy. To verify whether antihypertrophic actions occurred via receptor Mas, cells were treated with the Mas antagonist A-779 (1 mol/l). As shown in Figure 3B, A-779 reversed n=60 n=45 n=73 A A-779 Figure 3. suppresses Ang II induced hypertrophy in NRCMs. A, Representative confocal images showing -actinin stained NRCMs from control (CT) cells, treated cells (100 nmol/l), treated cells (100 nmol/l), cells treated with and (100 nmol/l), and cells treated with and (100 nmol/l) in the presence of Mas antagonist A-779 (10 mol/l) for 36 hours. Bar: 10 m. B, Averaged bar graph shows a significant increase in cell area induced by and prevention by when compared with control. Abolition of antihypertrophic effects was observed in the presence of the Mas antagonist, A-779. n indicates the number of cardiomyocytes analyzed. P 0.05 when compared with control,, and Ang-(1 7) Ang II treated cells. the antihypertrophic effects of in treated cells. Circumstantial evidence exist between mediated cardioprotective effects and NO generation. To investigate whether the effects of on cellular remodeling were related to changes in NO, we recorded NO basal levels in 4-amino-5-methylamino-2,7-dichlorofluorescein diacetate loaded NRCMs. Higher NO production was observed in NRCMs treated with for 36 hours (Figure S3). Treatment with a combination of and also led to a significant increase in NO levels; nevertheless, NO production under this condition remained lower than that observed in the presence of alone. To further establish an NO-dependent mechanism for antihypertrophic effects, NRCMs were treated with an NO synthase inhibitor, N G -nitro-l-arginine methyl ester (L-NAME; 1 mol/l), and cellular area was measured. Quantification of these results indicated that L-NAME blunted effects in treated neonatal cells (Figure 4A and 4B), suggesting that NO was involved in the antihypertrophic effects of in NRCMs. NO signals in cells directly or indirectly through a cgmp-dependent signaling pathway. 20 Involvement of cgmp on cardioprotective effects was investigated in cells treated with a guanylyl cyclase inhibitor, 1H-1,2,4oxadiazolo4,2-aquinoxalin-1-one (ODQ; 50 mol/l). As shown in Figure 4, ODQ blunted antihypertrophic effects. Acts via NO/cGMP to Prevent Ang II Induced NFAT Translocation in Cardiomyocytes To gain further insight into how exerts its antihypertrophic effects, we investigated the activity of calcineurin/ NFAT signaling in cardiomyocytes treated with by investigating the localization of NFAT in the cells. Figure 5A shows representative confocal images of NRCMs stained

5 Gomes et al Protective Signaling in Cardiomyocytes 157 A Downloaded from by guest on May 7, 2018 B CT Cellular area ( m ) n=50 n=60 + n=45 CT + L-NAME L-NAME with an anti-nfat antibody. Consistent with previous findings, 21 stimulation of cardiac myocytes led to increased nuclear NFAT localization, as shown in immunofluorescence images (Figure 5A) and in a bar graph (Figure 5B). The induced NFAT translocation was completely suppressed by. treatment alone had no effect on NFAT localization in the cell. As shown in Figure 5, the addition of A-779 to the culture medium prevented effects on NFAT localization in treated cardiomyocytes. To investigate the involvement of NO and cgmp in this cardioprotective effect of, we treated the cells with L-NAME or ODQ (Figure 6A and 6B). Both L-NAME and ODQ significantly blunted effects on NFAT localization in treated cells (Figure 6A and 6B). Collectively these data show that activates an antihypertrophic signaling pathway mediated by NO/cGMP signaling to counterregulate effects in cardiac cells. Discussion Multiple lines of evidence have shown that exerts cardioprotective effects in the heart. The question that remains is where and how exerts its effects. Here we show that can act directly on cardiomyocytes to suppress maladaptative cardiac remodeling induced by by activating an NO/cGMP signaling pathway. More specifically, blunted effects by inhibiting the calcineurin/nfat signaling cascade. Cardioprotective Signaling by in Ventricular Myocytes Grobe et al 4 have shown that infusion protected the heart from deleterious effects, such as hypertrophy and fibrosis. In line with these findings, a recent study 5 reported that chronic overproduction of in the heart of mice reduced induced cardiac remodeling through a n=17 n=18 ODQ + ODQ Figure 4. Inhibition of NO/cGMP production prevents effects on cellular hypertrophy. A, Representative confocal images showing -actinin stained NRCMs. Bar: 10 m. B, Averaged-bar graph showing an increase in cellular area. Antihypertrophic effects of on treated cells are prevented by L-NAME (1 mol/l), and ODQ (50 mol/ L). n indicates the number of cardiomyocytes analyzed. P 0.05 when compared with control and treated cells. direct effect on the heart. These observations are further supported by our finding that rats are protected from Ang II induced maladaptative remodeling. To extend these findings, we have identified an array of molecular features that occur in ventricular cardiomyocytes from infused rats that parallel the protective effects of in the heart. First, we found that ventricular cardiomyocytes from rats were protected from Ca 2 signaling dysfunction induced by. These data, in particular, contrast to our previous findings showing that acute treatment failed to alter Ca 2 -transient parameters in ventricular myocytes, 6 suggesting that effects on Ca 2 handling observed in cardiomyocytes from rats infused with result from indirect changes in other signaling pathways. Moreover, we found that increased levels reduced NFAT accumulation in the nucleus and prevented GSK3 inactivation induced by. In cardiomyocytes, NFAT is a potent regulator of prohypertrophic gene transcription, 22 and activation of this signaling pathway plays a pivotal role in the development of cardiac hypertrophy induced by various causes. Although we cannot attribute antiremodeling effects in ventricular cardiomyocytes of rats only to calcineurin/nfat signaling suppression, once activates a complex series of signaling cascades, the role of the calcineurin/nfat signaling pathway in the induced maladaptative stress is well documented. Indeed, NFATc3- null mice demonstrated attenuated induced cardiac hypertrophy, suggesting an important contribution of this signaling pathway to effects. 23 On the other hand, catalytically active GSK3 restrains gene expression and prevents hypertrophic growth of cardiac myocytes by inhibition of transcriptional regulators, including NFAT. 24 The ability of to prevent GSK3 phosphorylation by may represent another mechanism by which exerts its cardioprotective effects.

6 158 Hypertension January 2010 A CT A CT Downloaded from by guest on May 7, A-779 B NFAT localization (% of cells) NFAT DAPI Merged CT cytosol nucleus A-779 Figure 5. Regulation of NFAT subcellular localization by Ang- (1-7) in NRCMs. A, Representative images of neonatal cardiomyocytes stained with anti-nfat (green) are displayed. The nucleus was stained with 4,6-diamidino-2-phenylindole (blue), and the merged image is presented on the right. B, Averaged bar graph. In treated NRCMs, we observed increased nuclear NFAT accumulation. prevented induced NFAT translocation to the nucleus. suppression of NFAT translocation was blunted in the presence of the Mas antagonist, A-779. Each group represents data from 60 cells. How Does Regulate the Calcineurin/NFAT Cascade? Several studies have shown that cgmp-dependent protein kinase (PKG) signaling suppresses calcium-calcineurin- NFAT activation at multiple levels. 16,22 In cardiomyocytes, Ca 2 activation of calcineurin results in the dephosphorylation of cytoplasmic NFAT promoting its translocation into the nucleus resulting in expression of a hypertrophic gene program. It has been proposed that inhibitory effects of the NO-cGMP-PKG pathway upstream from calcineurin are + + L-NAME + ODQ B NFAT localization (% of cells) NFAT DAPI Merged CT L-NAME cytosol nucleus ODQ Figure 6. effects on NFAT localization are mediated by NO/cGMP. A, Representative confocal images are displayed. Bar: 10 m. B, Averaged bar graph shows that induces NFAT translocation from cytosol to the nucleus when compared with control, and its effect is prevented by. The Ang- (1-7) effect on NFAT localization was blunted by L-NAME and ODQ. Each group represents data from 75 cells. mediated by inhibition of the L-type Ca 2 channel, because PKG has shown to modulate this channel. Hsu et al 25 have shown recently that mice deficient in the calcineurin catalytic subunit A develop less hypertrophy in response to pressure overload than their wild-type counterparts, and this hypertrophy is inhibited by enhancing PKG activity via PDE5A inhibitors. These data show important evidence that antihypertrophic effects of PKG signaling are mediated by mechanisms other than calcineurin/nfat inhibition. Here we have shown that antiremodeling effects are mediated, at least in part, through cgmp production. Because PKG has been identified as a prime downstream target mediating the antihypertrophic effects of NO and cgmp, 16 it is reasonable to speculate that leads to

7 Gomes et al Protective Signaling in Cardiomyocytes 159 Downloaded from by guest on May 7, 2018 PKG activation and consequent modulation of calcineurin/ NFAT signaling in cardiomyocytes. Additional experiments are necessary to elucidate the exact role of derived cgmp in protecting against calcineurin/nfat cascade activation. How Do and Signaling Pathways Cross-Talk in Cardiac Cells? Although our results support a major role for the NO/cGMP pathway in the antihypertrophic effects of against cellular maladaptative remodeling, where exactly these 2 signaling pathways cross-talk is still unknown. Our hypothesis is that this cross-talk occurs at multiple points. acts via type 1 receptors through 2 major signal transduction pathways; one is associated with G 12/13 and the other with G q. 12 Recently, Takimoto et al 26 have shown a critical role for regulator of G-protein signaling 2 as a brake against the G q /phospholipase C pathway in the early cardiac stress response to pressure overload. Regulator of G-protein signaling 2 activation is mediated by cgmp, suggesting a possible mechanism by which via cgmp antagonizes actions in cardiac cells. Besides calcineurin/nfat signaling, it still remains to be determined whether antagonizes other Gq-linked pathways, such as calmodulin-dependent kinase II (CaMKII) and extracellular signal regulated kinase 1/2, in ventricular cells. induced oxidation leads to CaMKII activation and subsequent apoptosis in cardiomyocytes. 27 In cardiac cells, CaMKII is involved in coupling excitation and contraction through the regulation of a variety of Ca 2 handling proteins. Moreover, constitutively active CaMKII is elevated in a number of pathological conditions of the heart, 28 and it is an important downstream mediator of effects. 29 Tallant et al 30 reported that significantly reduced serum-stimulated extracellular signal regulated kinase 1/2 mitogen-activated protein kinase activity in cardiomyocytes. In contrast, another study did not observe an inhibitory effect of on extracellular signal regulated kinase 1/2 activation in response to by using mice with chronic overproduction of in the heart. 5 The reason for these differences is not clear and awaits clarification. Origin of NO in Cardiac Cells Under Stimulus On the basis of the present findings, the mechanism of antipathological remodeling involves NO generation in vitro. Because formation of reactive oxygen species in combination with a low NO bioavailability predisposes for cardiac damage, it is reasonable to speculate that NO plays a role in modulation of pathological remodeling and hypertrophy in vivo. We have previously identified enos as a downstream mediator of signaling pathway in ventricular cells. 6 Intriguingly, we have not detected changes in enos expression levels in cardiomyocytes from rats. In fact, this lack of change is in line with our previous findings showing no significant change in enos levels in ventricular myocytes from Mas / mice. 6 Whether enos activity is altered in vivo and its contribution as a source of derived NO remain to be clarified. Other than enos, nnos has also been linked to an antihypertrophic response in the heart. 31,32 Interestingly, we observed marked upregulation of nnos in cells from rats infused with Ang II. In keeping with this finding, unpublished data from our laboratory showed reduced nnos expression in Mas / cardiomyocytes (M.F. Dias-Peixoto, R.A.S.S., and S.G., unpublished data, 2009), suggesting an important association between the /Mas axis and nnos signaling in ventricular cardiomyocytes. A previous study has shown that nnos overexpression within cardiomyocytes correlates with enhanced cardiac contractility by modulating Ca 2 cycling in the cell. 33 Moreover, Casadei 34 suggested that nnos-derived NO may delay the development of heart failure after myocardial infarction. Increased nnos-derived NO was also found in the failing human heart. 19 Therefore, it remains to be elucidated whether nnos-derived NO contributes significantly to the cardioprotective effects of in vivo. Perspectives has been reported to have a pivotal role in the regulation of the cardiovascular system by counterregulating actions. We now report that can act directly on cardiomyocytes to suppress induced maladaptative remodeling by activating an NO/cGMP signaling pathway. More specifically, exerts its effects by inhibiting the prohypertrophic calcineurin/nfat signaling cascade. Although calcineurin/nfat signaling plays an important role in induced maladaptative stress, is known to activate a complex series of signaling cascades, suggesting that the cross-talk between these 2 peptides occurs at multiple levels. It still remains to be determined how these 2 peptides interact at the cellular level and the implications of this molecular cross-talk for cardiac disease development. Sources of Funding This work was supported by grants from Deutscher Akademischer Austauschdienst (PROBRAL program of DAAD/CAPES), Conselho Nacional de Desenvolvimento Científico e Tecnológico (to S.G. and R.A.S.S.), and Fundação de Amparo à Pesquisa do Estado de Minas Gerais (to S.G.). E.R.M.G. is a recipient of the Conselho Nacional de Desenvolvimento Científico e Tecnológico PhD fellowship at the Postgraduation Program in Biological Science: Physiology and Pharmacology at the Federal University of Minas Gerais. None. Disclosures References 1. Ferrario CM. Role of angiotensin II in cardiovascular disease therapeutic implications of more than a century of research. J Renin Angiotensin Aldosterone Syst. 2006;7: Santos RA, Ferreira AJ, Simoes e Silva AC. Recent advances in the angiotensin-converting enzyme 2-angiotensin(1-7)-Mas axis. Exp Physiol. 2008;93: Ferreira AJ, Santos RA, Almeida AP. Angiotensin-(1-7): cardioprotective effect in myocardial ischemia/reperfusion. Hypertension. 2001;38: Grobe JL, Mecca AP, Lingis M, Shenoy V, Bolton TA, Machado JM, Speth RC, Raizada MK, Katovich MJ. Prevention of angiotensin II-induced cardiac remodeling by angiotensin-(1-7). Am J Physiol Heart Circ Physiol. 2007;292:H736 H Mercure C, Yogi A, Callera GE, Aranha AB, Bader M, Ferreira AJ, Santos RA, Walther T, Touyz RM, Reudelhuber TL. Angiotensin(1-7)

8 160 Hypertension January 2010 Downloaded from by guest on May 7, 2018 blunts hypertensive cardiac remodeling by a direct effect on the heart. Circ Res. 2008;103: Dias-Peixoto MF, Santos RA, Gomes ER, Alves MN, Almeida PW, Greco L, Rosa M, Fauler B, Bader M, Alenina N, Guatimosim S. Molecular mechanisms involved in the angiotensin-(1-7)/mas signaling pathway in cardiomyocytes. Hypertension. 2008;52: Santos RA, Ferreira AJ, Nadu AP, Braga AN, de Almeida AP, Campagnole-Santos MJ, Baltatu O, Iliescu R, Reudelhuber TL, Bader M. Expression of an angiotensin-(1-7)-producing fusion protein produces cardioprotective effects in rats. Physiol Genomics. 2004;17: Guatimosim S, Amaya MJ, Guerra MT, Aguiar CJ, Goes AM, Gomez- Viquez NL, Rodrigues MA, Gomes DA, Martins-Cruz J, Lederer WJ, Leite MF. Nuclear Ca2 regulates cardiomyocyte function. Cell Calcium. 2008;44: Guatimosim S, Sobie EA, dos Santos CJ, Martin LA, Lederer WJ. Molecular identification of a TTX-sensitive Ca(2 ) current. Am J Physiol Cell Physiol. 2001;280:C1327 C Lauton-Santos S, Guatimosim S, Castro CH, Oliveira FA, Almeida AP, Dias-Peixoto MF, Gomes MA, Pessoa P, Pesquero JL, Pesquero JB, Bader M, Cruz JS. Kinin B1 receptor participates in the control of cardiac function in mice. Life Sci. 2007;81: Schultz JJ, Witt SA, Glascock BJ, Nieman ML, Reiser PJ, Nix SL, Kimball TR, Doetschman T. F-beta1 mediates the hypertrophic cardiomyocyte growth induced by angiotensin II. J Clin Invest. 2002;109: Schluter KD, Wenzel S. Angiotensin II: a hormone involved in and contributing to pro-hypertrophic cardiac networks and target of antihypertrophic cross-talks. Pharmacol Ther. 2008;119: Finckenberg P, Inkinen K, Ahonen J, Merasto S, Louhelainen M, Vapaatalo H, Muller D, Ganten D, Luft F, Mervaala E. Angiotensin II induces connective tissue growth factor gene expression via calcineurindependent pathways. Am J Pathol. 2003;163: Frank D, Kuhn C, van EM, Gehring D, Hanselmann C, Lippl S, Will R, Katus HA, Frey N. Calsarcin-1 protects against angiotensin-ii induced cardiac hypertrophy. Circulation. 2007;116: Wilkins BJ, Dai YS, Bueno OF, Parsons SA, Xu J, Plank DM, Jones F, Kimball TR, Molkentin JD. Calcineurin/NFAT coupling participates in pathological, but not physiological, cardiac hypertrophy. Circ Res. 2004; 94: Fiedler B, Wollert KC. Interference of antihypertrophic molecules and signaling pathways with the Ca2 -calcineurin-nfat cascade in cardiac myocytes. Cardiovasc Res. 2004;63: Beals CR, Sheridan CM, Turck CW, Gardner P, Crabtree GR. Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3. Science. 1997;275: Mount PF, Kemp BE, Power DA. Regulation of endothelial and myocardial NO synthesis by multi-site enos phosphorylation. J Mol Cell Cardiol. 2007;42: Damy T, Ratajczak P, Shah AM, Camors E, Marty I, Hasenfuss G, Marotte F, Samuel JL, Heymes C. Increased neuronal nitric oxide synthase-derived NO production in the failing human heart. Lancet. 2004;363: Umar S, van der LA. Nitric oxide and nitric oxide synthase isoforms in the normal, hypertrophic, and failing heart. Mol Cell Biochem. In press. 21. Onohara N, Nishida M, Inoue R, Kobayashi H, Sumimoto H, Sato Y, Mori Y, Nagao T, Kurose H. TRPC3 and TRPC6 are essential for angiotensin II-induced cardiac hypertrophy. EMBO J. 2006;25: Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, Grant SR, Olson EN. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell. 1998;93: Wilkins BJ, De Windt LJ, Bueno OF, Braz JC, Glascock BJ, Kimball TF, Molkentin JD. Targeted disruption of NFATc3, but not NFATc4, reveals an intrinsic defect in calcineurin-mediated cardiac hypertrophic growth. Mol Cell Biol. 2002;22: Sugden PH, Fuller SJ, Weiss SC, Clerk A. Glycogen synthase kinase 3 (GSK3) in the heart: a point of integration in hypertrophic signalling and a therapeutic target? A critical analysis. Br J Pharmacol. 2008;153: S137 S Hsu S, Nagayama T, Koitabashi N, Zhang M, Zhou L, Bedja D, Gabrielson KL, Molkentin JD, Kass DA, Takimoto E. Phosphodiesterase 5 inhibition blocks pressure overload-induced cardiac hypertrophy independent of the calcineurin pathway. Cardiovasc Res. 2009;81: Takimoto E, Koitabashi N, Hsu S, Ketner EA, Zhang M, Nagayama T, Bedja D, Gabrielson KL, Blanton R, Siderovski DP, Mendelsohn ME, Kass DA. Regulator of G protein signaling 2 mediates cardiac compensation to pressure overload and antihypertrophic effects of PDE5 inhibition in mice. J Clin Invest. 2009;119: Erickson JR, Joiner ML, Guan X, Kutschke W, Yang J, Oddis CV, Bartlett RK, Lowe JS, O Donnell SE, Ykin-Burns N, Zimmerman MC, Zimmerman K, Ham AJ, Weiss RM, Spitz DR, Shea MA, Colbran RJ, Mohler PJ, Anderson ME. A dynamic pathway for calcium-independent activation of CaMKII by methionine oxidation. Cell. 2008;133: Zhang R, Khoo MS, Wu Y, Yang Y, Grueter CE, Ni G, Price EE, Thiel W, Guatimosim S, Song LS, Madu EC, Shah AN, Vishnivetskaya TA, Atkinson JB, Gurevich VV, Salama G, Lederer WJ, Colbran RJ, Anderson ME. Calmodulin kinase II inhibition protects against structural heart disease. Nat Med. 2005;11: Palomeque J, Delbridge L, Petroff MV. Angiotensin II: a regulator of cardiomyocyte function and survival. Front Biosci. 2009;14: Tallant EA, Ferrario CM, Gallagher PE. Angiotensin-(1-7) inhibits growth of cardiac myocytes through activation of the mas receptor. Am J Physiol Heart Circ Physiol. 2005;289:H1560 H Booz GW. Putting the brakes on cardiac hypertrophy: exploiting the NO-cGMP counter-regulatory system. Hypertension. 2005;45: Barouch LA, Harrison RW, Skaf MW, Rosas GO, Cappola TP, Kobeissi ZA, Hobai IA, Lemmon CA, Burnett AL, O Rourke B, Rodriguez ER, Huang PL, Lima JA, Berkowitz DE, Hare JM. Nitric oxide regulates the heart by spatial confinement of nitric oxide synthase isoforms. Nature. 2002;416: Loyer X, Gomez AM, Milliez P, Fernandez-Velasco M, Vangheluwe P, Vinet L, Charue D, Vaudin E, Zhang W, Sainte-Marie Y, Robidel E, Marty I, Mayer B, Jaisser F, Mercadier JJ, Richard S, Shah AM, Benitah JP, Samuel JL, Heymes C. Cardiomyocyte overexpression of neuronal nitric oxide synthase delays transition toward heart failure in response to pressure overload by preserving calcium cycling. Circulation. 2008;117: Casadei B. The emerging role of neuronal nitric oxide synthase in the regulation of myocardial function. Exp Physiol. 2006;91:

9 Angiotensin-(1-7) Prevents Cardiomyocyte Pathological Remodeling Through a Nitric Oxide/Guanosine 3',5'-Cyclic Monophosphate Dependent Pathway Enéas R.M. Gomes, Aline A. Lara, Pedro W.M. Almeida, Diogo Guimarães, Rodrigo R. Resende, Maria J. Campagnole-Santos, Michael Bader, Robson A.S. Santos and Silvia Guatimosim Downloaded from by guest on May 7, 2018 Hypertension. published online December 7, 2009; Hypertension is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX Copyright 2009 American Heart Association, Inc. All rights reserved. Print ISSN: X. Online ISSN: The online version of this article, along with updated information and services, is located on the World Wide Web at: Data Supplement (unedited) at: Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published in Hypertension can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for which permission is being requested is located, click Request Permissions in the middle column of the Web page under Services. Further information about this process is available in the Permissions and Rights Question and Answer document. Reprints: Information about reprints can be found online at: Subscriptions: Information about subscribing to Hypertension is online at:

10 ONLINE SUPPLEMENT ANGIOTENSIN-(1-7) PREVENTS CARDIOMYOCYTE PATHOLOGICAL REMODELING THROUGH A NO/cGMP DEPENDENT PATHWAY. Enéas R.M. Gomes 1, Aline A. Lara 1, Pedro W.M. Almeida 1, Diogo Guimarães 1, Rodrigo R Resende 2, Maria J. Campagnole-Santos 1, Michael Bader 3, Robson A.S. Santos 1, Silvia Guatimosim 1 1 Department of Physiology and Biophysics, Federal University of Minas Gerais, Belo Horizonte, MG, , Brazil 2 Institute of Learning and Research Santa Casa of BH (IEPSC BH), Belo Horizonte, Brazil 3 Max-Delbrück Center for Molecular Medicine (MDC), Robert-Rössle-Str. 10, D Berlin, Germany Short title: Protective signaling by in cardiomyocytes Address for correspondence Silvia Guatimosim Institute of Biological Sciences Federal University of Minas Gerais Av. Antônio Carlos 6627 Belo Horizonte, MG - CEP: Brazil Phone: (31) , FAX: (31) guatimosim@icb.ufmg.br 1

11 Expanded Materials and Methods infusion in rats A 14-day infusion of (6 µg/kg/h) or vehicle (0.9% NaCl, 0,5 µl/h) was performed using osmotic minipumps (ALZET, model 2002) implanted subcutaneously in the dorsal region under tribromoethanol anesthesia (2.5%, 1 ml/100 g of body wright), as previously described 1. Systolic Blood Pressure Measurement For monitoring systolic blood pressure (SBP) we performed the current tail-cuff method 2, 3. SBP was measured by the tail-cuff method using a XBP1000 Series Rat Tail Blood Pressure System (Kent Scientific, Torrington, CT). Cardiac and cardiomyocyte hypertrophy measurements To analyze the extension of cardiac hypertrophy we performed a heart weight/tibia length ratio measurement. For cardiomyocyte hypertrophy we measured cellular area in adult ventricular cardiomyocytes or in NRCM stained with anti-α-actinin antibody. Confocal images were analysed using LSM image browser software (Zeiss). DAF- measurents in neonatal cardiomyocytes Measurement of NO production in living NRCM was done using the membrane permeable fluorescent indicator DAF-FM (Molecular Probes) as previously described 4. NO measurements were performed in NRCM treated with peptides for 36 h. 2

12 Cytoplasmic/Nuclear fractionation Adult ventricular myocytes were harvested in ice-cold homogenization RIPA buffer (150 mm NaCl, 0.5% deoxycholate, 1% Triton X-100, 1: 300 Sigma protease inhibitor cocktail and 50 mm Tris-HCl at ph 7.4). The homogenate was centrifuged at 100 g for 5 min (4 C). The resulting supernatant was centrifuged again at 600 g for 5 min (4 C) to obtain the nuclear pellet and the cytoplasmic extract (supernatant). The pellet was incubated with RIPA buffer containing 0.3% S and DNAse (1 mg ml 1 ) for 30 min (4 C) and then centrifuged at 2000 g for 10 min (4 C) to obtain the nuclear extract (supernatant), as previously described 5. Purity of cytosolic and nuclear cell fractions was assessed with anti-gapdh and anti-histone 3 antibodies. GAPDH was found only in the cytosolic fraction whereas histone-3 was found only in the nuclear extract. Western blot Adult ventricular myocytes were harvested as described above and protein content was quantified according to Bradford protein assay µg of protein were separated by S-PAGE. Antibodies and their sources are as follows: anti-nfatc3 1:1000 (Santa Cruz BioTech), anti-gsk3β 1:1000 and anti-phospho (Ser 9) GsK3β 1:1000 (Cell Signaling), CaMKII 1:1000 (SAB), phospho-camkii 1:1000 (Millipore), anti-histone-3 1:1000 (Cell Signaling), and anti-gapdh 1:5000 (Clontech). Immunodetection was carried out using enhanced chemiluminescence (Amersham Biosciences). Protein levels were expressed as a ratio of optical densities. Quantitative Real time PCR 3

13 Total RNA was extracted from isolated ventricular cardiomyocytes using Trizol (Invitrogen, São Paulo, Brazil). For quantitative PCR (qpcr), total RNA was treated with DNase I (Ambion, Austin, TX, USA) and first strand cdna was synthesized using High Capacity cdna Transcription Kit (Applied Biosystems, CA, USA) according to manufacturer s instructions. After reverse transcription, the cdna was subjected to qpcr on a 7500 Real Time PCR System (Applied Biosystems, CA, USA) using Power SYBR Green PCR Master Mix (Applied Biosystems, CA, USA). Relative quantification of gene expression was done with the 2 - Ct method using the beta actin gene expression to normalize the data. Primers used were: ANF FW: 5 - GGATTTCAAGAACCCTAGA -3 and RE 5 - CTTCATCGGTCCTCGCTCA - 3 ; BNP FW 5 - CTCGGACCACCTCTCAAG -3 ND RE 5 - ACACGCAAGTTC -3 ; β-mhc FW 5 - CCTCGCAATATCAAGGGAAA -3 and RE 5 - TACAGGCATCAGCTCCAG -3. F-β FW 5 - GAAGCCATCCGGCCAGAT-3 and RE 5 - CCAGACGTCAAAAGACAG-3. Immunofluorescence Cardiomyocytes were fixed in PFA 4% and permeabilized with Triton X %. Antibodies and their sources were as follow: anti-nfatc3 (Santa Cruz BioTech), anti-α-actinin (Sigma). Anti-rabbit and anti-mouse antibodies conjugated to Alexa-488 and Alexa-633 (Molecular Probes) were used at a dilution of 1:1000, nuclear staining was performed with 4,6-Diamidino-2-Phenylindole (DAPI) 1:50, as previously described 7. 4

14 Reagents The peptides angiotensin-(1-7), A-779, and angiotensin II were from Bachem. Unless specified, other reagents were obtained from Sigma Chemical Corp. 5

15 References 1. da Silva LM, Nardoni Goncalves BA, Roberto da SJ, ugusto Souza Dos SR. Altered cardiovascular responses to chronic angiotensin II infusion in aged rats. Regul Pept. 2005;132: Krege JH, Hodgin JB, Hagaman JR, Smithies O. A noninvasive computerized tailcuff system for measuring blood pressure in mice. Hypertension. 1995;25: Whitesall SE, Hoff JB, Vollmer AP, D'Alecy LG. Comparison of simultaneous measurement of mouse systolic arterial blood pressure by radiotelemetry and tail-cuff methods. Am J Physiol Heart Circ Physiol. 2004;286:H2408-H Dias-Peixoto MF, Santos RA, Gomes ER, Alves MN, Almeida PW, Greco L, Rosa M, Fauler B, Bader M, Alenina N, Guatimosim S. Molecular mechanisms involved in the angiotensin-(1-7)/mas signaling pathway in cardiomyocytes. Hypertension. 2008;52: Oliveira RS, Ferreira JC, Gomes ER, Paixao NA, Rolim NP, Medeiros A, Guatimosim S, Brum PC. Cardiac anti-remodelling effect of aerobic training is associated with a reduction in the calcineurin/nfat signalling pathway in heart failure mice. J Physiol. 2009;587:

16 6. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72: Guatimosim S, Amaya MJ, Guerra MT, Aguiar CJ, Goes AM, Gomez-Viquez NL, Rodrigues MA, Gomes DA, Martins-Cruz J, Lederer WJ, Leite MF. Nuclear Ca2+ regulates cardiomyocyte function. Cell Calcium. 2008;44:

17 Supplemental Figures Supplemental Figure 1: induced cardiomyocyte hypertrophy is prevented in R rats. A. Representative immunofluorescence images of cardiomyocytes stained with antiα-actinin. B. Bar graph show averaged-cardiomyocyte area for ventricular cardiomyocytes from and rats treated or not with. n= number of cardiomyocytes analysed. p< 0.05 when compared to other groups. Bar=10 µm. 8

18 Supplemental Figure 2: Overexpression of in rats prevents F-β upregulation on Ang-II stimulation. F-β mrna levels were measured by real-time PCR. n= data from at least 4 independent experiments.p< 0.05 when compared to group, #p< 0.05 when compared to group. 9

19 Supplemental Figure 3: stimulates NO release in NRCM. A. Representative confocal images showing DAF-loaded untreated control (left panel), treated with Ang- (1-7) (middle panel) or with and (right panel). Bar= 10µm. B. Bar graph shows significant increase in DAF fluorescence in NRCM following treatment with for 36h. Treatment of NRCM with and also resulted in significant NO production when compared to untreated cardiomyocytes. n= number of cardiomyocytes analysed. p<0.05 when compared to control cells, and #p< 0.05 when compared to treated cells. 10