AT1 RECEPTOR BLOCKADE ATTENUATES INSULIN RESISTANCE AND MYOCARDIAL REMODELING IN RATS WITH DIET-INDUCED OBESITY
|
|
|
- Roy Adams
- 5 years ago
- Views:
Transcription
1 AT1 RECEPTOR BLOCKADE ATTENUATES INSULIN RESISTANCE AND MYOCARDIAL REMODELING IN RATS WITH DIET-INDUCED OBESITY SA Oliveira Jr, MP Okoshi, PF Martinez, DM Guizoni, BP Torres, M Dal Pai-Silva, K Okoshi, CR Padovani, AP Lima-Leopoldo, AC Cicogna 1 Federal University of Mato Grosso do Sul, Campo Grande, Brazil Sao Paulo State University, Botucatu Medical School, Brazil There is not any conflict of interest regarding the current presentation.
2 BACKGROUND
3 Cardiac remodeling Adaptive process to maintain myocardial performance in response to stress conditions Cardiac remodeling involves myocyte hypertrophy, interstitial fibrosis and molecular modifications Cohn JN, Ferrari R, Sharpe N. J Am Coll Cardiol, 2000;35(3): Barry S, Davidson S, Townsend P. Int J Biochem Cell, 2008;40(10):
4 Cardiac remodeling Differential molecular mechanisms can interact in multiple points of the cytosol in cardiac remodeling Important connection (cross-talk) between the signal transduction pathways that mediate insulin and angiotensin II actions in the heart Cardiac Remodeling and Insulin Resistance Cooper S, et al. Am J Physiol-Heart Circ Physiol. 2007;293(4):H Bertrand L, et al. Cardiovasc Res, 2008;79(2):238-48
5 Regulation of insulin signaling Insulin actions are highly regulated by several factors Regulatory mechanisms attenuate metabolic signaling from insulin stimuli by decreasing Tyrosine phosphorylation of proteins members from insulin pathway, as insulin receptor (IR), insulin receptor substrate (IRS) and phosphatidilinositol 3-kinase (PI3K) messenger Insulin resistance is a common pathological state in which target cells fail to respond to normal stimuli from circulating insulin
6 Molecular mechanisms of angiotensin II signaling Elevations in angiotensin II (Ang-II) contribute to stimulation of Ang-II type 1 (AT1) receptor: remodeling and insulin resistance in the heart Velloso, Folli, Perego, et al.; Diab Metab Res Rev 2006; 22(1): Olivares-Reyes, Arellano-Plancarte, Castillo-Hernandez; Mol Cell Endocrinol 2009; 302(1):128-39
7 Cross-talk between Ang-II and insulin in Obesity Clinical studies/ genetic models of obesity (Zucker rats): Interventions with ACE inhibitors or AT1 receptor blockade: - attenuation of metabolic and endocrine disorders; - normalization of arterial pressure as well as remodeling and insulin resistance in the heart Ang-II and insulin interaction in models of diet-induced obesity Fogari et al.; Hypertens Res 2005;28(3): Ernsberger et al.; Am J Hypertens. 2007;20(8): Carvalheira et al.; Endocrinology. 2003;144(12):
8 HYPOTHESIS Hypercaloric diet-induced obesity has been associated with metabolic and cardiovascular disorders, including remodeling and insulin resistance in the myocardium
9 OBJECTIVE
10 OBJECTIVE To evaluate the influence of angiotensin-ii type I (AT1) receptor blocker losartan on insulin receptor/ phosphatidylinositol 3-kinase pathway and myocardial remodeling in rats with diet-induced obesity
11 METHODS
12 Animals and experimental design Wistar-Kyoto rats (60 days-old) Control group (C) Obese group (OB) C CL OB OBL Experimental period: 30 Weeks 5 Weeks C groups: animals submitted to commercial rat chow (3.2 kcal/g) OB groups: animals submitted to hypercaloric diet (4.6 kcal/g) L groups: groups treated with Losartan (30 mg/kg/day)
13 Nutritional and metabolic parameters Body weight (g) Adiposity (AD): AD=[epididymal fat (EF) + retroperitoneal fat (RPF)] 100 (body weight sum of fat pads) Glycemia was obtained from glucose tolerance test Insulin concentration (ELISA) Cardiovascular parameters Systolic blood pressure (SBP) was assessed, using a noninvasive tail-cuff method (pletismography) Morfological study integrated myocyte cross-sectional area and collagen interstitial fraction determination
14 Cardiovascular parameters Molecular expression of following proteins (Western blot): - β subunit of insulin receptor (βri) antibodies against βri (sc-711) and phospho-tyr βri (sc-25103) - p85 subunit of phosphatidylinositol 3-kinase (p85/pi3-k) antibodies against p85/pi3k (sc-1637) and phospho-tyr p85/pi3k (sc ) - Protein levels were normalized to those of GAPDH (6C5, sc-32233, Santa Cruz Biotechnology) Martinez et al.; Med Sci Monit 2010; 16(12):BR374-83
15 Proceedings of statistical analyses Results were evaluated by two-way analysis of variance (ANOVA) When significant differences were found (p<0.05), the post hoc Tukey s multiple comparisons test was carried out The level of significance was considered to be 5%. Bayley; J Am Stat Assoc 1977; 72: Norman & Streiner; Biostatistics: the bare essentials. 1994
16 RESULTS
17 Nutritional, metabolic and cardiovascular profile Table 1. Nutritional, metabolic and cardiovascular results according groups Variables Groups C OB CL OBL Body weight (g) 553 ± ± 45 * 552 ± ± 63 Adiposity (%) 6.0 ± ± 2.3 * 6.4 ± ± 2.3 Glycemia (AUC) 26,345±1,935 34,841±1,836 * 26,520±1,840 31,300±1,836 Insulin (ng/dl) 1.64 ± ± 0.37 * 1.03 ± 0.21 * 2.06 ± 0.20 # SBP (mmhg) ± ± 9.7 * ± 7.6 * ± 13.9 # Results in mean±standard error; AUC: area under curve of responses to glycemic tolerance test; SBP: systolic blood pressure; * p<0.05 vs C; # p<0.05 vs OB group; p<0.05 vs CL group; ANOVA and Tukey s test
18 Cross-sectional area (µm 2 ) A Histological parameters of the heart C 400 * # B CL OB OBL 100 C OB CL OBL Figure 1. Morphometric analysis of left ventricle; (A) histological sections stained with hematoxylin-eosin; (B) myocyte cross-sectional area, according group; results in mean and standard-error; * p<0.05 vs C group; # p<0.05 vs OB group; ANOVA and Tukey s test
19 Interstitial collagen fraction (%) A Histological parameters of the heart C 6 * * B 5 OB CL 1 C OB CL OBL OBL Figure 2. Morphometric analysis of left ventricle; (A) histological sections stained with picro-sirius red; (B) interstitial collagen fraction according groups; results in mean and standard-deviation; * p<0.05 vs C; # p<0.05 vs OB; p<0.05 vs CL; ANOVA and Tukey s test
20 Tyr βir/ βir βir/ GAPDH 3,0 2,5 A Figure 3. Protein levels of insulin 2,0 receptor in cardiac muscle 1,5 analyzed by Western blotting. (A) β-subunit of insulin receptor (βir); βir protein levels normalized to the GAPDH levels. (B) phospho- 1,0 0,5 0,0 C OB CL OBL Tyr βri expression; protein levels normalized to the βri total 4 # B levels; results in mean and standard-deviation; * p<0.05 vs C; # p<0.05 vs OB; p<0.05 vs CL; 3 2 * * ANOVA and Tukey s test. 1 0 C OB CL OBL
21 Tyr 508 -PI3K/ PI3K PI3K/ GAPDH 4 A Figure 4. Protein levels of p85 3 subunit of phosphatidylinositol 3- kinase (PI3K) in cardiac muscle 2 * analyzed by Western blotting. (A) PI3K expression; PI3K protein 1 levels normalized to the GAPDH levels. (B) phospho-tyr 508 -PI3K 0 C OB CL OBL expression; protein levels normalized to the PI3K total levels; results in mean and standard-error; * p<0.05 vs C; # * # B p<0.05 vs OB; p<0.05 vs CL; ANOVA and Tukey s test. 1 0 C OB CL OBL
22 CONCLUSION
23 CONCLUSION Losartan attenuates insulin resistance and myocardial remodeling in obese rats. Financial support: FAPESP
Effects of sitagliptin on cardiac metabolism in mice
Effects of sitagliptin on cardiac metabolism in mice M. Lenski, J.-C. Reil, M. Böhm, U. Laufs Saarland University Hospital Department of Internal Medicine III, Cardiology Homburg - Germany Disclosures
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
Extensive impact of saturated fatty acids on metabolic and cardiovascular profile in rats with diet-induced obesity: a canonical analysis
Oliveira Junior et al. Cardiovascular Diabetology 2013, 12:65 CARDIO VASCULAR DIABETOLOGY ORIGINAL INVESTIGATION Open Access Extensive impact of saturated fatty acids on metabolic and cardiovascular profile
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
Angiotensin-Converting Enzyme-2 Overexpression Improves Left Ventricular Remodeling and Function in a Rat Model of Diabetic Cardiomyopathy
Journal of the American College of Cardiology Vol. 59, No. 8, 2012 2012 by the American College of Cardiology Foundation ISSN 0735-1097/$36.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2011.09.071
Blockade of Renin-Angiotensin System Attenuates Cardiac Remodeling in Rats Undergoing Aortic Stenosis
Original Article Blockade of Renin-Angiotensin System Attenuates Cardiac Remodeling in Rats Undergoing Aortic Stenosis Giancarlo Gonçalves, Leonardo A. M. Zornoff, Henrique B. Ribeiro, Marina P. Okoshi,
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
CNS Effects of Aldosterone :
CNS Effects of Aldosterone : Critical Roles in salt-sensitive sensitive hypertension and CHF. Frans HH Leenen MD, PhD, FRCPC, FAHA 2 Renin Angiotensin Aldosterone System Circulatory RAAS Tissue RAAS: -
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
Cardiovascular Protection and the RAS
Cardiovascular Protection and the RAS Katalin Kauser, MD, PhD, DSc Senior Associate Director, Boehringer Ingelheim Pharmaceutical Inc. Micardis Product Pipeline Scientific Support Ridgefield, CT, USA Cardiovascular
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
ANGIOTENSIN-(1-7) PREVENTS CARDIOMYOCYTE PATHOLOGICAL. REMODELING THROUGH A NO/cGMP DEPENDENT PATHWAY.
ONLINE SUPPLEMENT ANGIOTENSIN-(1-7) PREVENTS CARDIOMYOCYTE PATHOLOGICAL REMODELING THROUGH A NO/cGMP DEPENDENT PATHWAY. Enéas R.M. Gomes 1, Aline A. Lara 1, Pedro W.M. Almeida 1, Diogo Guimarães 1, Rodrigo
Age-related changes in cardiovascular system. Dr. Rehab Gwada
Age-related changes in cardiovascular system Dr. Rehab Gwada Objectives explain the main structural and functional changes in cardiovascular system associated with normal aging Introduction aging results
Prevention of Atrial Fibrillation and Heart Failure in the Hypertensive Patient
Prevention of Atrial Fibrillation and Heart Failure in the Hypertensive Patient The Issue of Primary Prevention of A.Fib. (and Heart Failure) and not the Prevention of Recurrent A.Fib. after Electroconversion
There is no conflict of interests for the following presentation
There is no conflict of interests for the following presentation Inflammation and Left Ventricular Diastolic Dysfunction Cho-Kai Wu MD National Taiwan University Hospital, Taipei, Taiwan Diastolic heart
G-Protein Signaling. Introduction to intracellular signaling. Dr. SARRAY Sameh, Ph.D
G-Protein Signaling Introduction to intracellular signaling Dr. SARRAY Sameh, Ph.D Cell signaling Cells communicate via extracellular signaling molecules (Hormones, growth factors and neurotransmitters
Ventricular Interactions in the Normal and Failing Heart
Ventricular Interactions in the Normal and Failing Heart Congenital Cardiac Anesthesia Society 2015 Pressure-volume relations Matched Left ventricle to low hydraulic impedance Maximal stroke work limited
control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
Pathophysiology of heart failure with preserved ejection fraction. Extracellular matrix
Pathophysiology of heart failure with preserved ejection fraction Extracellular matrix Javier Díez, MD, PhD. Full Professor of Cardiovascular Medicine and Director Division of Cardiovascular Sciences Centre
Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure
Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure Coralie Poizat, Ph.D. Director, Cardiovascular Research Program KFSHRC-Riyadh Saudi Heart Failure Working Group Jeddah, 5 December 2015 Cardiovascular
Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on
Supplemental Methods Immunohistochemical Analyses Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on prostatectomy sections obtained post-study. Briefly,
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Heart Failure with Preserved Ejection Fraction: Mechanisms and Management
Heart Failure with Preserved Ejection Fraction: Mechanisms and Management Jay N. Cohn, M.D. Professor of Medicine Director, Rasmussen Center for Cardiovascular Disease Prevention University of Minnesota
Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
Recovery of Myocardial Infarction via Unique Modulation of the Cardiac Microenvironment
2016 춘계심혈관통합학술대회, 경주 Recovery of Myocardial Infarction via Unique Modulation of the Cardiac Microenvironment Youngkeun Ahn, MD, PhD Department of Cardiology, Cardiovascular Center Chonnam National University
Chem Lecture 10 Signal Transduction
Chem 452 - Lecture 10 Signal Transduction 111130 Here we look at the movement of a signal from the outside of a cell to its inside, where it elicits changes within the cell. These changes are usually mediated
High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes
High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes Sophie Cassidy, s.cassidy@ncl.ac.uk 1) Concentric remodelling 1.2 * Eccentricity ratio
Estrogens vs Testosterone for cardiovascular health and longevity
Estrogens vs Testosterone for cardiovascular health and longevity Panagiota Pietri, MD, PhD, FESC Director of Hypertension Unit Athens Medical Center Athens, Greece Women vs Men Is there a difference in
PKC II inhibition attenuates myocardial infarction induced heart failure and is associated with a reduction of fibrosis and pro-inflammatory responses
J. Cell. Mol. Med. Vol 15, No 8, 2011 pp. 1769-1777 PKC II inhibition attenuates myocardial infarction induced heart failure and is associated with a reduction of fibrosis and pro-inflammatory responses
Cardiac AT 1 Receptor-Dependent and IGF1 Receptor-Independent Signaling Is Activated by a Single Bout of Resistance Exercise
Physiol. Res. 66: 1061-1065, 2017 SHORT COMMUNICATION Cardiac AT 1 Receptor-Dependent and IGF1 Receptor-Independent Signaling Is Activated by a Single Bout of Resistance Exercise S. F. S. MELO 1,2, V.
Myocardial Remodeling in Chronic Pressure or Volume Overload in the Rat Heart
Article Original Article Myocardial Remodeling in Chronic Pressure or Volume Overload in the Rat Heart Luiz Shiguero Matsubara, Silvia Narikawa, Ana Lucia dos Anjos Ferreira, Sergio Alberto Rupp de Paiva,
Analysis of AVP functions via V1a and V1b receptors with knockout mice. Akito Tanoue
Analysis of AVP functions via V1a and V1b receptors with knockout mice Akito Tanoue Department of Pharmacology, National Research Institute for Child Health and Development Arginine-Vasopressin (AVP) is
Risk Stratification in Heart Failure: The Role of Emerging Biomarkers
Risk Stratification in Heart Failure: The Role of Emerging Biomarkers David G. Grenache, PhD Associate Professor of Pathology, University of Utah Medical Director, ARUP Laboratories Salt Lake City, UT
Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
C57BL/6 Mice are More Appropriate. than BALB/C Mice in Inducing Dilated Cardiomyopathy with Short-Term Doxorubicin Treatment
Original Article C57BL/6 Mice are More Appropriate Acta Cardiol Sin 2012;28:236 240 Heart Failure & Cardiomyopathy C57BL/6 Mice are More Appropriate than BALB/C Mice in Inducing Dilated Cardiomyopathy
Hypoinsulinemia is strongly associated with coronary artery calcification (CAC) assessed by multislice computed tomography
Hypoinsulinemia is strongly associated with coronary artery calcification (CAC) assessed by multislice computed tomography Yohei Oda 1, Muhei Tanaka 2, Michiaki Fukui 2, Sei Tsunoda 1, Satoshi Akabame
Preserved EF with heart failure (HF pef) 50% 5 year survival. Both have type 2 diabetes Both have hypertension Both have normal ejection fractions
Research companies Government / University research Preserved EF with heart failure (HF pef) 50% 5 year survival Both have type 2 diabetes Both have hypertension Both have normal ejection fractions Introduction
MOLECULAR MECHANISMS INVOLVED IN ANGIOTENSIN-(1-7)/Mas. Short title: Ang-(1-7)/Mas signaling pathway in cardiomyocytes
MOLECULAR MECHANISMS INVOLVED IN ANGIOTENSIN-(1-7)/Mas SIGNALING PATHWAY IN CARDIOMYOCYTES 1 Marco Fabrício Dias-Peixoto, 1 Robson A.S. Santos, 1 Enéas R.M. Gomes, 1 Márcia N.M. Alves, 1 Pedro W.M. Almeida,
The Diabetes Link to Heart Disease
The Diabetes Link to Heart Disease Anthony Abe DeSantis, MD September 18, 2015 University of WA Division of Metabolism, Endocrinology and Nutrition Oswald Toosweet Case #1 68 yo M with T2DM Diagnosed DM
Introduction! Introduction! Introduction! Chem Lecture 10 Signal Transduction & Sensory Systems Part 2
Chem 452 - Lecture 10 Signal Transduction & Sensory Systems Part 2 Questions of the Day: How does the hormone insulin trigger the uptake of glucose in the cells that it targets. Introduction! Signal transduction
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous
Supplementary Figure 1. Spatial distribution of LRP5 and β-catenin in intact cardiomyocytes. (a) and (b) Immunofluorescence staining of endogenous LRP5 in intact adult mouse ventricular myocytes (AMVMs)
Cedars Sinai Diabetes. Michael A. Weber
Cedars Sinai Diabetes Michael A. Weber Speaker Disclosures I disclose that I am a Consultant for: Ablative Solutions, Boston Scientific, Boehringer Ingelheim, Eli Lilly, Forest, Medtronics, Novartis, ReCor
SUPPLEMENTAL DATA. Lumen area ( m 2 )
Elastin Lumen area ( m 2 ) Media to lumen ratio (x1) H.E. Medium thickness ( m) Medium area ( m 2 ) SUPPLEMENTAL DATA A (Bmal1 flox/flox ) (SM-Bmal1 -/- ) B 1 8 8 6 6 4 4 2 2 1µm 5 8 4 6 3 2 4 1 2 Supplemental
New Trials. Iain Squire. Professor of Cardiovascular Medicine University of Leicester. Chair, BSH
New Trials Iain Squire Professor of Cardiovascular Medicine University of Leicester Chair, BSH BSH Heart Failure Day for Revalidation and Training 2017 Presentation title: New Trials Speaker: Iain Squire
Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
Histomorphometric Evaluation of the Small Coronary Arteries in Rats Exposed to Industrial Noise
Int. J. Mol. Sci. 2015, 16, 10095-10104; doi:10.3390/ijms160510095 Article OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Histomorphometric Evaluation
Effect of chronic oral administration of a low dose of captopril on sodium appetite of hypothyroid rats. Influence of aldosterone treatment
Brazilian Sodium appetite Journal of in Medical hypothyroid and rats Biological Research (21) 34: 47-411 ISSN 1-879X Short Communication 47 Effect of chronic oral administration of a low dose of captopril
Diabetes and the Heart
Diabetes and the Heart Association of Specialty Professors April 4, 2013 Jorge Plutzky, MD Co-Director, Preventive Cardiology Director, The Lipid Clinic Cardiovascular Division Brigham and Women s Hospital
Severe Left Ventricular Dysfunction: Evolving Revascularization Strategies
Severe Left Ventricular Dysfunction: Evolving Revascularization Strategies Robert O. Bonow, MD, MS, MACC Northwestern University Feinberg School of Medicine Bluhm Cardiovascular Institute Northwestern
Blood Pressure Goal in Elderly Hypertensive Patients with Diabetes Mellitus: A Subanalysis of the CASE-J Trial
Blood Pressure Goal in Elderly Hypertensive Patients with Diabetes Mellitus: A Subanalysis of the CASE-J Trial Kenji Ueshima 1, Shinji Yasuno 1, Sachiko Tanaka 1, Akira Fujimoto 1, Toshio Ogihara 2, Takao
Diastolic Heart Failure
Diastolic Heart Failure Presented by: Robert Roberts, M.D., FRCPC, MACC, FAHA, FRSC Professor of Medicine and Chair ISCTR University of Arizona, College of Medicine Phoenix Scientist Emeritus and Advisor,
Heart Failure: The Frequent, Forgotten and often Fatal Complication of Type 2 Diabetes
Heart Failure: The Frequent, Forgotten and often Fatal Complication of Type 2 Diabetes DAVID S. H. BELL CHAIRMAN BELL, DSH. DIABETES CARE(2003)26:2433-41. Speaker s Bureau: AstraZeneca Novo Nordisk Janssen
The promise of the thiazolidinediones in the management of type 2 diabetes-associated cardiovascular disease
The promise of the thiazolidinediones in the management of type 2 diabetes-associated cardiovascular disease Steve Smith, Group Director Scientific Affairs, Diabetes & Metabolism GlaxoSmithKline R & D
Diastolic Heart Failure. Edwin Tulloch-Reid MBBS FACC Consultant Cardiologist Heart Institute of the Caribbean December 2012
Diastolic Heart Failure Edwin Tulloch-Reid MBBS FACC Consultant Cardiologist Heart Institute of the Caribbean December 2012 Disclosures Have spoken for Merck, Sharpe and Dohme Sat on a physician advisory
ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU. PhD THESIS Summary
ROMANIAN ACADEMY INSTITUTE OF CELLULAR BIOLOGY AND PATHOLOGY NICOLAE SIMIONESCU PhD THESIS Summary INVOLVEMENT OF ALARMIN HMGB1 IN INFLAMMATORY PROCESSES ASSOCIATED WITH VASCULAR DYSFUNCTION IN HYPERLIPIDEMIA
Value of cardiac rehabilitation Prof. Dr. L Vanhees
Session: At the interface of hypertension and coronary heart disease haemodynamics, heart and hypertension Value of cardiac rehabilitation Prof. Dr. L Vanhees ESC Stockholm August 2010 Introduction There
TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]
![TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]](/thumbs/89/99233308.jpg "TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]")
ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology
Paul M McKie, Alessandro Cataliotti, Guido Boerrigter, Horng C Chen, Fernando L Martin, and John C Burnett Jr
Cardiorenal Enhancing and Aldosterone Suppressing Actions of a Novel Designer Natriuretic Peptide in Experimental Hypertension with Ventricular Pressure Overload Paul M McKie, Alessandro Cataliotti, Guido
Risk Assessment of developing type 2 diabetes mellitus in patient on antihypertensive medication
41 Research Article Risk Assessment of developing type 2 diabetes mellitus in patient on antihypertensive medication Amarjeet Singh*, Sudeep bhardwaj, Ashutosh aggarwal Department of Pharmacology, Seth
Regression of Electrocardiographic Left Ventricular Hypertrophy by Losartan Versus Atenolol
Regression of Electrocardiographic Left Ventricular Hypertrophy by Losartan Versus Atenolol The Losartan Intervention For Endpoint reduction in hypertension (LIFE) Study Peter M. Okin, MD; Richard B. Devereux,
Oxidative Stress Unify the Pathophysiological Mechanism of Experimental Hypertension and Diabetes of Spontaneously Hypertensive Stroke-Prone Rats
Oxidative Stress Unify the Pathophysiological Mechanism of Experimental Hypertension and Diabetes of Spontaneously Hypertensive Stroke-Prone Rats Stenio Fiorelli¹, Camille F França¹, Carlos Alberto Basílio
Vascular Alterations in High-fat Diet-obese Rats: Role of Endothelial L-arginine/NO Pathway
Vascular Alterations in High-fat Diet-obese Rats: Role of Endothelial L-arginine/NO Pathway Thiago Bruder Nascimento 1, Rafaela de Fátima Ferreira Baptista 1, Priscila Cristina Pereira 1, Dijon Henrique
LXIV: DRUGS: 4. RAS BLOCKADE
LXIV: DRUGS: 4. RAS BLOCKADE ACE Inhibitors Components of RAS Actions of Angiotensin i II Indications for ACEIs Contraindications RAS blockade in hypertension RAS blockade in CAD RAS blockade in HF Limitations
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
Hypertension with Comorbidities Treatment of Metabolic Risk Factors in Children and Adolescents
Hypertension with Comorbidities Treatment of Metabolic Risk Factors in Children and Adolescents Stella Stabouli Ass. Professor Pediatrics 1 st Department of Pediatrics Hippocratio Hospital Evaluation of
The Beneficial Role of Angiotensin- Converting Enzyme Inhibitor in Acute Myocardial Infarction
The Beneficial Role of Angiotensin- Converting Enzyme Inhibitor in Acute Myocardial Infarction Cardiovascular Center, Korea University Guro Hospital 2007. 4. 20 Seung-Woon Rha, MD, PhD Introduction 1.
Angiotensin IV and the Molecular Mechanisms Involved in the Development of Insulin Resistance in 3T3-L1 Adipocytes
University of Tennessee, Knoxville Trace: Tennessee Research and Creative Exchange Masters Theses Graduate School 8-2011 Angiotensin IV and the Molecular Mechanisms Involved in the Development of Insulin
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Earlier studies, mainly in rodents, have shown that diabetic
Downregulation of Myocardial Myocyte Enhancer Factor 2C and Myocyte Enhancer Factor 2C Regulated Gene Expression in Diabetic Patients With Nonischemic Heart Failure Peter Razeghi, MD; Martin E. Young,
METABOLISMO E VITAMINA D
CONVEGNO NAZIONALE GIBIS ROMA 14-15 MAGGIO 2015 METABOLISMO E VITAMINA D Alfredo Scillitani UO Endocrinologia Ospedale Casa Sollievo della Sofferenza Holick MF, NEJM 2007 Sindrome Metabolica E un cluster
Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
CKD Satellite Symposium
CKD Satellite Symposium Recommended Therapy by Heart Failure Stage AHA/ACC Task Force on Practice Guideline 2001 Natural History of Heart Failure Patients surviving % Mechanism of death Sudden death 40%
Managing the Low Output Low Gradient Aortic Stenosis Patient
Managing the Low Output Low Gradient Aortic Stenosis Patient R A Nishimura MD Judd and Mary Leighton Professor of CV Mayo Clinic No disclosures Valvular Stenosis Severity of Aortic Stenosis Mean gradient
Diabetes Mellitus and Breast Cancer
Masur K, Thévenod F, Zänker KS (eds): Diabetes and Cancer. Epidemiological Evidence and Molecular Links. Front Diabetes. Basel, Karger, 2008, vol 19, pp 97 113 Diabetes Mellitus and Breast Cancer Ido Wolf
A Comparative Analysis of Capillary Density in the Myocardium of Normotensive and Spontaneously Hypertensive Rats
Institute of Experimental Morphology, Pathology and Anthropology with Museum Bulgarian Anatomical Society Acta morphologica et anthropologica, 24 (1-2) Sofia 2017 A Comparative Analysis of Capillary Density
Diabetes and the Heart
Diabetes and the Heart By Samir Naim Assaad, MD, MRCP(UK), FRCP(Edin), FRCP(Lond) Professor of Medicine & Endocrinology University of Alexandria EGYPT Disclosure None, related to this presentation Road
Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
Signal Transduction Pathway Smorgasbord
Molecular Cell Biology Lecture. Oct 28, 2014 Signal Transduction Pathway Smorgasbord Ron Bose, MD PhD Biochemistry and Molecular Cell Biology Programs Washington University School of Medicine Outline 1.
I have nothing to disclose.
I have nothing to disclose. Epicardial vs Pericardial Fat? Implications of this Question Thomas H Marwick MBBS, PhD, MPH Menzies Research Institute, Hobart, Australia Epicardial and pericardial fat 1.
J Jpn Coll Angiol, 2009, 49:
Online publication October 6, 2009 48 2 20 J Jpn Coll Angiol, 2009, 49: 293 297 atrial natriuretic peptide, brain natriuretic peptide, guanylyl cyclase-a receptor, cardiac remodeling, cardiac hypertrophy
The Therapeutic Potential of Novel Approaches to RAAS. Professor of Medicine University of California, San Diego
The Therapeutic Potential of Novel Approaches to RAAS Inhibition in Heart Failure Barry Greenberg, M.D. Professor of Medicine University of California, San Diego Chain of Events Leading to End-Stage Heart
Cardiovascular Complications of Diabetes
VBWG Cardiovascular Complications of Diabetes Nicola Abate, M.D., F.N.L.A. Professor and Chief Division of Endocrinology and Metabolism The University of Texas Medical Branch Galveston, Texas Coronary
Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours
Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal
Losartan Improves Exercise Tolerance in Patients With Diastolic Dysfunction and a Hypertensive Response to Exercise
Journal of the American College of Cardiology Vol. 33, No. 6, 1999 1999 by the American College of Cardiology ISSN 0735-1097/99/$20.00 Published by Elsevier Science Inc. PII S0735-1097(99)00048-0 Losartan
Effects of Losartan and Amlodipine on Left Ventricular Remodeling and Function in Young Stroke-Prone Spontaneously Hypertensive Rats
Original Article Acta Cardiol Sin 2014;30:316 324 Basic Science Effects of Losartan and Amlodipine on Left Ventricular Remodeling and Function in Young Stroke-Prone Spontaneously Hypertensive Rats De-Hua
ORIGINAL REPORTS: OBESITY
ORIGINAL REPORTS: OBESITY BODY MASS AND CARDIOVASCULAR REACTIVITY TO RACISM IN AFRICAN AMERICAN COLLEGE STUDENTS Objective: The purpose of the present study was to examine the effects of body mass on cardiovascular
OMICS Journals are Welcoming Submissions
OMICS Journals are Welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME
HSN301 REVISION NOTES TOPIC 1 METABOLIC SYNDROME What does the term Metabolic Syndrome describe? Metabolic syndrome describes a cluster of cardio-metabolic conditions that increase one's risk of developing
Insulin resistance influences 24h heart rate and blood pressure variabilities and cardiovascular autonomic modulation in normotensive healthy adults
Insulin resistance influences 24h heart rate and blood pressure variabilities and cardiovascular autonomic modulation in normotensive healthy adults Ochoa JE 1, Correa M 2, Valencia AM 2, Gallo J 2, McEwen
-adrenergic receptor subtypes blockade on the rat myocardium inotropy
Research Article The effect of -adrenergic receptor subtypes blockade on the rat myocardium inotropy Insaf Ilkhamovich Khabibrakhmanov*, Nafisa Ilgizovna Ziшatdinova, Timur Lvovich Zefirov ABSTRACT Aim:
Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
Supporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
When should you treat blood pressure in the young?
ESC Stockholm - Dilemmas in Cardiovascular Disease Prevention in the Young: 30 th August 2010 When should you treat blood pressure in the young? Bryan Williams MD FRCP FAHA FESC Professor of Medicine Department
Supporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
Experimental Procedures. Systolic, diastolic and mean BP levels and heart rate were measured using a
Supplemental Data Experimental Procedures Measurements of Blood Pressure and Heart Rate Systolic, diastolic and mean BP levels and heart rate were measured using a noninvasive computerized tail-cuff system
Sacubitril/Valsartan unter der Lupe Subgruppenanalysen, real world data,
Sacubitril/Valsartan unter der Lupe Subgruppenanalysen, real world data, praktische Erfahrungen michael.boehm@uks.eu M. Böhm Innere Medizin III (Kardiologie / Angiologie / Internistische Intensivmedizin)