Philipp Schlegel, Jan Ksienzyk, Jens Barthelmes, Uwe Haberkorn, Walter J. Koch, Hugo A. Katus, Patrick Most, Oliver J. Mueller, Philip W.J.
|
|
|
- Shannon Phillips
- 5 years ago
- Views:
Transcription
1 UniversityHospital Heidelberg Cardiac AAV6.betaARKct gene therapy ameliorates cardiac function and normalizes neurohumoral signaling in a clinically relevant large animal heart failure model Philipp Schlegel, Jan Ksienzyk, Jens Barthelmes, Uwe Haberkorn, Walter J. Koch, Hugo A. Katus, Patrick Most, Oliver J. Mueller, Philip W.J. Raake Department of Cardiology, University of Heidelberg, Heidelberg, Germany, Europe Department of Nuclear Medicine, University of Heidelberg, Heidelberg, Germany, Europe Center for Translational Medicine, Thomas Jefferson University, Philadelphia, USA HF 212 Belgrade
2 No disclosures to report. HF 212 Belgrade
3 G-protein signaling in heart failure β 1 AR β 2 AR P Arrestin P β γ GRK2 AC + - β γ GRK2 P P Arrestin GRK2 GRK2 GRK2
4 GRK2 is critical for heart failure development Conditional GRK2 KO mouse (αmhc-cre/grk2 flox/flox ) Male and female mice Percent survival MI GRK2 Knockout mouse / n = 91 MI Wildtype mouse / n = Time (days) MI Myocardial Infarction Raake et al. Circ Res 28
5 GRK2-Inhibition with ßARKct β 1 AR β 2 AR β γ βarkct Gαs AC + camp β γ GRK2 Koch et al. Science 1995 Rengo, Koch Circulation 29
6 Hypothesis: Cardiac ßARKct gene therapy improves myocardial function in a porcine heart failure model.
7 Experimental protocol Model: post myocardial infarction ischemic cardiomyopathy in large animals (pigs) Day 1 Day 14 Day 56 MI GENE TRANSFER Echocardiography, LV Hemodynamics Echocardiography, LV Hemodynamics, Sample harvesting
8 Large animal model of ischemic cardiomyopathy MI LAD TTC staining Infarcted area in % total LV area high sensitive TnT [pg/ml] Day1 Day2 Day3 Day4 Sham MI Day5
9 Experimental protocol Model: post myocardial infarction ischemic cardiomyopathy in large animals (pigs) Day 1 Day 14 Day 56 MI GENE TRANSFER Echocardiography, LV Hemodynamics Echocardiography, LV Hemodynamics, Sample harvesting
10 Catheter-Based Retrograde Gene Delivery LAD AIV AAV6.βARKct AAV6.Luciferase (Control) 1E13 vp / animal
11 Experimental protocol Model: post myocardial infarction ischemic cardiomyopathy in large animals (pigs) Day 1 Day 14 Day 56 MI GENE TRANSFER Echocardiography, LV Hemodynamics Echocardiography, LV Hemodynamics, Sample harvesting
12 Ladder LAD proximal LAD distal LAD proximal LAD mid. LAD distal LAD Apex LCX - Control (mouse) + Control (transgenic ßARKct mouse) Transgene expression Non-targeted area Targeted area βarkct western blotting ßARKct GAPDH 1X AAV6. Luciferase AAV6.ßARKct 4X GFP direct immunofluorescence AAV6.βARKct gene transfer is efficient.
13 LV Hemodynamics dp/dt max [mmhg/s] dp/dt max [mmhg/s] Day 14 Basal Day 56 Sham Day 14 Day 56 Dobutamine-Stimulation AAV6.Luciferase AAV6.ßARKct AAV6.βARKct improves systolic cardiac function in heart failure.
14 Normalization of β-ar signalling Metanephrine and normetanephrine levels (plasma) Myocardial β-ar density (target area) Plasma levels [pg/ml] Metanephrine Sham AAV6.Luciferase AAV6.ßARKct Normetanephrine -adrenergic receptor density [fmol/mg protein] 5 p= Sham AAV6.Luciferase AAV6.ßARKct AAV6.βARKct normalizes neurohormonal β-ar signaling.
15 Adverse Cardiac Remodelling Heart to Body-Weight Ratio Fetal Gene Expression 3 HW/BW - Ratio [g/kg] # -MHC mrna vs. 18S molecules Sham AAV6.Luciferase AAV6.ßARKct ANF mrna vs. 18S mrna molecules
16 Adverse Cardiac Remodelling Markers of cardiac fibrosis (Collagen 1 and 3) Collagen 1 1 mrna vs. 18S molecules Collagen 3 1 mrna vs. 18S molecules Sham AAV6.Luciferase AAV6.ßARKct AAV6.βARKct represses adverse cardiac remodelling.
17 Summary and Conclusions Gene delivery AAV6 allows a robust myocardial transgene expression after retrograde coronary venous delivery AAV6.ßARKct Amelioration of systolic LV function Normalization of neurohormonal β-ar signalling axis Attenuation of adverse remodeling Future perspectives Synergistic effects with S1A1 or SERC2a gene therapy addressing deranged Ca2+-Cycling Further improvements of gene delivery techniques and AAV vectors Clinical trial
18 Department of Internal Medicine/Cardiology Prof. Dr. med. Hugo A. Katus Prof. Dr. med. Patrick Most PD Dr. med. Oliver Müller Dr. med. Sven Pleger Thank you! UniversityHospital Heidelberg Thomas Jefferson University Walter J. Koch, PhD Andrea D. Eckhart, PhD Leif E. Vinge, MD PhD Deutsche Forschungsgemeinschaft Raake Lab Molecular Targets in Heart Disease Philipp Schlegel Julia Reinkober Jens Barthelmes Henrike Tscheschner Suzan Allam Regina Huditz Irina Neacsu
19 Blood count SI Units SHAM AAV6.Luciferase AAV6.ßARKct Leucocytes /nl 18,92 ± 5,18 15,94 ± 3,38 16,53 ± 3,38 Erythrocytes /nl 5,69 ±,7 5,69 ±,48 5,83 ±,43 Hemoglobine mmol/l 6,4 ±,43 5,18 ± 1,35 5,73 ±,28 Hematocrit L/L,28 ±,2,28 ±,2,28 ±,1 MCV fl 49,25 ± 2,71 5, ± 1,53 48,88 ± 2,17 MCH pg/cell 17,25 ± 1,49 16,29 ±,76 16,13 ±,83 MCHC g/l 352,5 ± 26,59 324,29 ± 9,76 33, ± 1,69 RDW % 16,48 ±,88 16,36 ±,89 16,36 ±,73 Platelets /nl 426,13 ± 89,37 484,43 ± 133,41 488,13 ± 92,31 Hypo.Ery %,84 ±,4 6,51 ± 8,11 1,66 ± 2,31 Clinical chemistry Sodium mmol/l 139,75 ± 4,2 139,86 ± 1,7 139,13 ± 3,18 Potassium mmol/l 4,3 ±,65 4, ±,7 3,78 ±,12 Creatinine µmol/l 128,73 ± 2,42 117,7 ± 22,38 111,72 ± 21,97 Urea mmol/l 8,7 ± 3,38 8,42 ± 1,13 7,59 ± 2,43 hstnt ng/l 4,38 ± 2,56 6,17 ± 6,9 3,88 ± 1,81 LDH U/L 537,63 ± 96,29 52,71 ± 37,46 576,13 ± 144,32 GOT/AST U/L 37,75 ± 13,51 33,43 ± 1,66 4, ± 14,62 GPT/ALT U/L 44,88 ± 13,48 42,29 ± 1,16 51,38 ± 14,83 Alkaline phosphatase U/L 128, ± 27,87 12, ± 26,73 127,75 ± 23,74 GGT U/L 71,88 ± 35,83 56,86 ± 9,32 63,38 ± 12,91 Bilirubin µmol/l <3,42 ±, <3,42 ±, <3,42 ±, Coagulation Quick % 84,1 ± 9,8 9,55 ± 1,98 84,61 ± 4,35 INR 1,7 ±,6 1,4 ±,6 1,7 ±,3 aptt s 14,8 ± 1,53 13,64 ±,34 13,86 ±,63 Table 1
20 Cardiac Funtion - Echocardiography 5 5 FS [%] FS % - Change Sham AAV6.Luciferase AAV6.ßARKct Day 14 Day 56
21 Normalization of Neurohumoral Axis Plasma levels [pg/ml] Sham AAV6.Luciferase AAV6.ßARKct Metanephrine Normetanephrine BNP plasma level [pg/ml] AAV6.Luciferase AAV6.ßARKct AAV6.βARKct normalizes neurohormonal signaling.
GRK 2 level in peripheral blood lymphocytes of elderly patients with acute myocardial infarction
Journal of Geriatric Cardiology (2013) 10: 281 285 2013 JGC All rights reserved; www.jgc301.com Research Article Open Access GRK 2 level in peripheral blood lymphocytes of elderly patients with acute myocardial
Exercise in Adverse Cardiac Remodeling: of Mice and Men
Exercise in Adverse Cardiac Remodeling: of Mice and Men 17-01-2013 Dirk J Duncker Experimental Cardiology, Cardiology, Thoraxcenter Cardiovascular Research Institute COEUR Erasmus MC, University Medical
Hamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
Hamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
Original Article Effect of β-adrenergic receptor kinase inhibitor on post-myocardial infarction heart failure in rats
Int J Clin Exp Pathol 2017;10(9):9858-9865 www.ijcep.com /ISSN:1936-2625/IJCEP0058900 Original Article Effect of β-adrenergic receptor kinase inhibitor on post-myocardial infarction heart failure in rats
Tables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
Cardiac Gene Therapy: Beyond the Mouse. David M Kaye Heart Failure Research Group Baker IDI, Melbourne, AUSTRALIA
Cardiac Gene Therapy: Beyond the Mouse David M Kaye Heart Failure Research Group Baker IDI, Melbourne, AUSTRALIA Presenter Disclosure Information FINANCIAL DISCLOSURE: Equity: Osprey Medical Grants/Research
NEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
i. Where is the participant seen?
PFU01 method used: Phone/in-person interview 1 Enter PIP # here: Online survey 2 Enter Web # here: Initials of person completing form: Date Form Completed: / / Form Version: 03 / 01 / 18 Is the participant
Study. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6
Chemistry Reference Ranges and Critical Values
Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl
Gene Transfer During LVAD Support. University of Pittsburgh Medical Center Pittsburgh, PA
Gene Transfer During LVAD Support University of Pittsburgh Medical Center Pittsburgh, PA Heart Failure Major cause of morbidity and mortality In the United States each year, more than 1,000,000 hospitalizations
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO
POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the
Let us know how access to this document benefits you. Part of the Medical Genetics Commons, and the Pharmacy and Pharmaceutical Sciences Commons
Thomas Jefferson University Jefferson Digital Commons Department of Medicine Faculty Papers Department of Medicine 5-21-2010 Reduction of sympathetic activity via adrenaltargeted GRK2 gene deletion attenuates
Small Platform Catheter-Based Left Ventricular Assist Device Support Suppresses Cardioprotective Beta Arrestin- Mediated Signal Transduction
Small Platform Catheter-Based Left Ventricular Assist Device Support Suppresses Cardioprotective Beta Arrestin- Mediated Signal Transduction Keshava Rajagopal, MD PhD, Progyaparamita Saha, PhD, Isa Mohammed,
REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
NIH Public Access Author Manuscript Circ Res. Author manuscript; available in PMC 2009 May 10.
NIH Public Access Author Manuscript Published in final edited form as: Circ Res. 2008 August 15; 103(4): 413 422. doi:10.1161/circresaha.107.168336. G Protein-Coupled Receptor Kinase 2 Ablation in Cardiac
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
GRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
Effects of sitagliptin on cardiac metabolism in mice
Effects of sitagliptin on cardiac metabolism in mice M. Lenski, J.-C. Reil, M. Böhm, U. Laufs Saarland University Hospital Department of Internal Medicine III, Cardiology Homburg - Germany Disclosures
Gene Therapy Targets in Heart Failure: The Path to Translation
nature publishing group state Gene Therapy Targets in He Failure: The Path to Translation PWJ Raake 1, H Tscheschner 1, J Reinkober 1, J Ritterhoff 1, HA Katus 1, WJ Koch 2 and P Most 1 He failure (HF)
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Get to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
E10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g)
Myociyte cross-sectional Relative mrna levels Relative levels Relative mrna levels Supplementary Figures and Legends a 8 6 4 2 Ezh2 E1.5 E18.5 P2 1w 83w b Ezh2 p16 amhc b-actin P2 43w kd 37 86 16 wt mouse
Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
ENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
SUPPLEMENTARY INFORMATION
a c e doi:10.1038/nature10407 b d f Supplementary Figure 1. SERCA2a complex analysis. (a) Two-dimensional SDS-PAGE gels of SERCA2a complexes. A silver-stained SDSPAGE gel is shown, which reveals a 12 kda
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions
Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood
Modificazioni età-correlate del signaling β-adrenergico e basi molecolari dell'utilizzo dei β-bloccanti
L Italia? Non è un paese per vecchi 53 Congresso Nazionale Società Italiana di Gerontologia e Geriatria Firenze, 26-29 Novembre 2008 Modificazioni età-correlate del signaling β-adrenergico e basi molecolari
Yokohama City University School of Medicine Susumu Minamisawa (
Yokohama City University School of Medicine Susumu Minamisawa ( skeletal muscle cardiac muscle mitochondria Sarcoplasmic reticulum mitochondria I A T-tubule SR Free Ca 2+ T-tubule SR Opi. The Heart, 3rd
Delta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and function in
SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure 1. Fbn1 C1039G/+ hearts display normal cardiac function in the absence of hemodynamic stress. A. Echocardiographic quantification of cardiac dimensions and
Get to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
Cardiac devices beyond pacemaker and ICD Prof. Dr. Martin Borggrefe
Cardiac devices beyond pacemaker and ICD Prof. Dr. Martin Borggrefe Mannheim CRT studies Patient selection CRT: NYHA III-IV, EF 35%, SR, QRS 120ms, LVEDD>55mm (25-45)% Non-Responder The Concept: Cardiac
IPERATTIVITA DEL SISTEMA NERVOSO SIMPATICO: DALL INVECCHIAMENTO FISIOLOGICO ALL INSUFFICIENZA CARDIACA
IPERATTIVITA DEL SISTEMA NERVOSO SIMPATICO: DALL INVECCHIAMENTO FISIOLOGICO ALL INSUFFICIENZA CARDIACA Giuseppe Rengo, MD, PhD Department of Translational Medical Sciences University of Naples Federico
Trial to Reduce. Aranesp* Therapy. Cardiovascular Events with
Trial to Reduce Cardiovascular Events with Aranesp* Therapy John J.V. McMurray, Hajime Uno, Petr Jarolim, Akshay S. Desai, Dick de Zeeuw, Kai-Uwe Eckardt, Peter Ivanovich, Andrew S. Levey, Eldrin F. Lewis,
Follow-up of the CUPID Gene Therapy Trials
Follow-up of the CUPID Gene Therapy Trials Roger J. Hajjar, MD Icahn School of Medicine at Mount Sinai New York, NY Pathway to Heart Failure Injury / Damage Mature Dysfunctional Dying New Coronary Disease
SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy
HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes
Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The
In the name of GOD. Animal models of cardiovascular diseases: myocardial infarction & hypertension
In the name of GOD Animal models of cardiovascular diseases: myocardial infarction & hypertension 44 Presentation outline: Cardiovascular diseases Acute myocardial infarction Animal models for myocardial
10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
Supplementary Note Details of the patient populations studied Strengths and weakness of the study
Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined
LabDriver Audit Trail Example
LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009
Strain/Untwisting/Diastolic Suction
What Is Diastole and How to Assess It? Strain/Untwisting/Diastolic Suction James D. Thomas, M.D., F.A.C.C. Cardiovascular Imaging Center Department of Cardiology Cleveland Clinic Foundation Cleveland,
Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES
NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.
Imaging congestive heart failure: role of coronary computed tomography angiography (CCTA)
Imaging congestive heart failure: role of coronary computed tomography angiography (CCTA) Gianluca Pontone, MD, PhD, FESC, FSCCT Director of MR Unit Deputy Director of Cardiovascul CT Unit Clinical Cardiology
CHRONIC HEART FAILURE : WHAT ELSE COULD WE OFFER TO OUR PATIENTS? Cardiac Rehabilitation Society of Thailand
CHRONIC HEART FAILURE : WHAT ELSE COULD WE OFFER TO OUR PATIENTS? Cardiac Rehabilitation Society of Thailand ENHANCED EXTERNAL COUNTER PULSATION Piyanuj Ruckpanich, MD. Cardiac Rehabilitation Center Perfect
S100A1 Genetically Targeted Therapy Reverses Dysfunction of Human Failing Cardiomyocytes
Journal of the American College of Cardiology Vol. 58, No. 9, 2011 2011 by the American College of Cardiology Foundation ISSN 0735-1097/$36.00 Published by Elsevier Inc. doi:10.1016/j.jacc.2011.03.054
Increased de novo ceramide synthesis and accumulation in failing myocardium
Increased de novo ceramide synthesis and accumulation in failing myocardium Ruiping Ji, 1 Hirokazu Akashi, 1 Konstantinos Drosatos, 2 Xianghai Liao, 1 Hongfeng Jiang, 4 Peter J. Kennel, 1 Danielle L. Brunjes,
Treating the patient with acute heart failure. What do we really know? Principles of acute heart failure treatment
ESC 2012 27Aug - 3Sep, 2012, Munich, Germany Treating the patient with acute heart failure. What do we really know? Principles of acute heart failure treatment Marco Metra, MD, FESC Cardiology University
A Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
BC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
Disclosure Information : No conflict of interest
Intravenous nicorandil improves symptoms and left ventricular diastolic function immediately in patients with acute heart failure : a randomized, controlled trial M. Shigekiyo, K. Harada, A. Okada, N.
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
DECLARATION OF CONFLICT OF INTEREST. None
DECLARATION OF CONFLICT OF INTEREST None Controversies on marathon and beyond: Elevated biomarkers as a proof of cardiac damage: Contra Jürgen Scharhag, FACSM, FESC Internal Medicine III: Cardiology, Angiology
Types of target values, acceptable ranges
Types of target values, acceptable ranges As the differential of rounding, maximum 1 percent point deviation is allowed from the maximum acceptable range. 100. Clinical chemistry (wet) 1. Calcium RMV 10
BNP mrna expression in DR and DS rat left ventricles (n = 5). (C) Plasma norepinephrine
Kanazawa, et al. Supplementary figure legends Supplementary Figure 1 DS rats had congestive heart failure. (A) DR and DS rat hearts. (B) QRT-PCR analysis of BNP mrna expression in DR and DS rat left ventricles
How will new high sensitive troponins affect the criteria?
How will new high sensitive troponins affect the criteria? Hugo A Katus MD Abteilung Innere Medizin III Kardiologie, Angiologie, Pulmologie Universitätsklinikum Heidelberg Even more sensitive: The new
COMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
Conflict of Interest Slide
Comparison of six- month clinical outcomes, event free survival rates of patients undergoing enhanced external counterpulsation (EECP) for coronary artery disease in the United States and Europe Ozlem
Dr. Dermot Phelan MB BCh BAO PhD European Society of Cardiology 2012
Relative Apical Sparing of Longitudinal Strain Using 2- Dimensional Speckle-Tracking Echocardiography is Both Sensitive and Specific for the Diagnosis of Cardiac Amyloidosis. Dr. Dermot Phelan MB BCh BAO
Glossary of terms used in IEEM. Hong Kong College of Emergency Medicine March 2013
Glossary of terms used in IEEM Hong Kong College of Emergency Medicine March 2013 The Hong Kong College of Emergency Medicine IEEM uses several terms in examinations that may cause confusion. The following
Clinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
The Who, How and When of Advanced Heart Failure Therapies. Disclosures. What is Advanced Heart Failure?
The Who, How and When of Advanced Heart Failure Therapies 9 th Annual Dartmouth Conference on Advances in Heart Failure Therapies Dartmouth-Hitchcock Medical Center Lebanon, NH May 20, 2013 Joseph G. Rogers,
Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease
Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Xin-Liang Ma, MD, PhD Thomas Jefferson University Philadelphia, PA USA CVD As The #1 Causes of Death In USA Male Female Heart Disease and
Dr. Khairy Abdel Dayem. Professor of Cardiology Ain-Shams University
Dr. Khairy Abdel Dayem Professor of Cardiology Ain-Shams University RALES Randomized Aldactone Evaluation Study 1. NEJM 1999 2. Bertram Pitt 3. 1660 Class III and IV HF patients 4. EF 35% 5. 841 placebo
Qualifying Examination (Part I)
Department of Pharmacology Qualifying Examination (Part I) December 12 & 13, 2006 Please remember that this is a closed-book examination. You must be prepared to answer 4 of the 7 questions. Although not
Antonio Colombo. Centro Cuore Columbus and S. Raffaele Scientific Institute, Milan, Italy. Miracor Symposium. Speaker: 15. Parigi: May 16-19, 2017
Parigi: May 16-19, 2017 Miracor Symposium Speaker: 15 Antonio Colombo Centro Cuore Columbus and S. Raffaele Scientific Institute, Milan, Italy Nothing to disclose PiCSO Impulse System Elective high risk
Department of Cardiovascular Medicine Saga University Mitsuhiro Shimomura
Complex Intervention For Hemodialysis Patient Department of Cardiovascular Medicine Saga University Mitsuhiro Shimomura TCTAP 2012 Case A 77 year old female had been treated with hemodialysis(hd) for chronic
Isolated congenital coronary anomalies: Evaluation by multislice-ct or MRI
Isolated congenital coronary anomalies: Evaluation by multislice-ct or MRI B.K. Velthuis, Dept. of Radiology UMC Utrecht, the Netherlands ESC 2010 Coronary artery anomalies CAA Uncommon 0.3-5% normal population
LXIV: DRUGS: 4. RAS BLOCKADE
LXIV: DRUGS: 4. RAS BLOCKADE ACE Inhibitors Components of RAS Actions of Angiotensin i II Indications for ACEIs Contraindications RAS blockade in hypertension RAS blockade in CAD RAS blockade in HF Limitations
The right heart: the Cinderella of heart failure
The right heart: the Cinderella of heart failure Piotr Ponikowski, MD, PhD, FESC Medical University, Centre for Heart Disease Clinical Military Hospital Wroclaw, Poland none Disclosure Look into the Heart
Does Pharmacological Exercise Mimetics Exist? Hokkaido University Graduate School of Medicine Shintaro Kinugawa
Does Pharmacological Exercise Mimetics Exist? Hokkaido University Graduate School of Medicine Shintaro Kinugawa Survival rate (%) Peak oxygen uptake and prognosis in patients with heart failure (HF) 1
Defining rise and fall of cardiac troponin values
Defining rise and fall of cardiac troponin values Doable but Not Simple Allan S. Jaffe, MD.* Consultant - Cardiology & Laboratory Medicine Professor of Medicine Chair, CCLS Division, Department of Laboratory
Severe Hypertension. Pre-referral considerations: 1. BP of arm and Leg 2. Ambulatory BP 3. Renal causes
Severe Hypertension *Prior to making a referral, call office or Doc Halo, to speak with a Cardiologist or APP to discuss patient and possible treatment options. Please only contact the patient's cardiologist.
1 Week Followup - Intermacs
version date: 9/27/2017 1 Week Followup - Intermacs Followup Status (1 Week Followup (+/- 3 days)) Select one of the following Inpatient Outpatient Other Facility Unable to obtain follow-up information
1 Week Followup 5/27/2014. Nursing Home/Assisted Care Hospice Another hospital Rehabilitation Facility Unknown
1 Week Followup t Started Please answer all questions considering all time since the previous visit and current follow-up date. Print this Form Followup Status t Started Select one of the following Inpatient
Radiologic Assessment of Myocardial Viability
November 2001 Radiologic Assessment of Myocardial Viability Joshua Moss, Harvard Medical School Year III Patient EF 66yo female with a 3-year history of intermittent chest pain previously relieved by sublingual
Intermittent pressure overload triggers hypertrophy-independent cardiac dysfunction and vascular rarefaction
Related Commentary, page 1467 Research article Intermittent pressure overload triggers hypertrophy-independent cardiac dysfunction and vascular rarefaction Cinzia Perrino, 1 Sathyamangla V. Naga Prasad,
J Jpn Coll Angiol, 2009, 49:
Online publication October 6, 2009 48 2 20 J Jpn Coll Angiol, 2009, 49: 293 297 atrial natriuretic peptide, brain natriuretic peptide, guanylyl cyclase-a receptor, cardiac remodeling, cardiac hypertrophy
Alcohol Septal Ablation for Hypertrophic Obstructive Cardiomyopathy. CardioVascular Research Foundation
Alcohol Septal Ablation for Hypertrophic Obstructive Cardiomyopathy Alcohol Septal Ablation (ASA) Nonsurgical technique for septal myocardial reduction Dramatic hemodynamic improvement Technically easy
Biochemistry Adult Reference Ranges
Certified correct on 28/06/2016 Biochemistry Adult Reference Ranges Test Reference range Units Reference range from Traceable to standard reference material Albumin 35 50 g/l Pathology IRMM ERM-DA470k/IFCC
Exercise ECG (TMT) is a commonly used investigation in the
Journal of the association of physicians of india july 2013 VOL. 61 65 Case Reports The Common, Less Common and Uncommon Examples of Exercise ECG MJ Jacob *, Puneet Kumar +, Mudalsha Ravina +, Amrita Tiwari
Inspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
Intravenous Inotropic Support an Overview
Intravenous Inotropic Support an Overview Shaul Atar, MD Western Galilee Medical Center, Nahariya Affiliated with the Faculty of Medicine of the Galilee, Safed, Israel INOTROPES in Acute HF (not vasopressors)
NOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
Diastolic Heart Failure. Edwin Tulloch-Reid MBBS FACC Consultant Cardiologist Heart Institute of the Caribbean December 2012
Diastolic Heart Failure Edwin Tulloch-Reid MBBS FACC Consultant Cardiologist Heart Institute of the Caribbean December 2012 Disclosures Have spoken for Merck, Sharpe and Dohme Sat on a physician advisory
RT-100 technical summary (as of March 2015) Table of contents
RT-100 technical summary (as of March 2015) Table of contents 1. Major unmet clinical need 2. Gene therapy 3. Adenylyl cyclase and heart failure 4. Clinical congestive heart failure 5. lntracoronary adenovirus
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity
Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity Yuhee Ryu 1,+, Li Jin 1,2+, Hae Jin Kee 1,, Zhe Hao Piao 3, Jae
Volume 3 (2017) Issue 23 ISSN Abstract. Keywords. Learning Objective. Introduction. Open Journal of Clinical & Medical Case Reports
Open Journal of Clinical & Medical Case Reports Volume 3 (2017) Issue 23 ISSN 2379-1039 Severe pulmonary hypertension secondary to anagrelide treatment? George Calcaianu*; Mihaela Calcaianu; Guillaume
What is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such
SUPPLEMENTARY RESULTS
SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7
Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure
Genetic ablation of Acp1 (Lmptp) in mice prevents heart failure Coralie Poizat, Ph.D. Director, Cardiovascular Research Program KFSHRC-Riyadh Saudi Heart Failure Working Group Jeddah, 5 December 2015 Cardiovascular
Serodos and Serodos plus
Design Verification Serodos and Serodos plus Contents 1 Value Adjustment... 2 2 Target Determination... 2 3 Stability... 2 Real-Time Stability... 3 Stability after Reconstitution... 4 Stability after Reconstitution
BC Cancer Protocol Summary for Therapy of Acute Myeloid Leukemia Using azacitidine and SORAfenib
BC Cancer Protocol Summary for Therapy of Acute Myeloid Leukemia Using azacitidine and SORAfenib Protocol Code Tumour Group Contact Physician ULKAMLAS Leukemia/BMT Dr. Donna Hogge ELIGIBILITY: Acute myeloid
Percutaneous Mitral Valve Repair
Percutaneous Mitral Valve Repair MitraClip: Procedure, Data, Patient Selection Chad Rammohan, MD FACC Director, Cardiac Cath Lab El Camino Hospital Mountain View, California Mitral Regurgitation MitraClip
The Heart in Concert: Do Other Organs Matter? The Liver
The Heart in Concert: Do Other Organs Matter? The Liver Pascal de Groote CHRU Lille France DECLARATION OF CONFLICT OF INTEREST I have no conflict of interest with this presentation Impact of liver disease