Transport of the outer dynein arm complex to cilia requires a cytoplasmic protein Lrrc6

Transcription

1 Genes to Cells Transport of the outer dynein arm complex to cilia requires a cytoplasmic protein Lrrc6 Yasuko Inaba 1, Kyosuke Shinohara 1a, Yanick Botilde 1, Ryo Nabeshima 1, Katsuyoshi Takaoka 1, Rieko Ajima 1b, Lynda Lamri 1, Hiroyuki Takeda 2, Yumiko Saga 3, Tetsuya Nakamura 1c and Hiroshi Hamada 1 * 1 Developmental Genetics Group, Graduate School of Frontier Biosciences, Osaka University, and CREST, Japan Science and Technology Corporation (JST), 1-3 Yamada-oka, Suita, Osaka , Japan 2 Department of Biological Sciences, Graduate School of Science, University of Tokyo, Hongo, Bunkyo-ku, Tokyo , Japan 3 Division of Mammalian Development, Genetic Strains Research Center, National Institute of Genetics, Yata 1111, Mishima, Shizuoka , Japan Lrrc6 encodes a cytoplasmic protein that is expressed specifically in cells with motile cilia including the node, trachea and testes of the mice. A mutation of Lrrc6 has been identified in human patients with primary ciliary dyskinesia (PCD). Mutant mice lacking Lrrc6 show typical PCD defects such as hydrocephalus and laterality defects. We found that in the absence of Lrrc6, the morphology of motile cilia remained normal, but their motility was completely lost. The arrangement of microtubules remained normal in Lrrc6 -/- mice, but the outer dynein arms (ODAs), the structures essential for the ciliary beating, were absent from the cilia. In the absence of Lrrc6, ODA proteins such as DNAH5, DNAH9 and IC2, which are assembled in the cytoplasm and transported to the ciliary axoneme, remained in the cytoplasm and were not transported to the ciliary axoneme. The IC2 IC1 interaction, which is the first step of ODA assembly, was normal in Lrrc6 / mice testes. Our results suggest that ODA proteins may be transported from the cytoplasm to the cilia by an Lrrc6- dependent mechanism. Introduction Cilia are hairlike organelles present in nearly all cell types. There are two types of mammalian cilia: motile and nonmotile cilia (also known as primary cilia). Motile cilia are found in the trachea, oviduct, sperm and brain. They have a characteristic structure with nine peripheral microtubule doublets arranged around a central pair of microtubules. In motile cilia, dynein complexes outer dynein arms (ODAs) and inner dynein arms (IDAs) are attached to the Communicated by: Hisato Kondoh *Correspondence: hamada@fbs.osaka-u.ac.jp a Present address: Institute of Engineering, Tokyo University of Agriculture and Technology, Koganei, Tokyo , Japan b Present address: National Institute of Genetics, Yata 1111, Mishima, Shizuoka , Japan c Present address: Department of Organismal Biology and Anatomy, University of Chicago, Chicago, IL 60637, USA peripheral microtubule doublets. However, primary cilia structurally lack the central pair of microtubules (9 + 0). However, some primary cilia with a arrangement such as the cilia present in the mouse embryonic node are exceptionally motile (Nonaka et al. 2002; Ishikawa and Marshall, 2011). The nodal cilia play a critical role in left right patterning (Hirokawa et al. 2009). Cilia mediate diverse functions in signaling and fluid dynamics. Nonmotile cilia are implicated in sensing environmental cues. They act as sensory antennae that receive signals from the outside of cells. Motile cilia are involved in the movement of extracellular fluids. In the respiratory tract, for example, motile cilia are responsible for mucociliary clearance of external pathogens. Defects in the structure and function of motile cilia result in primary ciliary dyskinesia (PCD, OMIM242650), a disorder characterized by recurrent respiratory infections and male infertility. 728 Genes to Cells (2016) 21, DOI: /gtc Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd

2 Transport of dynein to cilia Outer dynein arms (ODAs) and inner dynein arms (IDAs) are essential structures for cilia motility. ODAs hydrolyze ATP to power ciliary movement, whereas IDAs regulate the ciliary beating pattern. ODAs and IDAs are composed of many proteins including heavy (HC)-, light (LC)- and intermediate-chain (IC) proteins. ODA complexes are preassembled in the cytoplasm before being transported into cilia (Fowkes & Mitchell 1998). Assembly of ODA complexes has been extensively studied in Chlamydomonas. Cytoplasmic preassembly of ODA complexes has been found to require at least two steps. The first step involves the folding of globular dynein head domains that are required for HCs stability. The second step involves the formation of assembled complex between HCs and intermediate chains (ICs) (Mitchison et al. 2012). ODA assembly factors are known as dynein axonemal assembly factors (DNAAFs) and currently include four proteins: ODA7 (also known as DNAAF1 or LRRC50) (Loges et al. 2009), PF13 (also known as DNAAF2 or Ktu) (Omran et al. 2008), PF22 (also known as DNAAF3) (Mitchison et al. 2012) and DNAAF4 (also known as DYX1C1) (Tarkar et al. 2013). DNAAF1 4 work together with heat-shock protein (HSP)-based molecular chaperone to direct the proper folding of ODA subunits. Additional proteins including ZMYND10, HEATR2, C21orf59, SPAG1 and Pih1d3 may also be involved in ODA assembly. Like DNAAF1 4, these proteins are localized in the cytoplasm and mutations in each of these genes leads to ODA deficiency (Austin-Tse et al. 2013; Knowles et al. 2013; Zariwala et al. 2013; Diggle et al. 2014; Dong et al. 2014). However, the precise function of these proteins is not well understood. A mutagenesis screen in zebrafish identified Lrrc6/Seahorse as a gene responsible for cystic kidney (Sun et al. 2004). Lrrc6 encodes a coiled-coil domain containing protein. Lrrc6 mutant zebrafish showed aberrant left right (LR) patterning (Kishimoto et al. 2008), suggesting that Lrrc6 is involved in the regulation of cilia-mediated processes. Recent report (Zariwala et al. 2013) showed that Lrrc6 interacts with reptin in zebrafish and Zmynd10 in mice. Reptin is involved in epigenetic and transcriptional regulation (Zhao et al. 2013), whereas Zmynd10 is one of the dynein arm assembly factor (Zariwala et al. 2013). However, the precise function of Lrrc6 remains to be elucidated. To understand the function of Lrrc6, we generated and analyzed mutant mouse lacking Lrrc6. Results Lrrc6 is specifically expressed in cells with motile cilia We first examined Lrrc6 expression using a BAC transgene (Lrrc6-lacZ), in which IRES-lacZ was inserted after the stop codon of an Lrrc6 BAC clone. At the embryonic day 8.0 (E8.0), Lrrc6 was expressed at the node (Fig. 1A,B), especially in pit cells, which are located at the central region of the node and possess motile cilia (Fig. 1C). At later stages, Lrrc6 expression was detected in the notochord at E9.0 (Fig. 1D), in the hindbrain, the branchial arches and neural tube at E11.0 (Fig. 1E), in the hindbrain at E12.0 (Fig. 1F) and in the forebrain at E13.0 (Fig. 1G). In adult, Lrrc6 was found to be expressed in epithelial cells of the trachea (Fig. 1H), testis (Fig. 1I) and ependymal cells of the cerebral ventricles (Fig. 1J), all of which are known to possess motile cilia. Lrrc6 expression was not detected in other cell types, including those with immotile cilia. In all, Lrrc6 expression was mainly expressed in cells with motile cilia. Lrrc6 is required for the motility of various motile cilia To investigate Lrrc6 function, we generated an Lrrc6 mutant mouse (Fig. S1 in Supporting Information) Figure 1 Expression of Lrrc6 in cells that have motile cilia. (A-C) E8.0 transgenic embryos harboring Lrrc6-lacZ were stained with X-gal. (A) Lateral view and (B) posterior view. The arrowhead indicates the node in (A). (C) Transverse section of the node. The expression of Lrrc6-lacZ is highly specific to node pit cells. (D J) Lrrc6-lacZ expression at later stages. Lrrc6-lacZ expression was detected in the notochord at E9.0 (D) (indicated by the arrowhead), in the hindbrain (indicated by the black arrowhead), branchial arches (indicated by the blue arrowhead) and neural tube (indicated by the arrow) at E11.0 (E), in the hindbrain (indicated by the arrowhead) at E12.0 (F), and in the fore brain (indicated by the arrowhead) at E13.0 (G). X-gal staining of trachea (H), testis (I) and brain (J) of adult Lrrc6-lacZ mouse. (H, I) Pictures of whole-mount staining are shown in the left panels and of section staining are shown in the right panel. Lrrc6-lacZ expression is observed in multiciliated epithelial cells of the trachea (H) and in seminiferous tube of testis (I). (J) Coronal sections of adult brains showing expression of Lrrc6-lacZ in the lateral ventricle (indicated by the arrowhead) Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd Genes to Cells (2016) 21,

3 Y Inaba et al. (A) (B) (C) (F) (G) (D) (E) (H) (I) (J) 730 Genes to Cells (2016) 21, Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd

4 Transport of dynein to cilia and examined its phenotype. Lrrc6 protein was absent in the trachea of Lrrc6 / mice (Fig. S1E in Supporting Information), suggesting that Lrrc6 is a null allele. Upon intercrosses of Lrrc6 +/ mice, Lrrc6 / embryos were detected at the expected frequency at E8.0. However, Lrrc6 / mice were found at a lower frequency at birth, suggesting that a significant portion (approximately 60%) of Lrrc6 / mice die in utero. Mutant newborn mice showed laterality defects (6/6 newborn mice) with variable severities. Thus, some of them (2/6) showed reversal of the heart apex, stomach, aortic arch and azygos vein, whereas others showed less severe defects with abnormal liver lobation (Table S1 in Supporting Information). Surviving mutant mice (6/6 mice) developed hydrocephalus 3 weeks after the birth, and all Lrrc6 / mice eventually died within 5 weeks of birth. Laterality defects in the Lrrc6 / mice prompted us to examine Nodal expression at E8.0. Nodal expression was found exclusively on the left side of the lateral plate in the wild-type (WT) embryos. In the Lrrc6 / embryos, however, Nodal expression was randomized so that it was found either on the left (3/9 embryos), right (1/9 embryos) or both (2/9 embryos) side(s) or was absent (3/9 embryos) (Fig. 2J). These defects, typical of patients with PCD and PCD animals, suggest that ciliary motility may be impaired in the Lrrc6 / mice. This was indeed the case. Node cilia, which rotate into the clockwise direction in the WT embryos (Movie S1 in Supporting Information), were completely immotile in the Lrrc6 / mice (Fig. 3A; Movie S2 in Supporting Information). The cilia of trachea epithelial cells and brain ependymal cells, which show planar beating in WT mice (Movie S3 and S5 in Supporting Information), also lost motility in the Lrrc6 / mice (Fig. 3A; Movie S4 and S6 in Supporting Information). Finally, Lrrc6 was specifically deleted from male germ cells using Nanos3-Cre (Suzuki et al. 2008). Sperm obtained from the testis-specific Lrrc6 knockout (Lrrc6 f/f ;Nanos3 Cre/+ ) mouse were completely immotile (Fig. 3A; Movie S8 in Supporting Information). Thus, all types of the motile cilia that were examined lost motility in the absence of Lrrc6. Lrrc6 is essential for transporting the ODA complex from the cytoplasm to the cilia To understand why ciliary motility was lost in the absence of Lrrc6, we examined the ultrastructure of trachea cilia by transmission electron microscopy (TEM). In the WT trachea cilia, their inner structure showed microtubules containing nine peripheral doublet microtubules and two central microtubules (Fig. 3B). Peripheral microtubules contained outer and inner dynein arms (Fig. 3B), which are essential for ciliary motility. In the trachea cilia of the Lrrc6 / mice, the configuration of the microtubules remained normal, but ODAs were absent (Fig. 3B). We next examined the subcellular distribution of ODA proteins in airway epithelial cells by immunostaining. In the WT mouse, DNAH5 and DNAH9 proteins were specifically expressed in the multiciliated cells and, these proteins were localized exclusively to the ciliary axoneme (Fig. 4A,B). In the Lrrc6 / mice, however, both DNAH5 and DNAH9 were absent from the cilia but were detected in the cytoplasm as punctuated spots (Fig. 4A,B). IC2 protein was also expressed specifically in the multiciliated cells, and was localized predominantly in the ciliary axoneme in the WT mice (Fig. 4C). In the Lrrc6 / mice, however, IC2 was absent from the cilia and instead was diffusely distributed throughout the cytoplasm (Fig. 4C). These results suggest that ODA proteins are not transported to the ciliary axoneme in the absence of Lrrc6. Lrrc6 is a cytoplasmic protein, but assembly of the IC1 IC2 complex does not require Lrrc6 To investigate subcellular localization of Lrrc6 protein in cells with motile cilia, we generated a BAC Figure 2 Primary ciliary dyskinesia in Lrrc6 / mice. (A-D) Laterality of visceral organs in Lrrc6 +/+ (A, B) and Lrrc6 / (C, D) mice at P0. The position of the heart apex in Lrrc6 +/+ mouse is located on the left (A), but it is reversed in Lrrc6 / mice (C). The stomach is located in the left side in Lrrc6 +/+ mouse (B), but it is on the right side in the Lrrc6 / mouse (D, arrow). (E, F) Lrrc6 +/+ (E) and Lrrc6 / (F) mice at P21. Compared to Lrrc6 +/+ mouse, Lrrc6 / mouse shows domed crown head (indicated by the arrow in F). (G, H) Dorsal (G) and coronal (H) views of the brain of Lrrc6 +/+ and Lrrc6 / mice. Lrrc6 / brains show significant deformation with collapsed cortices. (I) Whole-mount in situ hybridization of Nodal in E8.0 Lrrc6 +/+ and Lrrc6 / embryos. The black arrows indicate left lateral plate mesoderm (LPM). The blue arrows indicate aberrant expression in right LPM. (J) The numbers of embryos showing each pattern of gene expression are summarized. L, left; R, right Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd Genes to Cells (2016) 21,

5 Y Inaba et al. (A) (B) (E) (C) (D) (F) (G) (H) (I) (J) 732 Genes to Cells (2016) 21, Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd

6 Transport of dynein to cilia (A) Node Brain Sperm Lrrc6 / Lrrc6 +/+ Trachea Lrrc6 / Lrrc6 +/+ (B) Lrrc6 +/+ Lrrc6 / Figure 3 Motile cilia lose motility in the absence of Lrrc6. (A) Movement of cilia in the node, brain ependymal cells and trachea of Lrrc6 +/+ and Lrrc6 / mice was traced with TEMA software. Sperm motility was examined with Lrrc6 +/+ and Lrrc6 f/f ; Nanos3 Cre/+ mice. Colored lines (red, light blue and blue) indicate the movement of individual cilia. (B) Transmission electron microscope (TEM) images of tracheal cilia from Lrrc6 +/+ and Lrrc6 / mice. ODA in tracheal cilia from the Lrrc6 +/+ mouse is indicated by the red arrowhead, whereas those from the Lrrc6 / mouse lacked ODAs (indicated by the white arrowhead). Scale bars: 100 nm Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd Genes to Cells (2016) 21,

7 Y Inaba et al. transgenic mouse that expressed an Lrrc6::Venus fusion protein (Venus is a version of yellow fluorescent protein) (Fig. S2 in Supporting Information). This fusion protein was fully functional because it was able to rescue lethality of Lrrc6 / mouse (Fig. S2 in Supporting Information). In the node cells of E8.0 embryos harboring this transgene, the Lrrc6::Venus protein was localized only in the cytoplasm, whereas it was not detected in the axoneme (Ift46 + region) of the node cilia (Fig. 5A,B). Similarly, the Lrrc6::Venus protein was localized to the cytoplasm of airway epithelial cells, in particular to the apical side of the cytoplasm (Fig. 5C,D). However, the Lrrc6::Venus protein was not detected in the ciliary axoneme, which was positive for acetylated tubulin (Fig. 5C,D). Finally, we also examined the Lrrc6::Venus protein in the testes. The Lrrc6::Venus protein was expressed in germ cells ranging from primary spermatocytes and spermatids, and its subcellular localization was again restricted to the cytoplasm (Fig. 5E,F). Cytoplasmic localization of the Lrrc6 protein and the absence of ODA in the axoneme of Lrrc6 / motile cilia suggest that this protein acts in the cytoplasm, and may be involved in a process such as cytoplasmic preassembly of the ODAs or transport of ODA complex from the cytoplasm to the ciliary axoneme. ODAs are assembled in the cytoplasm through several steps by DNAAFs. The IC1 IC2 complex is formed first followed by HC IC complex formation. In the testes lacking Lrrc6 (testes from the Lrrc6 f/ ; Nanos3 Cre/+ mice), the level of IC2 was reduced (Fig. 6). However, interaction between IC1 and IC2 remained normal (Fig. 6), suggesting that the IC1 IC2 complex formation, the first step of ODA assembly, does not require Lrrc6. Discussion ODA proteins are preassembled in the cytoplasm and are subsequently transported to the ciliary axoneme. Several proteins, collectively called DNAAFs, are required for cytoplasmic preassembly of the ODA complex. The cytoplasmic assembly of ODA is achieved through multiple steps. The first step is the folding of the head domain of the dynein heavy chain by DNAAF1/Lrrc50, DNAAF2/PF13 and Hsp70. This is followed by formation of a stable IC1 IC2 complex, which involves Pih1d3 in sperm (Dong et al. 2014). Finally, the IC HC (heavy chain) complex is formed via DNAAF3. Whereas the mechanism of ODA preassembly is becoming clear, it is totally unknown how assembled ODA complex is transported from the cytoplasm to the cilia. Although our current data do not clarify whether Lrrc6 is involved in the preassembly or transport, several lines of evidence suggest that Lrrc6 is more likely involved in the transport of the preassembled ODA complex to the axoneme. First, the interaction between IC1 and IC2 remained normal in the Lrrc6 / testes, suggesting that the early step of preassembly does not require Lrrc6. Furthermore, Lrrc6::Venus expression in the testes was found mainly between the spermatocyte and spermatid stages, which is later than the stage for expression of Pih1d3, one of the cytoplasmic DNAAF proteins required for the stability of the IC1 IC2 complex in the testes (Dong et al. 2014). Second, ODA proteins are not transported if cytoplasmic preassembly is impaired. Thus, in airway epithelial cells in human patients with PCD lacking DNAAF, ODA proteins are absent in the ciliary axoneme (Loges et al. 2009; Mitchison et al. 2012; Panizzi et al. 2012; Tarkar et al. 2013). However, these proteins are often absent in the cytoplasm, probably because unassembled ODA proteins undergo rapid degradation. For example, DNAH5 and DNAH9 are absent when DNAAF1 is mutated (Loges et al. 2009); and DNAH9 is absent in respiratory cells with DNAAF4 mutations (Tarkar et al. 2013). In Lrrc6 / trachea, however, DNAH5, DNAH9 and IC2 proteins remained in the cytoplasm. In particular, there was no sign of IC2 degradation in the Lrrc6 mutant cells, as the level of cytoplasmic IC2 protein was maintained or even increased in the Lrrc6 / airway cells (Fig. 4C). However, a low level of DNAH5 protein was detected in the cytoplasm of airway cells from some patients with PCD, such as a patient with a mutation in DNAAF4 (Tarkar et al. 2013), suggesting that the fate of ODA proteins in patients with PCD may depend on individual mutations. In all, our data suggest that Lrrc6 may be required for the transport of the ODA complex to the axoneme, but Lrrc6 may also be involved in cytoplasmic preassembly of ODA proteins. A significant portion of Lrrc6 / mice die before birth (between E13.5 and E18.5), but the exact cause of embryonic lethality is unknown. Randomization of LR asymmetry at E8.0 would account for the death at the newborn stage, but not for the embryonic lethality. Interestingly, whereas Lrrc6 was expressed in cells with motile cilia, it was also expressed in the branchial arch of E11.0 embryos (Fig. 1E), which do not have motile cilia. In this regard, Lrrc6 may have an additional function 734 Genes to Cells (2016) 21, Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd

8 Transport of dynein to cilia (A) (B) (C) 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd Genes to Cells (2016) 21,

9 Y Inaba et al. Figure 4 Cilia of Lrrc6 / trachea epithelial cells lack ODA proteins. (A-C) Immunofluorescence analysis of trachea epithelial cells at P14 in Lrrc6 +/+ and Lrrc6 / mice. Acetylated a-tubulin (red); DAPI (blue). ODA heavy-chain proteins DNAH5 (A) and DNAH9 (B) are localized in cilia of the Lrrc6 +/+ airway cells, but both proteins were absent from cilia of Lrrc6 / airway cells. Note that both proteins remained localized in the cytoplasm as punctuated spots (indicated by arrows) in the Lrrc6 / airway cells. ODA intermediate-chain protein DNAIC2 (C) was mainly localized in the cilia of Lrrc6 +/+ airway cells, whereas DNAIC2 was absent from cilia but remained in the cytoplasm of Lrrc6 / airway cells. Note that the level of cytoplasmic DNAIC2 was increased in some of the Lrrc6 / airway cells (white arrowheads). Scale bars: 5 lm. unrelated to ciliary motility. For example, Lrrc6 may be involved in intracellular transport of some other proteins in nonciliated cell. In conclusion, whereas our data suggest that ODA may be transported to the cilia by an Lrrc6-dependent mechanism, the precise mechanism of ODA transport from the cytoplasm to cilia and the exact role of Lrrc6 require further investigation. Experimental procedures Mice The targeting vector for Lrrc6 was constructed with bacterial artificial chromosome (BAC) clone RP24-333G17. A single loxp site was inserted 200 bp upstream of exon 1 of Lrrc6 gene. The Frt-Pgk-neo-Frt-loxP cassette was inserted 100 bp downstream of the exon 1. The construct was introduced into G4 mouse embryonic stem (ES) cells (C57BL/6 and 129/Sv hybrid). After selection of transformed clones with G418, homologous recombinants were detected by Southern blot hybridization with a specific two probes, external and internal probes. Chimeric mice were generated by aggregation of ES clones with ICR morulas. Null allele was generated by cross with CAG-Cre or CAG-Flp transgenic mice, to remove Lrrc6 exon 1 and the neo cassette. PCR primers for the Lrrc6 + allele were Lrrc6-WT-F (AGCTCAGACATAAGCTCCCAAG) and Lrrc6-WT-R (GACAGCACTGGCAATATCTCTG), whereas PCR primers for Lrrc6 allele were Lrrc6-Mut-F (TGCCAGTGGGTGTAAGTAAGG) and Lrrc6-Mut-R (CACATCGCTTTGAGGACAGTT). To generate Lrrc6:: Venus BAC transgene, the Venus-coding sequence was inserted before the stop codon of Lrrc6 in BAC clone RP24-333G17. To generate Lrrc6-lacZ transgene, the IRES-lacZ cassette was inserted after the stop codon of Lrrc6 in the same BAC clone. X- gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside) staining was carried out as described previously (Saijoh et al. 1999). Serial sections (10 lm) of trachea, testis and brain were prepared after X-gal staining. All animal experiments were approved by the animal experiment committee of Osaka University. Whole-mount in situ hybridization Whole-mount in situ hybridization was carried out according to standard procedures specific with digoxigenin-labeled riboprobes for Nodal. Antibodies Polyclonal antibodies that recognize a COOH-terminal sequence (QPRDEPSEEDPDFEDNPEV) of mouse Lrrc6 were recovered from a corresponding antigen injected rabbit and purified by affinity chromatography (Immuno-Biological Laboratories). Additional antibodies used in this study are rabbit anti-ift46 (Abcam, ab122422), rabbit anti-gfp (MBL, 598), rat anti-gfp (Nacalai, ), mouse anti-acetylated tubulin (SIGMA, T6793) and mouse anti-ic2 (Abnova, H MO1). DNAH5 and DNAH9 antibodies have been described previously (Matsuo et al. 2013). Immunofluorescence staining E8.0 embryos were collected and fixed in 4% PFA for 1 h at 4 C. The embryos were then dehydrated in methanol, blocked with blocking solution for 1 h at 4 C, incubated overnight at 4 C with primary antibodies diluted in the blocking solution, washed for 6 h with phosphate-buffered saline (PBS) containing 0.1% Triton X-100, incubated overnight at 4 C with secondary antibodies diluted in the blocking solution and washed. Node of stained embryos was excised and placed to slide glasses with silicone rubber spacers, covered with cover glasses and observed with an Olympus FV1000 confocal microscope. Trachea were collected and cut longitudinally in ice-cold PBS and fixed in 4% PFA for 1 h at 4 C. They were then permeabilized with 1% Triton X-100 in PBS for 10 min at 4 C, blocked with blocking solution 1 h at 4 C, and then incubated overnight at 4 C with primary antibodies diluted in the blocking solution, washed with PBS containing 0.1% Triton X-100, incubated overnight at 4 C with secondary antibodies diluted in the blocking solution and washed. The samples were placed on a slide glasses with silicone rubber spacers, covered with cover glasses and observed with an Olympus FV1000 confocal microscope. Testis were collected and fixed in 4% PFA for 24 h at 4 C and then mounted in OCT compound and sectioned into 15-lm slices. They were treated in the same way as tracheal samples. Western blotting Testis and trachea samples from adult mice were lysed in the lysis buffer (50 mm Tris-HCl, 150 mm NaCl, 5 mm MgCl2, 0.2% NP-40 and 19 protease inhibitor), homogenized using Dounce Tissue Grinder (WHEATON ) and incubated 736 Genes to Cells (2016) 21, Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd

10 Transport of dynein to cilia (A) (B) (C) (D) (E) (G) (F) (H) 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd Genes to Cells (2016) 21,

11 Y Inaba et al. Figure 5 Lrrc6 is a cytoplasmic protein. (A, B) The node from Lrrc6::Venus Tg + or Tg mouse was immunostained for Ift46 (red) and GFP (green). The node was also stained with DAPI (blue). (C-H) The trachea (C, D) and testis (E-H) from Lrrc6::Venus Tg + and Tg mice were stained for acetylated tubulin (red), GFP (green) and DAPI (blue). The boxed regions (E, F) are shown at higher magnification (G, H). Note that GFP signals were detected in the cytoplasm in all cases examined: node, epithelial cells of trachea and seminiferous tube of testis from Lrrc6::Venus Tg + mouse. Scale bars: 10 lm (A D) and 50 lm (E H). were added to 20 ll of Dynabeads protein G diluted in 1 ml IP buffer and incubated with rotation for 3 h at 4 C to make antibody-coupled beads. In the meantime, protein samples from testis extracts were also incubated with Dynabeads to reduce nonspecific binding. After 3 h, protein samples were incubated with anti-ic2/mouse IgG beads for 3 h at 4 C and then washed briefly two times with IP buffer and three times for 10 min each with rotation at 4 C. Immunoprecipitates were eluted using 50 ll of19 SDS buffer after 30 min of incubation at 37 C water bath. Transmission electron microscopy (TEM) Figure 6 IC1 and IC2 are normally assembled in Lrrc6 f/ ; Nanos3 Cre/+ testis. Testis extracts were prepared from adult Lrrc6 +/+, Lrrc6 f/ and Lrrc6 f/ ;Nanos3 Cre/+ mice. The extracts were subjected to immunoprecipitation with either mouse anti-ic2 antibody or control mouse immunoglobulin G (migg). The immunoprecipitated samples were subjected to Western blot analysis using an anti-ic1 antibody or an anti-ic2 antibody. Testis extracts (input) were subjected to Western blot analysis using anti-ic2, IC1, Lrrc6 and Hsp70 (loading control) antibodies. on ice for 30 min. Lysates were centrifuged at g for 10 min at 4 C, and the supernatant was used for Western blotting and immunoprecipitation assays. Total protein concentration was measured using BCA Protein Assay Kit (Thermo #23224). Motility of cilia Motility of cilia was examined (100 frames/second for node cilia and sperm, 500 frames/second for airway cilia and brain ependymal cilia) with a high-speed CMOS camera (HAS- 500M, Detect). Motion pattern of cilia was traced with TEMA software. Immunoprecipitation and interaction protein Testes were used for immunoprecipitation of IC2 antibody. Dynabeads protein G was washed three times with IP buffer (50 mm Tris-HCl, 150 mm NaCl, 5 mm MgCl 2, 0.2% NP- 40). Anti-IC2 (5 lg) and mouse control IgG (5 lg) antibodies E8.0 embryos and trachea from 3-week-old mice were fixed overnight with 2% PFA, 2.5% glutaraldehyde and 0.1% tannic acid in 0.1M cacodylate buffer. They were then washed with 8% sucrose in 0.1M cacodylate buffer, fixed with 2% osmium tetroxide for 1 h at room temperature and blocked with 0.5% uranyl acetate. They were dehydrated with ethanol, incubated in QY-1 (Okenshoji, #50751) and embedded in epoxy resin. The area of interest was selected by observation of semithin (1 lm) sections stained with 1% methylene blue. Ultrathin (80 nm) sections were then prepared with a diamond knife and dried on 100-lm grid meshes. These sections were stained with 2% uranyl acetate and 3% lead citrate solution and then observed with a transmission electron microscope (JEM-1200 EX; JEOL). Acknowledgements We thank Y. Ikawa and H. Nishimura for technical assistance. This work was supported by a grant from CREST (Core Research for Evolutional Science and Technology) of the Japan Science and Technology Corporation as well as by a Grant-in- Aid from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (Project No. 13J04993 and ). Y.I. was supported by a fellowship from the Japan Society for the Promotion of Science for Japanese Junior Scientists. References Austin-Tse, C., Halbritter, J., Zariwala, M.A. et al. (2013) Zebrafish ciliopathy screen plus human mutational analysis identifies C21orf59 and CCDC65 defects as causing primary ciliary dyskinesia. Am. J. Hum. Genet. 93, Diggle, C.P., Moore, D.J. & Mill, P. (2014) HEATR2 Plays a Conserved Role in Assembly of the Ciliary Motile Apparatus. PLoS Genet. 10, Genes to Cells (2016) 21, Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd

12 Transport of dynein to cilia Dong, F., Shinohara, K., Botilde, Y., Nabeshima, R., Asai, Y., Fukumoto, A., Hasegawa, T., Matsuo, M., Takeda, H., Shiratori, H., Nakamura, T. & Hamada, H. (2014) Pih1d3 is required for cytoplasmic preassembly of axonemal dynein in mouse sperm. J. Cell Biol. 204, Fowkes, M.E. & Mitchell, D.R. (1998) The role of preassembled cytoplasmic complexes in assembly of flagellar dynein subunits. Mol. Biol. Cell 9, Hirokawa, N., Tanaka, Y. & Okada, Y. (2009) Left-right determination: involvement of molecular motor KIF3, cilia, and nodal flow. Cold Spring Harb. Perspect. Biol. 1, a Ishikawa & Marshall (2011) Ciliogenesis: building the cell s antenna. Nat. Rev. Mol. Cell Biol. 12, Kishimoto, N., Cao, Y., Park, A. & Sun, Z. (2008) Cystic kidney gene seahorse regulates cilia-mediated processes and Wnt pathways. Dev. Cell 14, Knowles, M.R., Ostrowski, L.E., Loges, N.T. et al. (2013) Mutations in SPAG1 cause primary ciliary dyskinesia associated with defective outer and inner dynein arms. Am. J. Physiol. Lung Cell. Mol. Physiol. 304, L736 L745. Loges, N.T., Olbrich, H., Becker-Heck, A. et al. (2009) Deletions and point mutations of LRRC50 cause primary ciliary dyskinesia due to dynein arm defects. Am. J. Hum. Genet. 85, Matsuo, M., Shimada, A., Koshida, S., Saga, Y. & Takeda, H. (2013) The establishment of rotational polarity in the airway and ependymal cilia. Am. J. Physiol. 304, L736 L745. Mitchison, H.M., Schmidts, M., Loges, N.T. et al. (2012) Mutations in axonemal dynein assembly factor DNAAF3 cause primary ciliary dyskinesia. Nat. Genet. 44, Nonaka, S., Shiratori, H., Saijoh, Y. & Hamada, H. (2002) Determination of left-right patterning of the mouse embryo by artificial nodal flow. Nature 418, Omran, H., Kobayashi, D., Olbrich, H. et al. (2008) Ktu/ PF13 is required for cytoplasmic pre-assembly of axonemal dyneins. Nature 456, Panizzi, J.R., Becker-Heck, A., Castleman, V.H., et al. (2012) CCDC103 mutations cause primary ciliary dyskinesia by disrupting assembly of ciliary dynein arms. Nat. Genet. 44, Saijoh, Y., Adachi, H., Mochida, K., Ohishi, S., Hirao, A. & Hamada, H. (1999) Distinct transcriptional regulatory mechanisms underlie left-right asymmetric expression of lefty-1 and lefty-2. Genes Dev. 13, Sun, Z., Amsterdam, A., Pazour, G.J., Cole, D.G., Miller, M.S. & Hopkins, N. (2004) A genetic screen in zebrafish identifies cilia genes as a principal cause of cystic kidney. Development 131, Suzuki, H., Tsuda, M., Kiso, M. & Saga, Y. (2008) Nanos3 maintains the germ cell lineage in the mouse by suppressing both Bax-dependent and independent apoptotic pathways. Dev. Biol. 318, Tarkar, A., Loges, N.T., Slagle, C.E. et al. (2013) DYX1C1 is required for axonemal dynein assembly and ciliary motility. Nat. Genet. 45, Zariwala, M.A., Gee, H.Y., Kurkowiak, M. et al. (2013) ZMYND10 is mutated in primary ciliary dyskinesia and interacts with LRRC6. Am. J. Hum. Genet. 93, Zhao, L., Yuan, S., Cao, Y., Kallakuri, S., Li, Y., Kishimoto, N., Dibella, L. & Sun, Z. (2013) Reptin/Ruvbl2 is a Lrrc6/Seahorse interactor essential for cilia motility. Proc. Natl Acad. Sci. USA 110, Received: 23 March 2016 Accepted: 19 April 2016 Supporting Information Additional Supporting Information may be found online in the supporting information tab for this article: Figure S1 Generation of Lrrc6 / mice. Figure S2 Lrrc6(IRES-LacZ) and Lrrc6::Venus BAC transgenes. Table S1 Laterality defects in visceral organs of the Lrrc6 / mouse Movie S1 Motility of Node Cilia in the Lrrc6 +/+ mouse. Movie S2 Motility of Node Cilia in the Lrrc6 / mouse. Movie S3 Motility of tracheal Cilia in the Lrrc6 +/+ mouse. Movie S4 Motility of tracheal Cilia in the Lrrc6 / mouse. Movie S5 Cilia of brain ependymal cells from the Lrrc6 +/+ mouse are motile. Movie S6 Cilia of brain ependymal cells from the Lrrc6 / mouse are immotile. Movie S7 Motility of sperm from Lrrc6 +/+ mouse. Movie S8 Motility of sperm from Lrrc6 f/f ;Nanos3 Cre/+ mouse Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd Genes to Cells (2016) 21,