SUPPLEMENTARY INFORMATION
|
|
- Lindsay Welch
- 5 years ago
- Views:
Transcription
1 Suppl. Fig. 1 in vivo expression of ISL1 in the human fetal heart. a, Hematoxylin eosin staining showing structures of left atrium and left atrium appendage (*) of a human fetal heart at 11 weeks of gestation. Panels on the right showing immohistochemical analyses for the LA with indicated antibodies. b, Immunostaining of sections from RA region with indicated antibodies. Yellow arrows pointing cells stained positive for ISL1 and PECAM1. RA; right atrium, LA: left atrium, RV: right ventricle. Scale bars: 25 µm (a,b) and 50 µm in far right panels in b. 1
2 Suppl. Fig. 1 in vivo expression of ISL1 in the human fetal heart (continued). c, d, Immunostaining of adjacent sections from human fetal hearts at 11 weeks (c) and 18 weeks (d) of gestation with indicated antibodies. A same field of each section is presented from a lower (left panel) to a higher (middle panel) magnification. RA; right atrium, SVC: Super vena cava, RCA: right coronary artery, AVC: atrioventricular canal, RV: right ventricle. Scale bars: 25 µm. 2
3 Suppl. Fig. 2 Generation of transgenic and knock-in hes cell lines. a, A diagram of the human ISL1-βgeo BAC transgenic construct. A βgeo cassette and an FRT-flanked antibiotics cassette are inserted into ISL1 endogenous translation start site. b, Cells dissociated from day 6 EBs of the human ISL1-cre knock-in line were stained positive for cre recombinase and ISL1 after a two-day co-culture with feeders. Scale bar: 5 µm. c, A scheme of the human ISL1-cre DsRed lineage tracing strategy in hes cell model system. In order to reduce potential effects on the regulatory sequences of the ISL1 locus, the FRT-flanked antibiotics cassette in knock-in locus was excised by transient transfection of an Flpase expressing plasmid. d, A typical beating human ISL1-cre DsRed EB on a gelatin-coated cell culture plate containing a cluster of DsRed+ cells. 3
4 Suppl. Fig. 3 Gene expression of the human ISL1-cre DsRed ES cells and KDR staining in the human fetal hearts. a, FACS analysis on cells dissociated from day 8 EBs of human ISL1-cre DsRed cells and stained with FITC-conjugated anti-kdr antibody. b, RT-PCR showing gene expression of DsRed+ and DsRed- cells isolated from day 8 EBs of human ISL1-cre DsRed cells. c, d, Cross sections of 18 weeks (c) and 11 weeks (d) of gestation human fetal heart co-stained for ISL1 and KDR in the RA areas, showing that some ISL1- cells are KDR+ and some ISL1+ cells stained negative for KDR. RA; right atrium, LA, left atrium, RCA: right coronary artery, AVC: atrioventricular canal, RV: right ventricle, IAS: intra atrial septum. 4
5 Suppl. Fig. 4 Single cell derived clones developed on MEF feeders. To confirm that the DsRed+ colonies studied in the clonal assays are derived from single cells, we generated an additional transgenic pcag-flox-egfp ES line in the human ISL1-cre knock-in background. DsRed+ and egfp+ cells were purified from day 8 EBs. Equal numbers of red and green cells were mixed and plated at up to a 4-fold density used in the clonal assay. a, Distinct colonies from mixed cultures showing either DsRed or egfp expressing exclusively after 10 days of co-culture. Scale bars: 10 µm. b, 101 colonies/clusters were formed from DsRed+ and egfp+ cells and are summarized. c, The number of colonies developed on MEF feeders showing an arithmetically linear relationship to the numbers of input cells. Bars represent mean ± s.d.; n=3. 5
6 Suppl. Fig. 5 Expansion and characterization of hes cell-derived ISL1+ cardiac progenitors. a, ISL1+ cells increased by BIO treatment. Day 6 EBs of human ISL1-βgeo BAC transgenic cells were dissociated and cultured on mouse CMC feeders for two days before treated with and without BIO for another five days. Colonies were stained with anti-isl1 antibody and counted for ISL1+ ones. b, Immunostaining of a typical BIO-treated ISL1+ colony. c, qpcr showing the gene expression of Wnt3a-expanded DsRed+ cells. Cells dissociated from day 7 EBs of human ISL1-cre DsRed cells were plated on Wnt3a-secreting feeders, cultured for five days and FACS isolated. Gene expression of DsRed+ cells was compared with DsRed- cells. Bars represent mean ± s.d.; n=3. 6
7 Supplementary Table 1. Molecular markers of single DsRed+ cell-derived progenitor clones. The total 95 tested clones are categorized into four groups based on their expression pattern of ISL1 and NKX2-5. The percentage of each group is listed under the group definition. Typical clones of each group are presented with gene expression pattern as well as their total numbers. 7
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
More informationSupplementary Information
Supplementary Information Overexpression of Fto leads to increased food intake and results in obesity Chris Church, Lee Moir, Fiona McMurray, Christophe Girard, Gareth T Banks, Lydia Teboul, Sara Wells,
More informationSupplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and
Supplementary Figure S1 Enlarged coronary artery branches in Edn1-knockout mice. a-d, Coronary angiography by ink injection in wild-type (a, b) and Edn1-knockout (Edn1-KO) (c, d) hearts. The boxed areas
More informationFigure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from
Figure S1. (A) Schematic diagram of dnrar transgene allele. (B) X-Gal staining of testis from germ cell mutants (dnrar flox/flox, Stra8-Cre +, RARElacZ) (A ), controls (dnrar flox/flox, RARElacZ) (B ),
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationProbe. Hind III Q,!?R'!! /0!!!!D1"?R'! vector. Homologous recombination
Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!
More informationBreeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma.
Supplementary Figure 1 Breeding scheme, transgenes, histological analysis and site distribution of SB-mutagenized osteosarcoma. (a) Breeding scheme. R26-LSL-SB11 homozygous mice were bred to Trp53 LSL-R270H/+
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
More informationSUPPLEMENTARY INFORMATION
1 SUPPLEMENTARY INFORMATION Mutations in the NOTCH pathway regulator MIB1 cause left ventricular noncompaction cardiomyopathy Guillermo Luxán, Jesús C. Casanova, Beatriz Martínez-Poveda, Belén Prados,
More informationNature Immunology: doi: /ni.3412
Supplementary Figure 1 Gata1 expression in heamatopoietic stem and progenitor populations. (a) Unsupervised clustering according to 100 top variable genes across single pre-gm cells. The two main cell
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationNeocortex Zbtb20 / NFIA / Sox9
Neocortex / NFIA / Sox9 Supplementary Figure 1. Expression of, NFIA, and Sox9 in the mouse neocortex at. The lower panels are higher magnification views of the oxed area. Arrowheads indicate triple-positive
More informationThe Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice
Supplementary information The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice Kanako Tatsumi 1, 2, Harumi Yamamoto-Mukai 2, Ritsuko Shimizu 3, Satoshi Waguri 4, Yu-Shin
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationDevelopment of the Heart
Development of the Heart Thomas A. Marino, Ph.D. Temple University School of Medicine Stages of Development of the Heart 1. The horseshoe-shaped pericardial cavity. 2. The formation of the single heart
More informationNature Neuroscience: doi: /nn Supplementary Figure 1. MADM labeling of thalamic clones.
Supplementary Figure 1 MADM labeling of thalamic clones. (a) Confocal images of an E12 Nestin-CreERT2;Ai9-tdTomato brain treated with TM at E10 and stained for BLBP (green), a radial glial progenitor-specific
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationHeart Development. Robert G. Kelly Developmental Biology Institute of Marseilles - Luminy
ESC CBCS Summer School on Cardiovascular Sciences 15th June 2011 Heart Development Robert G. Kelly Developmental Biology Institute of Marseilles - Luminy Animal models of heart development Tinman/Nkx2.5
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature11463 %Sox17(+) 9 8 7 6 5 4 3 2 1 %Sox17(+) #Sox17(+) d2 d4 d6 d8 d1 d12 d14 d18 25 2 15 1 5 Number of Sox17(+) cells X 1 Supplementary Figure 1: Expression of
More informationSupplementary Figure 1
Supplementary Figure 1 Kif1a RNAi effect on basal progenitor differentiation Related to Figure 2. Representative confocal images of the VZ and SVZ of rat cortices transfected at E16 with scrambled or Kif1a
More informationAtg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1
Takamura_Fig. S1 brain heart lung spleen stomach colon kidney SM Supplemental Figure 1 Histological findings of tg5 flox/flox ;CG-Cre mouse tissues. H&E staining of the brain, heart, lung, spleen, stomach,
More informationSupplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice.
Downstream Col1A locus S P P P EP Genotyping with P1, P2 frt PGKneopA + frt hygro-pa Targeting vector Genotyping with P3, P4 P1 pcag-flpe P2 P3 P4 frt SApA CAG LSL PGKATG frt hygro-pa C. D. E. ormal KRAS
More informationSupplementary Fig. 1 Blocking shh function at the protein level confirms its role as a guidance cue for postcommissural axons.
Supplementary Fig. 1 Blocking shh function at the protein level confirms its role as a guidance cue for postcommissural axons. As an alternative method to demonstrate the role of shh as a guidance cue
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3200 Supplementary Figure 1 Expression analysis of stomach markers in gutlike structure. (a) Differentiation scheme of gut-like structure formation from embryonic stem cells. (b) RT-PCR
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More information(a-r) Whole mount X-gal staining on a developmental time-course of hearts from
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Supplementary Figure 1 (a-r) Whole mount X-gal staining on a developmental time-course of hearts from Sema3d +/- ;Ephb4 LacZ/+ and Sema3d -/- ;Ephb4 LacZ/+ embryos.
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
More information"Lecture Index. 1) Heart Progenitors. 2) Cardiac Tube Formation. 3) Valvulogenesis and Chamber Formation. 4) Epicardium Development.
"Lecture Index 1) Heart Progenitors. 2) Cardiac Tube Formation. 3) Valvulogenesis and Chamber Formation. 4) Epicardium Development. 5) Septation and Maturation. 6) Changes in Blood Flow during Development.
More informationSupplemental Table 1. Echocardiography Control (n=4)
Supplemental Table 1. Echocardiography (n=4) Mlc2v cre/+ ; DNMAML (n=4) LVIDd, mm 3.9±0.3 4.3±0.3 LVIDs, mm 2.6±0.4 2.9±0.2 d, mm 0.72±0.06 0.75±0.1 LVPWd, mm 0.72±0.06 0.77±0.11 FS, % 33±6 33±1 EF, %
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationSupplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse
Supplemental figure legends Supplemental Figure 1. Intracranial transduction of a modified ptomo lentiviral vector in the mouse hippocampus targets GFAP-positive but not NeuN-positive cells. (A) Stereotaxic
More informationSupplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical
More informationC3, 4, 5, 6, & 7 Worksheet. C3 Describe the inter-relationships of the structures of the heart
Name: Date: C3, 4, 5, 6, & 7 Worksheet C3 Describe the inter-relationships of the structures of the heart 1. Label and give the functions of the following: a. left and right atrium: b. left and right ventricle:
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationMaoqing Ye, Yan Yin, Kazumi Fukatsu, and Paul Grossfeld
Evidence That Deletion of ETS-1, a Gene in the Jacobsen Syndrome (11q-) Cardiac Critical Region, Causes Congenital Heart Defects through Impaired Cardiac Neural Crest Cell Function 52 Maoqing Ye, Yan Yin,
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/375/ra41/dc1 Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice
More informationHeart Development. Origins of congenital heart defects Properties of cardiac progenitor cells. Robert G. Kelly
ESC CBCS Summer School on Cardiovascular Sciences Heart Development 19th June 2013 Origins of congenital heart defects Properties of cardiac progenitor cells Robert G. Kelly Animal models of heart development
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationSupplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
More informationstability and tumor suppression
Supplementary information The stress kinase MKK7 couples oncogenic stress to p53 stability and tumor suppression Daniel Schramek 1, Athanassios Kotsinas 2, Arabella Meixner 1, Teiji Wada 1, Ulrich Elling
More informationSUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
More informationSupplementary Figure 1
Supplementary Figure 1 YAP negatively regulates IFN- signaling. (a) Immunoblot analysis of Yap knockdown efficiency with sh-yap (#1 to #4 independent constructs) in Raw264.7 cells. (b) IFN- -Luc and PRDs
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
More informationCh.15 Cardiovascular System Pgs {15-12} {15-13}
Ch.15 Cardiovascular System Pgs {15-12} {15-13} E. Skeleton of the Heart 1. The skeleton of the heart is composed of rings of dense connective tissue and other masses of connective tissue in the interventricular
More informationSantulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function
ONLINE DATA SUPPLEMENTS Santulli G. et al. A microrna-based strategy to suppress restenosis while preserving endothelial function Supplementary Figures Figure S1 Effect of Ad-p27-126TS on the expression
More informationTitle: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
More informationgenome edited transient transfection, CMV promoter
Supplementary Figure 1. In the absence of new protein translation, overexpressed caveolin-1-gfp is degraded faster than caveolin-1-gfp expressed from the endogenous caveolin 1 locus % loss of total caveolin-1-gfp
More informationIL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia
Supplementary Figures IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia Yaming Wang, Kristy J. Szretter, William Vermi, Susan Gilfillan, Cristina
More informationTGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
More informationThe Mammalian Circulatory System
The Mammalian Heart The Mammalian Circulatory System Recall: What are the 3 cycles of the mammalian circulatory system? What are their functions? What are the three main vessel types in the mammalian circulatory
More informationSupplementary Figure 1: Imaging T-ALL progression and growth in transplanted
Supplementary Figure 1: Imaging T-ALL progression and growth in transplanted rag2e450fs fish. Monoclonal T-ALLs were serially passaged in strain fish and then used as donors (left panel). Cells were transplanted
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11306 Supplementary Figures Supplementary Figure 1. Basic characterization of GFP+ RGLs in the dentate gyrus of adult nestin-gfp mice. a, Sample confocal images
More informationMoore-Morris et al. Supplemental Table 1.
Moore-Morris et al. Supplemental Table. In vivo echocardiographic assessment of cardiac size and function following transaortic constriction (T) at 7d and 8d. SHM 7d N=6 T 7d N=5 SHM 8d N= T 8d N=6 W,
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the
More informationSupplementary material. Supplementary Figure legends
Supplementary material Supplementary Figure legends Supplementary Figure 1: Senescence-associated proliferation stop in response to oncogenic N-RAS expression Proliferation of NHEM cells without (ctrl.)
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2610 Figure S1 FSMCs derived from MSLN CLN transgenic mice express smooth muscle-specific proteins. Beta-galactosidase is ubiquitously expressed within cultured FSMCs derived from MSLN
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2638 Figure S1 Morphological characteristics of fetal testes and ovaries from 6.5-20 developmental weeks. Representative images of Hematoxylin and Eosin staining of testes and ovaries over
More informationSupplementary Figure 1. Chimeric analysis of inner ears. (A-H) Chimeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears.
Supplementary Figure 1. himeric analysis of inner ears. (A-H) himeric inner ears with fluorescent ES cells and (I,J) Rainbow inner ears. (A,B) omposite images showing three colors in different vestibular
More informationSupplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a,
Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Transverse sections of E17.5 ovary and mesonephros from Gli1-LacZ reporter embryos (n=3) after LacZ staining (blue). The
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Bidirectional optogenetic modulation of the tonic activity of CEA PKCδ + neurons in vitro. a, Top, Cell-attached voltage recording illustrating the blue light-induced increase in
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationZhu et al, page 1. Supplementary Figures
Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior
More informationSupplemental Information. Myocardial Polyploidization Creates a Barrier. to Heart Regeneration in Zebrafish
Developmental Cell, Volume 44 Supplemental Information Myocardial Polyploidization Creates a Barrier to Heart Regeneration in Zebrafish Juan Manuel González-Rosa, Michka Sharpe, Dorothy Field, Mark H.
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. Short-term coreceptor and costimulation blockade induces tolerance to pluripotent human ESCs. (A) Schematic diagram showing experimental approaches and
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationBNP mrna expression in DR and DS rat left ventricles (n = 5). (C) Plasma norepinephrine
Kanazawa, et al. Supplementary figure legends Supplementary Figure 1 DS rats had congestive heart failure. (A) DR and DS rat hearts. (B) QRT-PCR analysis of BNP mrna expression in DR and DS rat left ventricles
More informationTITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer
AD Award Number: W81XWH-04-1-0325 TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer PRINCIPAL INVESTIGATOR: Valerie Boka CONTRACTING ORGANIZATION: University of Texas Health Science
More informationCardiovascular System. Heart Anatomy
Cardiovascular System Heart Anatomy 1 The Heart Location & general description: Atria vs. ventricles Pulmonary vs. systemic circulation Coverings Walls The heart is found in the mediastinum, the medial
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationCirculatory System Review
Circulatory System Review 1. Know the diagrams of the heart, internal and external. a) What is the pericardium? What is myocardium? What is the septum? b) Explain the 4 valves of the heart. What is their
More informationWhen you see this diagram, remember that you are looking at the embryo from above, through the amniotic cavity, where the epiblast appears as an oval
When you see this diagram, remember that you are looking at the embryo from above, through the amniotic cavity, where the epiblast appears as an oval disc 2 Why the embryo needs the vascular system? When
More information(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment
SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Increased ABHD5 expression in human colon cancer associated macrophages. (a) Murine peritoneal macrophages were treated with regular culture medium (Ctrl) or
More informationSupplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
More informationSupplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids
Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee
More informationHuman Anatomy and Physiology Chapter 19 Worksheet 1- The Heart
Human Anatomy and Physiology Chapter 19 Worksheet 1- The Heart Name Date Period 1. The "double pump" function of the heart includes the right side, which serves as the circuit pump, while the left side
More informationSUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationThe Physiology of the Fetal Cardiovascular System
The Physiology of the Fetal Cardiovascular System Jeff Vergales, MD, MS Department of Pediatrics Division of Pediatric Cardiology jvergales@virginia.edu Disclosures I serve as the medical director for
More informationThe Body s Transport System (pp )
The Body s Transport System (pp. 538 547) This section describes how the heart, blood vessels, and blood work together to carry materials throughout the body. Use Target Reading Skills As you read, complete
More informationMeeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A
Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual
More informationMaterial and Methods Production and analysis of -gal+ clones Immunostaining Optical projection tomography Statistical analysis
Material and Methods Production and analysis of β-gal+ clones The α-cardiac actin nlaacz/+ and Cx40 egfp mouse lines used in this study were genotyped as previously reported 1, 2. Double transgenic knock-in
More informationSupplementary Information
Supplementary Information 1 Supplementary information, Figure S1 Establishment of PG-haESCs. (A) Summary of derivation of PG-haESCs. (B) Upper, Flow analysis of DNA content of established PG-haES cell
More informationLab Activity 23. Cardiac Anatomy. Portland Community College BI 232
Lab Activity 23 Cardiac Anatomy Portland Community College BI 232 Cardiac Muscle Histology Branching cells Intercalated disc: contains many gap junctions connecting the adjacent cell cytoplasm, creates
More informationEach event in Table 5.1 is immediately followed by one of the events listed in Table 5.2.
1 (a) Table 5.1 and Table 5.2 list events that occur during the cardiac cycle. Each event in Table 5.1 is immediately followed by one of the events listed in Table 5.2. Complete Table 5.1 by inserting
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationNIH Public Access Author Manuscript Science. Author manuscript; available in PMC 2010 July 2.
NIH Public Access Author Manuscript Published in final edited form as: Science. 2009 October 16; 326(5951): 426 429. doi:10.1126/science.1177350. Generation of Functional Ventricular Heart Muscle from
More informationPartial anomalous pulmonary venous connection to superior
Cavo-Atrial Anastomosis Technique for Partial Anomalous Pulmonary Venous Connection to the Superior Vena Cava The Warden Procedure Robert A. Gustafson, MD Partial anomalous pulmonary venous connection
More informationSIKLUS JANTUNG. Rahmatina B. Herman
SIKLUS JANTUNG Rahmatina B. Herman The Cardiac Cycle Definition: The cardiac events that occur from the beginning of one heartbeat to the beginning of the next The cardiac cycle consists of: - Diastole
More informationa b c periosteum parietal bone bone marrow dura periosteum suture mesenchyme osteogenic front suture mesenchyme 1
coronary suture sagittal suture DOI: 10.1038/ncb3139 a b c e parietal bone suture mesenchyme parietal bone bone marrow ura ura ura f parietal bone ura suture mesenchyme bone g ura osteogenic front suture
More information