About OMICS Group Conferences
|
|
- Piers Strickland
- 5 years ago
- Views:
Transcription
1 About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information on Sciences and technology Open Access, OMICS Group publishes 400 online open access scholarly journals in all aspects of Science, Engineering, Management and Technology journals. OMICS Group has been instrumental in taking the knowledge on Science & technology to the doorsteps of ordinary men and women. Research Scholars, Students, Libraries, Educational Institutions, Research centers and the industry are main stakeholders that benefitted greatly from this knowledge dissemination. OMICS Group also organizes 300 International conferences annually across the globe, where knowledge transfer takes place through debates, round table discussions, poster presentations, workshops, symposia and exhibitions.
2 About OMICS Group Conferences OMICS Group International is a pioneer and leading science event organizer, which publishes around 400 open access journals and conducts over 300 Medical, Clinical, Engineering, Life Sciences, Pharma scientific conferences all over the globe annually with the support of more than 1000 scientific associations and 30,000 editorial board members and 3.5 million followers to its credit. OMICS Group has organized 500 conferences, workshops and national symposiums across the major cities including San Francisco, Las Vegas, San Antonio, Omaha, Orlando, Raleigh, Santa Clara, Chicago, Philadelphia, Baltimore, United Kingdom, Valencia, Dubai, Beijing, Hyderabad, Bengaluru and Mumbai.
3 The Homeostatic Intracellular Repair Response (HIR 2 ) And Heart Surgery 3 rd International Conference on Clinical and Experimental Cardiology Hilton Chicago, Northbrook, USA, 2013 Bruce R. Ito, Roberta A. Gottlieb, Robert M. Mentzer, Jr. Donald P. Shiley BioScience Center San Diego State University San Diego, CA School of Medicine/WSU CVRI Wayne State University Detroit, MI
4 The Homeostatic Intracellular Repair Response (HIR 2 ) HIR 2 is a lysosomal adaptive response to stress Preclinical evidence indicates it is manifest in multiple organs In the heart it is a protective response to ischemia-reperfusion
5 Autophagy: A Survival Pathway Mitochondrion Pre-autophagosomal structure Atg5-Atg12 Beclin-1 Phagophore p62 Autophagolysosome LC3 Autophagosome Lysosome Modified from T. Shintani et al., Science 306, (2004)
6 Central Hypothesis Autophagy is impaired in the setting of MetS and results in the loss of endogenous protection conferred by ischemic preconditioning (IPC)
7 Metabolic Syndrome (MetS) Characterized by obesity, HC, dyslipidemia, and insulin resistance Increased risk of death from myocardial infarction and stroke Prevalence in the USA estimated at >30% of the population; >20% Japan (and rapidly increasing)
8 Methods Utilized 3 translational models of MetS LC3-mCherry transgenic mice fed a high fat diet (HFD) Genetic Zucker obese (ZO) rats Yucatan pigs fed a high fat/high fructose diet (HF/HF) Assessed autophagy (puncta, Western blot) Measured infarct size (TTC) and response to ischemic preconditioning (IPC)
9 Body Weight Gain (g) Fewer Cardiac Autophagosomes MHC mcherry-lc3 Mice Control Diet HFD Days on Diet in DIO Mice Normal Chow 40x High Fat Diet 40x Puncta/ Field Number of Puncta n=7 * n=7 Puncta / Nuclei Puncta/ Nuclei n=7 * n=7 Puncta Size (px 2 ) mcherry LC3 Puncta Size 60x 0 Chow HFD 0 Chow HFD 0 M14 M15 M16 M6 M7 Chow Diet M8 High Fat Diet
10 Autophagy is Decreased in DIO Mice p62 LC3 Chow HFD 14 LC3-II 5 Beclin-1 LC3II (Density) Beclin-1/ GAPDH Chow HFD 0 Chow HFD Atg p Atg12/ Tubulin p62/ Actin Chow HFD 0.0 Chow HFD
11 MetS in Zucker Obese Rats Body Weight (g) Body Weight p < 0.01 Lean Obese Cholesterol (mg/dl) Serum Cholesterol p < 0.01 Lean Obese Triglyceride (mg/dl) Serum Triglycerides p < 0.01 Lean Obese HOMA Index HOMA p < 0.01 Lean Obese Blood Glucose (mg/dl) Fasting Glucose p < 0.01 Lean Obese Insulin (ng/ml) Serum Insulin p < 0.01 Lean Obese
12 Impaired Autophagy in Adult Myocytes from ZO Rats with MetS 350 LC3-II: Starvation LC3-II (% of Control) Lean Control Starved ZO LC3 Rho Lean Ctrl Lean Starve ZO Ctrl ZO Starve p-s6k (% of Control) p-s6k: Rapamycin Lean Control Rapamycin ZO LC3-II (% of Control) LC3-II: Rapamycin Lean Control Rapamycin ZO p62 (% of Control) p62: Rapamycin Control Rapamycin Lean ZO 12
13 Autophagy is Reduced in in ZO Rats with MetS 0.12 Cardiac LC3-II 0.35 Cardiac Atg Density Density LC3 Lean Obese
14 Impaired Pre-conditioning in Zucker Obese Rats with MetS Lean Cont. Lean IPC Obese Cont. Obese IPC 80 Infarct Size in Zucker Rats Infarct Size (% AAR) * N.S. 0 Cont. IPC Cont. IPC Lean Obese
15 Obesity and Hypercholesterolemia in High Fat/ Fructose Fed Yucatan Pigs Body Weight (kg) Yucatan Mini Pigs Body Weight HFFD Diet Chow Diet Time on Diet (Weeks) Cholesterol (mg/dl) Fasting Cholesterol HFFD Diet Chow Diet Time on Diet (Weeks) 100 Abdominal Girth 25 Calculated Body Fat (cm) (%) Chow HFFD 0 Chow HFFD
16 Depressed Autophagy in Obese Yucatan Pigs Atg5 Rho p62 Rho Chow HFD Chow HFD 1.2 Cardiac Atg5 2.5 Cardiac p Atg5/ Rho p62/ Rho Chow HFFD 0.0 Chow HFFD
17 Impaired Preconditioning in Obese Swine with MetS Effect of High Fat - High Fructose Diet on Ischemic Preconditioning (IPC 1 x10') in Pigs Infarct Size (% of AAR) n=6 No IPC n=2 IPC Lean Farm Pigs n=2 Lean IPC n=2 HFFD IPC Yucatan Mini-pigs
18 Summary Animal models of metabolic syndrome show impaired autophagy and loss of cardioprotection But do we know about autophagy and cardioprotection in the human heart?
19 Autophagy in the Human Heart Upregulated autophagy in failing heart decreased after mechanical unloading Kassiotis et al. Circulation 2009 Impaired autophagy associated with postoperative atrial fibrillation Garcia et al. J Thorac Cardiovasc Surg 2011
20 Methods (1) 19 patients (38 samples) undergoing cardiac surgery Right atrial tissue ( mg) obtained before cross-clamping the aorta and after its removal Western blotting used to measure autophagy proteins (Beclin-1, Atg5-12, SQSTM1/p62)
21 Methods (2) The perioperative autophagic response was correlated with the morbidity and mortality risk calculated from STS Adult Cardiac Surgery Database
22 Actin Levels Are Unaffected By 0.8 Cardiac Stress 0.6 Actin 0.4 N.S Before After Pt Sample 6a 6b 7a 7b 8a 8b 9a 9b 10a 10b 11a 11b 12a 12b Actin
23 Cardiac Stress Is Associated with Decreased Levels of Beclin -1 Pt Sample 6a 6b 7a 7b 8a 8b 9a 9b 10a 10b 11a 11b 12a 12b Beclin-1
24 Cardiac Stress Is Associated with Decreased Levels of Atg Atg p = Before After Pt Sample 6a 6b 7a 7b 8a 8b 9a 9b 10a 10b 11a 11b 12a 12b Atg5-12
25 Cardiac Stress Is Associated with 0.5 Decreased Levels of p p p = Before After Pt Sample 6a 6b 7a 7b 8a 8b 9a 9b 10a 10b 11a 11b 12a 12b P62/SQSTM1
26 Cardiac Stress Depletes Key Autophagy Proteins Signal Density n =19 Patients Beclin-1 Atg 5-12 p62 p = * p =0.002 * p = * 0.0 Before After Before After Before After
27 Operative Risk Correlates with Changes in Autophagy Morbidity/ Mortality Risk (%) r 2 = 0.30 p = Change in p62 (Density Units)
28 Summary Preclinical studies support concept that autophagy is cardioprotective and is impaired in MetS Cardiac surgery and its attendant ischemia is accompanied by accelerated autophagic flux The magnitude of flux increase is inversely correlated with risk
29 Conclusion Studies evaluating the role of autophagy in setting of I/R are feasible in humans Enhancement of autophagy represents a new clinical approach to myocardial protection during heart surgery
30 Preparing for OMICS 2013
31 Acknowledgements Bruce R. Ito Roberta A. Gottlieb Salik Jahania David Sengstock Peter Vaitkevicius Post-doctoral Fellows Zoltan Giricz Allen Andres Students Nandini Ravindran Carlos Bazan 31
32
33 Mechanism is Adaptive Autophagy Mitochondrion Atg5-Atg12 p62 Beclin-1 LC3-GFP Modified from T. Shintani et al., Science 306, (2004)
34 Conclusion The findings suggest that the future of better cardioprotection lies with our ability to enhance this important adaptive response to ischemic stress
35 The Homeostatic Intracellular Repair Response (HIR 2 ) HIR 2 is a lysosomal adaptive response to stress Represents a new approach to myocardial protection Preclinical evidence indicates it is manifest in multiple organs and is cardioprotective
36 Increased Autophagic Flux is Associated with Reduced M/M Risk Autophagy Proteins Calculated M/M Risk vs. p62 Signal Density n =19 Patients Beclin-1 Atg 5-12 p62 p = * p =0.002 Before After Before After Before After * p = * Morbidity/ Mortality Risk (%) r 2 = 0.30 p < Change in p62 (Density Units)
37 Summary Autophagy flux is inversely correlated with operative risk Autophagy in humans is an endogenous self protective response
38 Thanks' for your kind attention!!!!!! 38
39 Let Us Meet Again We welcome you all to our future conferences of OMICS Group International Please Visit:
About OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group. OMICS Group International is an amalgamation of Open Access acetyl-coa
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 27 with the sole aim of making
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More information2/12/2014 *** + Chloro + Chloro. Bruce Ito, Nandini Ravindran, Robert Mentzer, unpublished data
LC3-II/Actin Ratio 1 Young *** Aged B. 0 + Chloro + Chloro Bruce Ito, Nandini Ravindran, Robert Mentzer, unpublished data 1 Chow HFD p62 LC3 Normal Chow High Fat Diet (16 wk) Bruce Ito, Nandini Ravindran,
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationOMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 27 with the sole aim of making
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationOMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007
* OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information on Sciences
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationOMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation ofopen Access publicationsand worldwide international science conferences and events. Established in the year 2007 with the sole aim of making
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationOMICS Group International is an amalgamation of Open Access publications
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationOMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group Conferences
About MICS Group MICS Group International is an amalgamation of pen Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making
More informationAbout OMICS Group. events. Established in the year 2007 with the sole aim of making the information on Sciences and technology Open Access, OMICS
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationAbout OMICS Group. Prof Dr. Abdalla Omar
About OMICS Group OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationOMICS INTERNATIONAL CONFERENCES
1 ABOUT OMICS GROUP OMICS Group is an amalgamation of Open Access Publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationABOUT OMICS INTERNATIONAL CONFERENCES
ABOUT OMICS GROUP OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationOMICS Journals are Welcoming Submissions
OMICS Journals are Welcoming Submissions OMICS International welcomes submissions that are original and technically so as to serve both the developing world and developed countries in the best possible
More informationAbout OMICS International Conferences
About OMICS Group OMICS Group is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of making the information
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationCell therapy: enhancing the therapeutic potential of cardiac progenitors for delivery post myocardial infarction. Rita Alonaizan
Cell therapy: enhancing the therapeutic potential of cardiac progenitors for delivery post myocardial infarction Rita Alonaizan Department of Physiology, Anatomy & Genetics St Catherine s College Supervisor:
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationAdipose Tissue Dysfunction and Diabetic Cardiovascular Disease
Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Xin-Liang Ma, MD, PhD Thomas Jefferson University Philadelphia, PA USA CVD As The #1 Causes of Death In USA Male Female Heart Disease and
More informationRepetitive stimulation of autophagy-lysosome machinery by intermittent fasting preconditions the myocardium to ischemia-reperfusion injury
Autophagy 11:9, 1537--1560; September 2015; 2015 Taylor & Francis BASIC RESEARCH PAPER Repetitive stimulation of autophagy-lysosome machinery by intermittent fasting preconditions the myocardium to ischemia-reperfusion
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationDefective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance
Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil
More informationNilgün Gedik 1, Matthias Thielmann 2, Eva Kottenberg 3,Jürgen Peters 3, Heinz Jakob 2, Gerd Heusch 1, Petra Kleinbongard 1 * Abstract.
No Evidence for Activated Autophagy in Left Ventricular Myocardium at Early Reperfusion with Protection by Remote Ischemic Preconditioning in Patients Undergoing Coronary Artery Bypass Grafting Nilgün
More informationSupplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells.
Supplementary Fig. 1 V-ATPase depletion induces unique and robust phenotype in Drosophila fat body cells. a. Schematic of the V-ATPase proton pump macro-complex structure. The V1 complex is composed of
More informationOVERVIEW OF ADVERSE CARDIOVASCULAR EVENTS IN THE BRODALUMAB PSORIASIS STUDIES
OVERVIEW OF ADVERSE CARDIOVASCULAR EVENTS IN THE BRODALUMAB PSORIASIS STUDIES Bruce Strober, 1,2 Lawrence F. Eichenfield, 3 April Armstrong, 4 Alice Gottlieb, 5 Kenneth Gordon, 6 Tina Lin, 7 Radhakrishnan
More informationSestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury
Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada
More informationAssessing Cardiac Risk in Noncardiac Surgery. Murali Sivarajan, M.D. Professor University of Washington Seattle, Washington
Assessing Cardiac Risk in Noncardiac Surgery Murali Sivarajan, M.D. Professor University of Washington Seattle, Washington Disclosure None. I have no conflicts of interest, financial or otherwise. CME
More informationAbout OMICS Group Conferences
About OMICS Group OMICS Group International is an amalgamation of Open Access publications and worldwide international science conferences and events. Established in the year 2007 with the sole aim of
More informationHypothalamic Autophagy and Regulation of Energy Balance
Hypothalamic Autophagy and Regulation of Energy Balance Rajat Singh, MD Albert Einstein College of Medicine New York NuGOweek 211 Sept 6-9, 211 Autophagy Evolutionarily conserved cellular recycling program
More informationMetformin For Prevention of Type II Diabetes
Transcript Details This is a transcript of an educational program accessible on the ReachMD network. Details about the program and additional media formats for the program are accessible by visiting: https://reachmd.com/programs/clinicians-roundtable/metformin-for-prevention-of-type-ii-diabetes/2826/
More informationIntegrative cardiovascular physiology: a primer to hypothesis driven research
Integrative cardiovascular physiology: a primer to hypothesis driven research Peter B. Raven, Ph.D. Univ. of N. TX. HSC @ Fort Worth & Craig G. Crandall, Ph.D. Inst. of Ex. and Environ. Med. @ Dallas Founded
More informationA. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationCardiovascular Diseases (BMM9) and Getting to Know CNIC course Course
Cardiovascular Diseases (BMM9) and Getting to Know CNIC course Course 2013-2014 A. Lectures: 13-30 January (09:30-12:15 h) I. Form and function of the cardiovascular system (13-15 January) 13 January (09.30
More informationCentral injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents
Central injection of fibroblast growth factor 1 induces sustained remission of diabetic hyperglycemia in rodents Jarrad M Scarlett 1,,1, Jennifer M Rojas 1,1, Miles E Matsen 1, Karl J Kaiyala 3, Darko
More informationIL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA
UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia
More informationElevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with
Elevated Serum Levels of Adropin in Patients with Type 2 Diabetes Mellitus and its Association with Insulin Resistance Mehrnoosh Shanaki, Ph.D. Assistant Professor of Clinical Biochemistry Shahid Beheshti
More informationAbout OMICS International
About OMICS International OMICS International through its Open Access Initiative is committed to make genuine and reliable contributions to the scientific community. OMICS International hosts over 700
More informationImplications of The LookAHEAD Trial: Is Weight Loss Beneficial for Patients with Diabetes?
Implications of The LookAHEAD Trial: Is Weight Loss Beneficial for Patients with Diabetes? Boston, MA November 7, 213 Edward S. Horton, MD Professor of Medicine Harvard Medical School Senior Investigator
More informationTumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
More informationSUPPLEMENTARY INFORMATION In format provided by JAATTELA (NOVEMBER 2005)
Box S1: Methods for studying lysosomal function and integrity Volume and distribution of the acidic compartment. Acridine orange is a metachromatic fluorochrome and a weak base that accumulates in the
More informationCardiovascular disease, studies at the cellular and molecular level. Linda Lowe Krentz Bioscience in the 21 st Century October 4, 2010
Cardiovascular disease, studies at the cellular and molecular level Linda Lowe Krentz Bioscience in the 21 st Century October 4, 2010 Content Introduction The number 1 killer in America Some statistics
More informationBasic pathophysiology of recovery: the role of endocrine metabolic response. Franco Carli McGill University Montreal, Canada
Basic pathophysiology of recovery: the role of endocrine metabolic response Franco Carli McGill University Montreal, Canada ASER, Washington, 2016 postoperative recovery, 1950 Loss of body weight, less
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationAutoimmunity. Autoimmunity Brochure. International Conference on. Autoimmunity Manchester, UK October 13-14, 2016
International Conference on Autoimmunity Manchester, UK October 13-14, 2016 Brochure Conference Secretariat 2360 Corporate Circle, Suite 400, Henderson, NV 89074-7722, USA Ph: +1-888-843-8169, Fax: +1-650-618-1417,
More informationCardiovascular disease, studies at the cellular and molecular level. Linda Lowe Krentz Bioscience in the 21 st Century September 23, 2009
Cardiovascular disease, studies at the cellular and molecular level Linda Lowe Krentz Bioscience in the 21 st Century September 23, 2009 Content Introduction The number 1 killer in America Some statistics
More informationMain Results Insulin Resistance Intervention after Stroke (IRIS) Trial
Main Results Insulin Resistance Intervention after Stroke (IRIS) Trial Walter N. Kernan, MD Professor of Medicine Yale School of Medicine February 17, 2016 Topic Presenter Disclosure Information Walter
More informationSupplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO
Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad
More informationSUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
More informationTargeting Glucose Metabolism to Stop Strokes IRIS: Insulin Resistance In Stroke study
Targeting Glucose Metabolism to Stop Strokes IRIS: Insulin Resistance In Stroke study Professor Gary Ford Chief Executive Officer, Oxford Academic Health Science Network Consultant Stroke Physician, Oxford
More informationUseful? Definition of High-risk? Pre-OP/Intra-OP/Post-OP? Complication vs Benefit? Mortality? Morbidity?
Preoperative intraaortic balloon counterpulsation in high-risk CABG Stefan Klotz, M.D. Preoperative IABP in high-risk CABG Questions?? Useful? Definition of High-risk? Pre-OP/Intra-OP/Post-OP? Complication
More informationIschemic Heart Disease Interventional Treatment
Ischemic Heart Disease Interventional Treatment Cardiac Catheterization Laboratory Procedures (N = 11,61) is a regional and national referral center for percutaneous coronary intervention (PCI). A total
More informationThe Journal of Thoracic and Cardiovascular Surgery
Accepted Manuscript Nitric Oxide: Might make it Better? J. Hunter Mehaffey, MD, MSc, Robert B. Hawkins, MD, MSc PII: S0022-5223(18)32342-0 DOI: 10.1016/j.jtcvs.2018.08.070 Reference: YMTC 13398 To appear
More informationSupplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
More informationAndrew Cohen, MD and Neil S. Skolnik, MD INTRODUCTION
2 Hyperlipidemia Andrew Cohen, MD and Neil S. Skolnik, MD CONTENTS INTRODUCTION RISK CATEGORIES AND TARGET LDL-CHOLESTEROL TREATMENT OF LDL-CHOLESTEROL SPECIAL CONSIDERATIONS OLDER AND YOUNGER ADULTS ADDITIONAL
More informationTrehalose, sucrose and raffinose are novel activators of autophagy in human. keratinocytes through an mtor-independent pathway
Title page Trehalose, sucrose and raffinose are novel activators of autophagy in human keratinocytes through an mtor-independent pathway Xu Chen 1*, Min Li 1*, Li Li 1, Song Xu 1, Dan Huang 1, Mei Ju 1,
More informationModels of preventive care in clinical practice to achieve 25 by 25
Models of preventive care in clinical practice to achieve 25 by 25 Professor David A Wood Garfield Weston Professor of Cardiovascular Medicine International Centre for Circulatory Health Imperial College
More informationSuccessful completion of Phase I clinical trial of AMPK activator O304
Successful completion of Phase I clinical trial of AMPK activator O304 O304 is safe and very well tolerated in young healthy subjects, in middle aged obese subjects, and in type 2 diabetics in combination
More informationAssociation between arterial stiffness and cardiovascular risk factors in a pediatric population
+ Association between arterial stiffness and cardiovascular risk factors in a pediatric population Maria Perticone Department of Experimental and Clinical Medicine University Magna Graecia of Catanzaro
More informationCardiovascular disease physiology. Linda Lowe-Krentz Bioscience in the 21 st Century November 2, 2016
Cardiovascular disease physiology Linda Lowe-Krentz Bioscience in the 21 st Century November 2, 2016 Content Introduction The number 1 killer in America Some statistics Recommendations The disease process
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationTesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies
Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin
More information6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells
6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells 6.1 TNF-α induces mitochondrial oxidative stress in SH-SY5Y cells. The dysregulation of mitochondria and oxidative
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationCardioprotezione ed invecchiamento
55 Congresso SIGG Invecchiamento e longevità: più geni o più ambiente? Firenze, 30/11/2010-04/12/2010 Palazzo dei Congressi SESSIONE DI BIOGERONTOLOGIA Cardioprotezione ed invecchiamento P. Abete, MD,
More informationCardiovascular Update for the Primary Care Provider. Friday, June 12, 2015 Seattle
virginia mason continuing medical education Cardiovascular Update for the Primary Care Provider Friday, June 12, 2015 Seattle Faculty course director: J. Susie Woo, MD, FACC The Heart Institute at Virginia
More informationCardioprotection by endogenous fibroblast growth factor 2 in cardiac ischemia-reperfusion injury in vivo
Washington University School of Medicine Digital Commons@Becker Conference Abstracts and Posters Division of Emergency Medicine/Emergency Care Research Section 2011 Cardioprotection by endogenous fibroblast
More informationIschemic Heart Disease Interventional Treatment
Ischemic Heart Disease Interventional Treatment Cardiac Catheterization Laboratory Procedures (N = 89) is a regional and national referral center for percutaneous coronary intervention (PCI). A total of
More informationSuppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified
Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes
More informationhttp://noodlemaz.wordpress.com/category/science/cancer/ Outline Introduction Serious nature of Cardiovascular Disease (CVD) How to prevent CVD? The disease process Damage and plaque development Current
More informationSupplemental Information. Autophagy in Oncogenic K-Ras. Promotes Basal Extrusion. of Epithelial Cells by Degrading S1P. Current Biology, Volume 24
Current Biology, Volume 24 Supplemental Information Autophagy in Oncogenic K-Ras Promotes Basal Extrusion of Epithelial Cells by Degrading S1P Gloria Slattum, Yapeng Gu, Roger Sabbadini, and Jody Rosenblatt
More informationPathophysiology of ischemia-reperfusion injury (and how to protect against it )
Pathophysiology of ischemia-reperfusion injury (and how to protect against it ) Dr Derek J Hausenloy Reader in Cardiovascular Medicine BHF Senior Clinical Research Fellow Honorary Consultant Cardiologist
More informationA nationwide population-based study. Pai-Feng Hsu M.D. Shao-Yuan Chuang PhD
The Association of Clinical Symptomatic Hypoglycemia with Cardiovascular Events and Total Death in Type 2 Diabetes Mellitus A nationwide population-based study Pai-Feng Hsu M.D. Shao-Yuan Chuang PhD Taipei
More informationAutophagy as a therapeutic target for ischaemia/reperfusion injury? Concepts, controversies, and challenges
Cardiovascular Research (2012) 94, 197 205 doi:10.1093/cvr/cvr358 SPOTLIGHT REVIEW Autophagy as a therapeutic target for ischaemia/reperfusion injury? Concepts, controversies, and challenges Karin Przyklenk
More information