The potential of colokinetics to assist in bowel management in people with spinal cord injury Translation from Laboratory to Clinic

Size: px
Start display at page:

Download "The potential of colokinetics to assist in bowel management in people with spinal cord injury Translation from Laboratory to Clinic"

Transcription

1 The potential of colokinetics to assist in bowel management in people with spinal cord injury Translation from Laboratory to Clinic Principal Investigators: John Furness, Albert Frauman, Andrew Ellis, Doug Brown, Dorota Ferens, Melinda Millard, Brid Callaghan, Ruslan Pustovit, Leni Rivera, James Brock, Mark Habgood Connections 2014

2 Living with SCI: The impact of bowel problems Widerström-Noga,1999: reported that 86% of people with SCI had problems with bowel control Snoek 2004: 75% of paraplegics nominated bowel problems as important to solve this was their highest rated problem The daily problem has two parts: The bowel cannot be emptied at will And The individual is fecally incontinent, which means that if there are feces in the bowel they can and will be released spontaneously If the bowel could be emptied in the morning the patient could go about daily life without there being a reservoir of feces threatening to be released Other complications: The bowel cannot be cleared for colonoscopy Bowel function continues to deteriorate. The damaged bowel may have to be removed and the person then has to live with an ileostomy

3 The discovery pathway 2004 A Side effect of a ghrelin receptor agonist developed for disorders of growth and appetite noticed in human trials 2005 Animal investigation of mechanism studies commenced in Melbourne 2006 First evidence that ghrelin receptor agonists stimulate defecation centres in the lumbo-sacral spinal cord published by Melbourne group 2008 Obtained first financial support to study autonomic effects of ghrelin receptor agonists (NHMRC), began local medicinal chemistry collaboration 2009 Data on actions in unanaesthetised animals published by Melbourne group 2009 Obtained TAC support for work in SCI and begin animal proof of principle studies 2010 Pfizer agrees to release Phase 1 and 2 trial data under confidentiality agreement. Proof of Principle experiments underway 2010 Obtain ethics for Human Trial 2011 Animal Proof of Principle data for SCI treatment published, patient recruitment commenced Pfizer and RaQualia agree to transfer of clinical grade compound to us in Melbourne Investigations of second generation compounds 2012 September - trial begins 2014 March - trial complete

4 Average number of pellets, cumulative Effect of the ghrelin receptor agonist, CP464709, on fecal pellet output in the conscious rat ** ** ** CP ** Saline PBS SB Shimizu, Furness et al., Collection times after injection (hr) n=6, mean±sem

5 Defecation control circuits: Intact and SCI Cortical control Medullary relay centres Facilitating & Inhibiting pathways Spinal lesion Enteric reflex pathways Visceral afferents Defecation centres (site of action of ghrelin receptor agonists) Defecation centres at L5- S2 almost always intact Lack of cortical control after SCI Furness 2012

6 Effects of ghrelin and ghrelin agonists on colonic propulsive activity Intrathecal at S1-2 Intrathecal at S1-2 Intravenous Shimizu, Furness et al., 2006

7 Hunne, Furness 2011 Ghrelin receptor in the spinal cord

8 Second generation compound, Ulimorelin, effect on colorectal motility Pustovit et al 2014

9 Animal Proof of Principle: Defecation centre stimulant, Capromorelin, was effective in causing defecation after SCI Ferens et al 2011

10 Capromorelin, effect on colorectal motility 6 weeks after SCI no supersensitivity Ferens et al 2011

11 The Human Trial Open label, ascending dose trial to determine safety and drug handling/ availability in people living with SCI, compared to uninjured controls. Limited dose range and confined to paraplegics to assure safety 5 people with SCI, 10 uninjured controls Pharmacokinetic profile 30 min to 12 h. Follow up at 4 weeks Monitoring blood pressure, heart rate, temperature, fecal output 12 lead ECG Full blood and urine analysis

12 Pharmacokinetics of Capromorelin Peak plasma concentrations were similar, but clearance was slower in those with SCI Andrew Ellis, Albert Frauman 2014

13 Blood Pressures after Capromorelin (SCI) Continuously monitored There was no evidence of any cardiovascular response to capromorelin, even at the highest dose All SCI subjects had a bowel movement within the period of continuous monitoring. There was no instance of associated dysreflexia (5 subjects x 3 doses) Andrew Ellis, Albert Frauman 2014

14 Other parameters after Capromorelin (SCI) Body Temperature and pulse rate No changes Electrocardiogram: No events Blood: No evidence of any changes in blood cells, blood chemistry or liver function Urea, Haematocrit, Bilirubin, Total CO2, Red Cell Count, White Cell Count, Creatinine, Sodium, Potassium, Chloride, Monocytes, Platelets, Lymphocytes, Neutrophils, Basophils, Alkaline Phosphatase, Albumin, Total Protein, Mean Corpuscular Volume, Eosinophils, Gamma Glutamyl Transpeptidase, Alanine Transaminase, Mean Corpuscular Haemoglobin, Globulin, Haemoglobin Urine: No changes ph, Glucose, Bilbruin, Ketone, Specific Gravity, Blood, Protein, Urobilinogen, Nitrite, Leukocytes Physical examination: No change Defecation Time to defecation after capromorelin: 89 +/- 32 min (mean, standard deviation)

15 Conclusions, ongoing and future studies Animal proof of principle studies showed that capromorelin is similarly effective in stimulating defecation in animals with spinal cord injury and in controls In human, capromorelin reached similar levels in blood in SCI and healthy controls, but was metabolised more slowly. There were no adverse effects/ no adverse events in spinal cord injured patients (paraplegics) treated with capromorelin. An animal study of a second generation ghrelin agonist, ulimorelin, showed a stronger effect on defecation and less desensitisation. A planned placebo controlled, randomised multiple repeated dose, double blinded study of capromorelin in quadriplegics has been submitted for ethics approval. This will be supported by TAC, through ISCRR

16 Preclinical Studies Dorota Ferens Mark Habgood James Brock Leni Rivera Ruslan Pustovit Brid Callaghan Medicinal Chemistry Jonathan Baell Pharma Industry Collaboration RaQualia, Pfizer Funding Transport Accident Commission NHMRC In-kind support University of Melbourne Spinal Research Institute Acknowledgements Clinical trials design, ethics Albert Frauman Doug Brown Andrew Ellis Melinda Millard Patient liaison, recruitment, logistics Melinda Millard Doug Brown Albert Frauman Nucleus Network Joanna Gajewski Conduct of Trial, analysis Albert Frauman Andrew Ellis Melinda Millard Nucleus Network

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Test Result Reference Range Flag

Test Result Reference Range Flag Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec

More information

LabDriver Audit Trail Example

LabDriver Audit Trail Example LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Supplementary materials

Supplementary materials Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

What Does My Blood Test Mean

What Does My Blood Test Mean What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

ENROLLMENT CONFIRMATION

ENROLLMENT CONFIRMATION Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431

More information

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer

More information

Glossary of terms used in College examinations. The Royal College of Emergency Medicine

Glossary of terms used in College examinations. The Royal College of Emergency Medicine Glossary of terms used in College examinations The Royal College of Emergency Medicine The CEM uses several terms in examinations that may cause confusion. The following definitions are intended as a guide

More information

BC Biomedical Laboratories Adult Reference Ranges

BC Biomedical Laboratories Adult Reference Ranges BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100

More information

Fullerton Healthcare Screening Centres

Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday

More information

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Goadsby PJ, Reuter U, Hallström Y, et al. A controlled trial

More information

SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION

SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Occupation Agency Code Work Location Work Supervisor Duty tel. #

Occupation Agency Code Work Location Work Supervisor Duty tel. # PRIVACY ACT STATEMENT: This information is subject to the Privacy Act of 1974 (5 U.S.C. Section 552a). This information may be provided to appropriate Government agencies when relevant to civil, criminal

More information

Research Data Available

Research Data Available Research Data Available Main Questionnaire General Topic Socio-economic status Occupational exposure Physical activity Mobile phone usage Sleeping patterns smoking Childhood conditions/illnesses/family

More information

Supplementary Note Details of the patient populations studied Strengths and weakness of the study

Supplementary Note Details of the patient populations studied Strengths and weakness of the study Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined

More information

Australian and New Zealand College of Veterinary Scientists. Fellowship Examination. Equine Medicine Paper 1

Australian and New Zealand College of Veterinary Scientists. Fellowship Examination. Equine Medicine Paper 1 Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2013 Equine Medicine Paper 1 Perusal time: Twenty (20) minutes Time allowed: Four (4) hours after perusal Answer

More information

What if you could help your team realise their health goals?

What if you could help your team realise their health goals? What if you could help your team realise their health goals? Realise Health Plans combine clinical data, lifestyle information and health coaching to help your employees understand their health and make

More information

Scientific Opinion on the safety and efficacy of sodium bisulphate (SBS) for all species as preservative and silage additive 1

Scientific Opinion on the safety and efficacy of sodium bisulphate (SBS) for all species as preservative and silage additive 1 EFSA Journal 2014;12(6):3731 SCIENTIFIC OPINION Scientific Opinion on the safety and efficacy of sodium bisulphate (SBS) for all species as preservative and silage additive 1 EFSA Panel on Additives and

More information

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0

More information

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Pre-Diabetes Treatment Packages

Pre-Diabetes Treatment Packages Pre-Diabetes Treatment Packages Price List - Valid to end September 2018 Type II Diabetes is a serious life-limiting disease which lowers both quality of life and life expectancy. It is a lifestyle disease

More information

AIDS and insurance. Information about the necessity of AIDS testing Implications of undergoing an AIDS test The choices available to you INSURANCE

AIDS and insurance. Information about the necessity of AIDS testing Implications of undergoing an AIDS test The choices available to you INSURANCE INSURANCE AIDS and insurance Information about the necessity of AIDS testing Implications of undergoing an AIDS test The choices available to you Please read carefully NSW and TAS only What is AIDS? AIDS

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

Summary ID# Clinical Study Summary: Study B4Z-JE-LYBD

Summary ID# Clinical Study Summary: Study B4Z-JE-LYBD CT Registry ID#5286 Page 1 Summary ID# 5286 Clinical Study Summary: Study B4Z-JE-LYBD An Open Label, Dose-Titration Safety Study of Hydrochloride in Outpatient Japanese Children with Attention-Deficit/Hyperactivity

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017

M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory

More information

Gemcitabine & Cisplatin

Gemcitabine & Cisplatin Gemcitabine & Cisplatin Available for Routine Use in Burton in-patient Derby in-patient Burton day-case Derby day-case Burton community Derby community Burton out-patient Derby out-patient Indication Advanced

More information

The Blood Chemistry Panel Explained

The Blood Chemistry Panel Explained The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems

More information

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer

More information

2011 FITWAY Allowable CPT Codes (Modifiers are to be reported with appropriate CPT codes at the discretion of the Provider or Facility)

2011 FITWAY Allowable CPT Codes (Modifiers are to be reported with appropriate CPT codes at the discretion of the Provider or Facility) 2011 FITWAY Allowable s (Modifiers are to be reported with appropriate CPT codes at the discretion of the Provider or Facility) Fecal Immunochemical Test (FIT) G0328/ 82274 Colorectal cancer screening

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

Urinary system. Lab-7

Urinary system. Lab-7 Urinary system Lab-7 Excretion: processes that remove wastes and excess materials from the body Urinary system (kidneys): excretes nitrogenous wastes, excess solutes, and water The Kidneys Regulate Water

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Veterinary Emergency and Critical Care Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours

More information

Investigation into the molecular mechanism of action of Triticum aestivum for its activity in Thalassemia

Investigation into the molecular mechanism of action of Triticum aestivum for its activity in Thalassemia Investigation into the molecular mechanism of action of Triticum aestivum for its activity in Thalassemia Clinical study: The clinical study Investigation into the molecular mechanism of action of Triticum

More information

KEY FACTS IN ANAESTHESIA AND INTENSIVE CARE

KEY FACTS IN ANAESTHESIA AND INTENSIVE CARE KEY FACTS IN ANAESTHESIA AND INTENSIVE CARE Alcira Serrano Gomez MD Fellow John Farman Intensive Care Unit Addenbrooke s NHS Trust Cambridge, UK Gilbert R Park MD DMed Sci FRCA Director of Intensive Care

More information

Evaluation of new MiniCollect Z Serum (Separator) Tubes

Evaluation of new MiniCollect Z Serum (Separator) Tubes Evaluation of new MiniCollect Z Serum (Separator) Tubes Background: Greiner Bio-One has developed a newly designed MiniCollect tube offering an integrated collection scoop. The advantage of the new tube

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled

Efficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar

More information

G. Types of White Blood Cells

G. Types of White Blood Cells 1. White blood cells are also called leukocytes. G. Types of White Blood Cells 2. White blood cells function to protect against diseases. 3. Two hormones that stimulate white blood cell production are

More information

Cycle 1-6 (28 Days) Days 15&16 1&2 8. (±2 Days) (±2 Days) (±7 Days) (+7 days) X X X X X X X

Cycle 1-6 (28 Days) Days 15&16 1&2 8. (±2 Days) (±2 Days) (±7 Days) (+7 days) X X X X X X X Table 5 Schedule of Assessments A Cycles A-D and Cycles 1-6 (AZD4573 Monotherapy) Assessment Screen a Intra-subject Dose Escalation/ramp -up (Cycles a-d Cycle=14 days) z Days 1, 2, 15 & 16 Visits 1&2 8

More information

PACKAGE LEAFLET: INFORMATION FOR THE USER. Active substance: enoximone

PACKAGE LEAFLET: INFORMATION FOR THE USER. Active substance: enoximone PACKAGE LEAFLET 1 PACKAGE LEAFLET: INFORMATION FOR THE USER Perfan Injection 100 mg/20 ml Concentrate for Solution for Injection Active substance: enoximone Read all of this leaflet carefully before you

More information

-Renad Habahbeh. -Shahd Alqudah. - Saleem. 1 P a g e

-Renad Habahbeh. -Shahd Alqudah. - Saleem. 1 P a g e -1 -Renad Habahbeh -Shahd Alqudah - Saleem 1 P a g e Introduction: *Hematology and lymph system (MLS): it is a branch of medicine concerned with the study, diagnosis, prevention and treatment of blood

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Hammersmith Medicines Research Limited Cumberland Avenue Park Royal London NW10 7EW Contact: Juan Naveda Tel: +44 (0) 20 8961 4130 Fax: +44

More information

2012 FITWAY Allowable CPT Codes (Modifiers are to be reported with appropriate CPT codes at the discretion of the Provider or Facility)

2012 FITWAY Allowable CPT Codes (Modifiers are to be reported with appropriate CPT codes at the discretion of the Provider or Facility) 2012 FITWAY Allowable s (Modifiers are to be reported with appropriate CPT codes at the discretion of the Provider or Facility) Fecal Immunochemical Test (FIT) G0328/ 82274 Colorectal cancer screening

More information

Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments

Med Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that

More information

Understanding Blood Tests

Understanding Blood Tests PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

CASE-BASED SMALL GROUP DISCUSSION MHD II

CASE-BASED SMALL GROUP DISCUSSION MHD II MHD II, Session 11, Student Copy Page 1 CASE-BASED SMALL GROUP DISCUSSION MHD II Session 11 April 11, 2016 STUDENT COPY MHD II, Session 11, Student Copy Page 2 CASE HISTORY 1 Chief complaint: Our baby

More information

Spinal Cord Injury. R Hamid Consultant Neuro-Urologist London Spinal Injuries Unit, Stanmore & National Hospital for Neurology & Neurosurgery, UCLH

Spinal Cord Injury. R Hamid Consultant Neuro-Urologist London Spinal Injuries Unit, Stanmore & National Hospital for Neurology & Neurosurgery, UCLH Spinal Cord Injury R Hamid Consultant Neuro-Urologist London Spinal Injuries Unit, Stanmore & National Hospital for Neurology & Neurosurgery, UCLH SCI 800 1000 new cases per year in UK Car accidents 35%

More information

Case TWO. Vital Signs: Temperature 36.6degC BP 137/89 HR 110 SpO2 97% on Room Air

Case TWO. Vital Signs: Temperature 36.6degC BP 137/89 HR 110 SpO2 97% on Room Air Mr N is a 64year old Chinese gentleman who is a heavy drinker, still actively drinking, and chronic smoker of >40pack year history. He has a past medical history significant for Hypertension, Hyperlipidemia,

More information

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.

15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150. Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,

More information

* * Interpretation

* * Interpretation LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)

More information

ADPedKD: detailed description of data which will be collected in this registry

ADPedKD: detailed description of data which will be collected in this registry ADPedKD: detailed description of data which will be collected in this registry I. Basic data 1. Patient ID: will be given automatically 2. Personal information - Date of informed consent: DD/MM/YYYY -

More information

Chapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University.

Chapter 4. M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. Chapter 4 M.G.Rajanandh, Department of Pharmacy Practice, SRM College of Pharmacy, SRM University. RBC (Erythrocytes): RBC COUNT: NORMAL VALUES: For men: 4.3-5.9 millions/mm 3 of blood. For women: 3.5-5.0

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.

Evaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr. 5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:

More information

The following is a list of Fee-for-Service (FFS) outpatient laboratory Facility Approval Categories by fee item.

The following is a list of Fee-for-Service (FFS) outpatient laboratory Facility Approval Categories by fee item. MINISTRY OF HEALTH FEE FOR SERVICE OUTPATIENT LABORATORY FACILITY APPROVAL CATEGORIES October 1, 2015 Revised March 15, 2019 Introduction The following is a list of Fee-for-Service (FFS) outpatient laboratory

More information

SHRIRAM INSTITUTE FOR INDUSTRIAL RESEARCH

SHRIRAM INSTITUTE FOR INDUSTRIAL RESEARCH IN RATS SUB CHRONIC ORAL TOXICITY WITH NHH 44 Bt-COTTON SEEDS Report for: UNIVERSITY OF AGRICULTURAL SCIENCES AGRICULTURAL RESEARCH STATION DHARWAD-580007 KARNATAKA Guidelines: DBT, Guidelines for Toxicity

More information

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This

More information

Chapter 12. Capillaries. Circulation. The circulatory system connects with all body tissues

Chapter 12. Capillaries. Circulation. The circulatory system connects with all body tissues Chapter 12 Circulation The circulatory system connects with all body s In many animals, microscopic blood vessels called capillaries Form an intricate network among the Red blood cell song Figure 23.1A

More information

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310) 8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)

More information

HYPERCALCEMIC GOLDEN RETRIEVER

HYPERCALCEMIC GOLDEN RETRIEVER Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.

More information

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0. LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

QUALITY HEALTHCARE MEN'S PHYSICAL CHECK-UP ELIGIBLE TO EARN ASIA MILES

QUALITY HEALTHCARE MEN'S PHYSICAL CHECK-UP ELIGIBLE TO EARN ASIA MILES Detailed Medical History Physical Examination Visual Acuity Body Mass Index & Waist Circumference Package name: PLATINUM EXECUTIVE PREMIUM ELITE CS Code CN72 CN70 CN68 CN66 Screening Purpose Package Price

More information

MOVICOL Launched in Japan -The First Polyethylene Glycol Preparation for Chronic Constipation in Japan-

MOVICOL Launched in Japan -The First Polyethylene Glycol Preparation for Chronic Constipation in Japan- MOVICOL Launched in Japan -The First Polyethylene Glycol Preparation for Chronic Constipation in Japan- This material is an English translation of the press release issued on November 29, 2018 in Japanese,

More information

VOICE Screening Part 1 Visit. Operational Walkthrough Johannesburg, South Africa November 2008

VOICE Screening Part 1 Visit. Operational Walkthrough Johannesburg, South Africa November 2008 VOICE Screening Part 1 Visit Operational Walkthrough Johannesburg, South Africa November 2008 Protocol Requirements Administrative, Behavioral, and Regulatory Procedures Informed consent for screening

More information

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. 1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61

More information

HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE

HEALTH SCREEN CARE. VIGNE Healthcare provides a comprehensive Health Screening Package of EXCLUSIVE HEALTH SCREENING EXPERIENCE HEALTH SCREEN CARE VIGNE Healthcare provides a comprehensive Health Screening Package of Silver Gold Platinum Cancer EXCLUSIVE HEALTH SCREENING EXPERIENCE Meet & Greet Medical Review with Doctor Appointment

More information

Documentation Dissection

Documentation Dissection History of Present Illness: Documentation Dissection The patient is a 50-year-old male c/o symptoms for past 4 months 1, severe 2 bloating and stomach cramps, some nausea, vomiting, diarrhea. In last 3

More information

Results Report. Welcome to Your ABT Report!

Results Report. Welcome to Your ABT Report! Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be

More information

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L

BIOCHEMICAL REPORT. Parameters Unit Finding Normal Value. Lipase U/L Amylase U/L Lipase U/L 88.9 10-195 Amylase U/L 1181.1 371.3-1192.6 West Delhi :- 7/148, Opp. MCD Office, Major Pankaj Batra Marg, Near Ramesh Nagar, New Delhi-15, Ph. : 011-47562566,9999830187 Liver Function Test

More information

Chapter 23. Circulation

Chapter 23. Circulation Chapter 23 Circulation Standards CORE: I can describe the components and function of blood. I can describe structure and function of blood vessels. I can compare and contrast systemic and pulmonary systems.

More information

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL SUPPLEMENTAL MATERIAL Randomized Controlled Trial of to Increase Serum Bicarbonate in Chronic Kidney Disease Patients David A. Bushinsky a, Thomas Hostetter b, Gerrit Klaerner c, Yuri Stasiv c, Claire

More information

Refugee Health Funding Models: A Review of PA Models and A Vision for the Future

Refugee Health Funding Models: A Review of PA Models and A Vision for the Future Refugee Health Funding Models: A Review of PA Models and A Vision for the Future Gretchen Shanfeld, MPH Director of Health and Wellness, Nationalities Service Center Coordinator, Philadelphia Refugee Health

More information

I. Anatomy of the Urinary System A. Kidneys 1. Right lower than Left* 2. Retroperitoneal 3. Layers that secure kidneys in the abdominal cavity a.

I. Anatomy of the Urinary System A. Kidneys 1. Right lower than Left* 2. Retroperitoneal 3. Layers that secure kidneys in the abdominal cavity a. I. Anatomy of the Urinary System A. Kidneys 1. Right lower than Left* 2. Retroperitoneal 3. Layers that secure kidneys in the abdominal cavity a. Renal fascia b. Perinephric fat (Adipose) capsule c. Fibrous

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Ltd Pathology Department Contact: Sally Curtis BMI The Priory Hospital Tel: +44 (0) 20 7307 7342 Priory Road E-Mail: sally.curtis@tdlpathology.com

More information

Case presentation. Dr Rammohan Reddy 1 st year PG, Dept of DVL, Kamineni Institute of Medical Sciences, Narketpally.

Case presentation. Dr Rammohan Reddy 1 st year PG, Dept of DVL, Kamineni Institute of Medical Sciences, Narketpally. Case presentation Dr Rammohan Reddy 1 st year PG, Dept of DVL, Kamineni Institute of Medical Sciences, Narketpally. Name : XXX Age : 33 years Sex : Female Occupation : Farmer IP no : 201608905 DOA : 15-02-2016

More information

Renal Physiology: Filling of the Urinary Bladder, Micturition, Physiologic Basis of some Renal Function Tests. Amelyn R.

Renal Physiology: Filling of the Urinary Bladder, Micturition, Physiologic Basis of some Renal Function Tests. Amelyn R. Renal Physiology: Filling of the Urinary Bladder, Micturition, Physiologic Basis of some Renal Function Tests Amelyn R. Rafael, MD 1 Functions of the Urinary Bladder 1. storage of urine 150 cc 1 st urge

More information

Inspector's Accreditation Unit Activity Menu

Inspector's Accreditation Unit Activity Menu 01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,

More information

Online catalog

Online catalog This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)

More information

Please contact the Client Services Team if you require further information.

Please contact the Client Services Team if you require further information. Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used

More information

Renal Adjuvant MultiPle Arm Randomised Trial (RAMPART): Eligibility, Screening & Treatment

Renal Adjuvant MultiPle Arm Randomised Trial (RAMPART): Eligibility, Screening & Treatment Renal Adjuvant MultiPle Arm Randomised Trial (RAMPART): Eligibility, Screening & Treatment Sponsor: University College London Lead Trials Unit: MRC CTU at UCL Chief Investigator: Dr James Larkin Independent

More information

Evidence that stimulation of ghrelin receptors in the spinal cord initiates propulsive activity in the colon of the rat

Evidence that stimulation of ghrelin receptors in the spinal cord initiates propulsive activity in the colon of the rat J Physiol 576.1 (2006) pp 329 338 329 Evidence that stimulation of ghrelin receptors in the spinal cord initiates propulsive activity in the colon of the rat Yasutake Shimizu 1,2, Ed C. Chang 1, Anthony

More information

VICTOSA and Renal impairment DR.R.S.SAJAD

VICTOSA and Renal impairment DR.R.S.SAJAD VICTOSA and Renal impairment DR.R.S.SAJAD February 2019 Main effect of GLP-1 is : Stimulating glucose dependent insulin release from the pancreatic islets. Slow gastric emptying Inhibit inappropriate

More information

describe the location of the kidneys relative to the vertebral column:

describe the location of the kidneys relative to the vertebral column: Basic A & P II Dr. L. Bacha Chapter Outline (Martini & Nath 2010) list the three major functions of the urinary system: by examining Fig. 24-1, list the organs of the urinary system: describe the location

More information