The sulfhydryl-containing amino acid homocysteine

Size: px
Start display at page:

Download "The sulfhydryl-containing amino acid homocysteine"

Transcription

1 Differences in Betaine-Homocysteine Methyltransferase Expression, Endoplasmic Reticulum Stress Response, and Liver Injury Between Alcohol-Fed Mice and Rats Masao Shinohara, Cheng Ji, and Neil Kaplowitz Chronic ethanol infusion resulted in greater serum alanine aminotransferase elevation, lipid accumulation, necroinflammation, and focal hepatic cell death in mice than rats. Mice exhibited a remarkable hyperhomocysteinemia but no increase was seen in rats. Similarly, a high-methionine low-folate diet (HMLF) induced less steatosis, serum alanine aminotransferase increase, and hyperhomocysteinemia in rats than in mice. Western blot analysis of betaine homocysteine methyltransferase (BHMT) expression showed that rats fed either ethanol or HMLF had significantly increased BHMT expression, which did not occur in mice. Nuclear factor- B p65 was increased in mouse in response to alcohol feeding. The human BHMT promoter was repressed by homocysteine in mouse hepatocytes but not rat hepatocytes. BHMT induction was faster and greater in primary rat hepatocytes than mouse hepatocytes in response to exogenous homocysteine exposure. Mice fed ethanol intragastrically exhibited an increase in glucose-regulated protein 78 and inositol-requiring enzyme 1, which was not seen in the rat, and sterol regulatory element binding protein 1 was increased to a greater extent in mice than rats. Thus, rats are more resistant to ethanol-induced steatosis, endoplasmic reticulum stress, and hyperhomocysteinemia, and this correlates with induction of BHMT in rats. Conclusion: These findings support the hypothesis that a critical factor in the pathogenesis of alcoholic liver injury is the enhanced ability of rat or impaired ability of mouse to up-regulate BHMT which prevents hyperhomocysteinemia, endoplasmic reticulum stress, and liver injury. (HEPATOLOGY 2010;51: ) Abbreviations: BHMT, betaine-homocysteine methyltransferase; C/EBP, CCAAT-enhance-binding proteins ; ER, endoplasmic reticulum; GRP78, glucose-regulated protein 78; Hcy, homocysteine; HNF4, hepatocyte nuclear factor 4 ; IRF, interferon regulatory factor; IRE, inositol-requiring enzyme; NF- B, nuclear factor B; SAH, S-adenosylhomocysteine; SAM, S-adenosylmethionine; SREBP, sterol regulatory element binding protein. From the University of Southern California (USC) Research Center for Liver Disease, USC/University of California Los Angeles (UCLA) Research Center for Alcoholic Liver and Pancreas Diseases, Department of Medicine, Keck School of Medicine, University of Southern California, Los Angeles, CA. Received May 25, 2009; accepted October 12, Address reprint requests to: Dr. Cheng Ji, Ph.D., Gastroenterology/Liver Division, Keck School of Medicine, University of Southern California, HMR-101, 2011 Zonal Avenue, Los Angeles, CA chengji@usc.edu; fax: Copyright 2009 by the American Association for the Study of Liver Diseases. Published online in Wiley InterScience ( DOI /hep Potential conflict of interest: Nothing to report. Additional Supporting Information may be found in the online version of this article. The sulfhydryl-containing amino acid homocysteine (Hcy) is an intermediate of normal methionine metabolism. Hcy has unique biochemical properties that can both support a wide range of molecular effects and promote oxidant stress. Elevated Hcy in the blood, a condition termed hyperhomocysteinemia (HHcy) is implicated in a variety of diseases including vascular, central nervous system, and liver disease. 1-4 Accumulating evidence links hyperhomocysteinemia to endoplasmic reticulum (ER) stress in diet models and in both knockout mice and humans with altered Hcy metabolism. 5,6 In all models of nonalcoholic HHcy (5,10-methylene tetrahydrofolate reductase [MTHFR] /, cystathionine -synthase [CBS] /, high-methionine/low-folate diet), hepatic steatosis and ER stress with variable necroinflammation and apoptosis are observed Our previous work has particularly linked HHcy to alcoholic liver injury. The intragastric alcohol feeding exhibited a striking 5-fold to 10-fold increase in mouse plasma Hcy which was associated with ER stress response as indicated by altered expression of a set of ER stress markers such as molecular chaperone glucose-regulated protein 78 (GRP78 or BiP), sterol regulatory element binding proteins (SREBPs) that regulate liver lipid synthesis, and CCAAT-enhanced binding protein (C/EBP)- homologous protein (CHOP or GADD153) that mediates cell death

2 HEPATOLOGY, Vol. 51, No. 3, 2010 SHINOHARA, JI, AND KAPLOWITZ 797 The pathways for Hcy removal involve three choices: (1) conversion of Hcy to S-adenosylhomocysteine (SAH) by SAH hydrolase (which has bidirectional activity); (2) conversion of Hcy to cystathionine by CBS, ultimately leading to cysteine formation (trans-sulfuration); (3) the remethylation of Hcy to methionine for biosynthesis of S-adenosylmethionine (SAM) in a reaction catalyzed mostly in the liver by methionine adenosyltransferase 1a (MAT1a). 1,16 The remethylation pathway is carried out by methionine synthase (MS) (methyl tetrahydrofolate is the methyl donor substrate) and betaine-homocysteine methyltransferase (BHMT) (betaine is the methyl donor substrate) MS is ubiquitous and BHMT is expressed exclusively in hepatocytes and renal cells. Under normal conditions, about half of the Hcy produced in hepatocytes is remethylated with MS and BHMT contributing approximately equally. 19 Interestingly, BHMT has been a focus in this field of research because of its specificity of expression in the liver and because its substrate, betaine, is inexpensive and much more stable than SAM when consumed Betaine supplementation in mice with intragastric alcohol infusion abrogated alcohol-induced HHcy and ER stress response in parallel with decreased alanine aminotransferase (ALT) and ameliorated liver steatosis and apoptosis. 12 BHMT overexpression in HepG2 cells inhibited Hcy-induced ER stress response, lipid accumulation, and cell death. 23 Transgenic mice expressing human BHMT in organs peripheral to the liver are resistant to HHcy and fatty liver induced by chronic alcohol infusion or a high methionine and low folate (HMLF) diet. 24 However, in an attempt to extend this study from mice to rats, we found a striking species difference between the induction of HHcy in response of rats and mice to intragastric feeding of alcohol. Rats are relatively resistant, developing much more modest steatosis and injury than mice. This article documents the difference in response between species and explores potential mechanisms generating further evidence for the role of Hcy and ER stress in the pathogenesis of alcoholic liver disease. Materials and Methods Animal Models Mice and Rats with Intragastric Ethanol Infusion. Male C57B6 mice from the Jackson Laboratory (Bar Harbor, ME) and male Wistar rats from Harlan Laboratories (Indianapolis, IN) were used for the studies. The intragastric ethanol infusion model was described previously 12,15,25 and was performed in the Animal Core (USC/ UCLA Research Center for Alcoholic Liver and Pancreatic Diseases). Total caloric intake derived from the diet and ethanol was set at 533 cal/kg body weight, and the caloric percentages of ethanol, dietary carbohydrate (dextrose), protein (lactalbumin hydrolysate), and fat (corn oil) were 24.3%, 15.7%, 25%, and 35%, respectively. Adequate vitamin and salt mix were included at the recommended amounts by the Committee on Animal Nutrition of the National Research Council (AIN-76A, 4.42 g/l and 15.4 g/l, respectively; Dyets Inc., Bethlehem, PA). The diet and ethanol/dextrose infusion rate for mice was 400 ml/kg body weight/day for 4 weeks and the rate for rats was 120 ml/kg body weight/day for 6 weeks. The rats and mice received different amount of alcohol based on metabolic rate and both received the same 568 cal/kg/day. 25 Blood alcohol levels at the time of sacrifice (1-2 hours after disconnection of the feeding catheters) were mg/dl in mice and mg/dl in rats. Mice and Rats Fed a High-Methionine and Low- Folate Diet. Mice and rats were fed orally a HMLF diet (TD 98272) or equal amount of control diet (TD 05552) from Harlan (Madison, WI). 24 The HMLF diet contained 2% (wt/wt) of L-methionine and 0.015% (wt/wt) of folate. Serum and liver tissue samples were taken for analysis after 10-week feeding. All the animals were treated in accordance with the Guide for Care and Use of Laboratory Animals. 26 Histological Staining Detailed procedures for hematoxylin and eosin (H&E), and terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate nick-end labeling (TUNEL) staining were described previously. 12,13 Briefly, at the time of sacrificing, small pieces of liver tissue were harvested and fixed immediately in 3% paraformaldehyde (Sigma) for 4 hours and then transferred to 80% ethanol. After paraffin embedding, 5- m transverse sections were prepared and stained. Apoptotic hepatocytes were detected by the Cell and Tissue Imaging Core (USC Research Center for Liver Diseases) according to the TUNEL procedures with a TACS TdT Kit (R&D Systems Inc., Minneapolis, MN). Apoptosis rates were expressed as total TUNEL-positive cells in five microscope fields at 200 magnification. In Vitro Studies with Primary Mouse and Rat Hepatocytes The primary mouse and rat hepatocytes were provided by the Cell Culture Core (USC Research Center for Liver Diseases). The culturing of primary hepatocytes was described previously. 13,23 The hepatocytes were treated with 0-5 mm of Hcy for 0-24 hours. The intracellular concentrations achieved at 5 mm of exogenous Hcy are similar to what is seen in vivo in HHcy. 23,27 In some experiments, the hepatocytes were pretreated with betaine (1 mm), SAMe (3 mm), or methylthioadenosine (MTA; 0.5 mm)

3 798 SHINOHARA, JI, AND KAPLOWITZ HEPATOLOGY, March hour before the homocysteine treatments. The treated cells were either washed three times with cold 1 phosphate-buffered saline (PBS) and scratched off for extraction of DNA, RNA, and proteins, or stained for cell death. The cells were doubly stained with Sytox green (1 M; Molecular Probes, Eugene, OR) and Hoechst dye (8 g/ml; Sigma) for 30 minutes at 37 C. Cell death (combination of necrosis and apoptosis) was counted according to a previously described method. 13,23 Transfection and Luciferase Reporter Assays Primary mouse and rat hepatocytes plated on six-well plates were transiently transfected with a luciferase reporter or a promoterless pgl3-basic vector using the Targetfect-hepatocyte kit (Targeting System, Santee, CA). The luciferase reporter construct contained firefly luciferase gene which was under control of the promoter of human BHMT. 28 The primary cells were cotransfected with the Renilla prl-sv40 vector (Promega, Madison, WI) to control the transfection efficiency. Homocysteine (5 mm) or betaine (1 mm) was added to the transfected cell culture 12 hours after the transfection. Twelve hours after Hcy or betaine treatment, the cells were harvested and lysed in 200 L of reporter lysis buffer (Luciferase Assay System; Promega). Aliquots of the cell lysates were dually assessed for firefly and Renilla luciferase activities using a TD-20/20 luminometer (Promega). The luciferase activity driven by the BHMT promoter was expressed as a ratio of firefly to Renilla activity. Molecular and Metabolite Assays Western Blot. Proteins were extracted according to the method previously reported. 12,23 Proteins were routinely analyzed by immunoblotting using horseradish peroxidase labeled or alkaline phosphatase labeled secondary antibodies. Primary antibodies against SREBP1, inositol-requiring enzyme 1 (IRE1), methionine adenosyltransferase 1 (MAT1), MAT3, nuclear factor B(NF- B), GATA (transcription factor binding the WGATAR consensus sequence), C/EBP, COUP-TF1 (chicken ovalbumin upstream promoter transcription factor 1), hepatocyte nuclear factor 4 (HNF4 ), interferon regulatory factor 1 (IRF-1), IRF-2, CoxIV (cytochrome c oxidase), and -actin were purchased from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Antibodies against GRP78 (Bip) were purchased from Cell Signaling Technology (Danvers, MA). Anti-BHMT antibodies were self-made and described previously. 23,24 Proteins were visualized using LumiGLO Reagent (Cell Signaling Technology) on CL-Xposure films (Pierce, Rockford, IL) at an optimized time point. The intensity of protein bands on the western blots were quantified with the NIH software, ImageJ, after western blots of protein samples were scanned into TIF files. Analysis of ALT, Lipid, Homocysteine, and Betaine. Plasma ALT and Hcy measurements and lipid extraction and analysis were described previously. 12,13,24 To check intracellular Hcy levels, hepatocytes ( ) were homogenized and incubated in 50 L of 7,7- dimethylhept-2-ene-4-ynal (TBF) at 4 C for 30 minutes. The homogenate was mixed with 500 L of trichloroacetic acid (TCA, 10%) and 1 mm ethylene diamine tetraacetic acid (EDTA), and centrifuged at 100g for 5 minutes. The resultant supernatant (100 L) was mixed with 20 L of 1.55M NaOH, 150 L of 125 mm sodium borate and 4 mm EDTA (ph 9.5), and 100 L of SBD-F solution containing 1 mg/ml ammonium 7-fluorobenzo- 2-oxa-1,3-diazole-4-sulfonate and 125 mm sodium borate (ph 9.5). The mixture was incubated in a 60 C water bath for 1 hour and L of the mixture was injected into a column (C18 Axxi-Chrom 5 m pore size, 4.6 mm 250 mm) for high-performance liquid chromatography (HPLC) analysis by monitoring fluorescence (excitation at 385 nm and emission at 515 nm). To measure betaine, 10 L of the liver tissue or cell homogenate was mixed with 10 LofKH 2 PO 4,90 Lof p-bromophenacyl-8 reagent (Pierce, Rockford, IL), and 90 L of 90% acetonitrile. The mixture was incubated at 80 C for 1 hour and then centrifuged at 20,800 g for 4 minutes. The resultant supernatant ( L) was injected into a column (Supelco LC-SCX 5, mm [Ion Exchange]) for HPLC analysis by detecting absorbance at 254 nm. Hcy and betaine standards were injected into the corresponding HPLC columns for reference and quantitation. Statistical Analysis Experiments were performed with 3-6 mice or rats per group with values presented as mean standard deviation. Primary hepatocyte culture experiments were performed on at least three separate preparations with each condition assessed in triplicate. Comparisons between two groups were by t test and among multiple groups by analysis of variance with correction for small sample size. A P value 0.05 was considered significant. Results Pathological Differences Between Alcohol-Fed or High Methionine Fed Mouse and Rat Chronic alcohol feeding increased plasma ALT by more than 10-fold in mice and by two-fold in rats (Fig. 1A). Plasma Hcy was increased by the alcohol feeding by seven-fold in mice but was not increased in rats (Fig. 1B).

4 HEPATOLOGY, Vol. 51, No. 3, 2010 SHINOHARA, JI, AND KAPLOWITZ 799 Fig. 1. Plasma alanine aminotransferase (ALT) and homocysteine in mice versus rats fed alcohol intragastrically or fed a high methionine, low folate diet (HMLF) orally. CF, pair-fed control; EtOH, fed alcohol; HM, fed HMLF; *P 0.05; **P 0.01, n 6 mice or rats in the EtOH-fed group; n 3-5 mice or rats in the HMLF-fed group. Chronic feeding of the high methionine diet increased plasma ALT by five-fold in mice but by less than one-fold in rats (Fig. 1C). Plasma Hcy was increased by more than 20-fold in mice and by eight-fold in rats (Fig. 1D). The HMLF diet feeding did not significantly reduce liver betaine levels in either mice ( mol/g liver tissue versus control of mol/g) or rats ( mol/g liver versus control of mol/g). Similar results (no significant changes) in liver betaine levels were detected in alcohol-fed mice ( mol/g liver tissue versus control of mol/g) or alcohol-fed rats ( mol/g liver versus control of mol/g). Alcohol feeding induced fatty liver in both species. However, severity of alcohol-induced fatty liver was much greater in mice than in rats (Fig. 2). Liver triglycerides and cholesterol were increased by more than four-fold in mice fed alcohol but by less than two-fold in rats fed alcohol (Fig. 2C). Significant increase in liver lipids was detected in mice but not in rats in response to the chronic high methionine feeding (Fig. 3). In the model of intragastric alcohol feeding, foamy fatty changes, fat granuloma, focal hepatic necrosis, and apoptosis could be observed consistently in mice but not in rats (data not shown). The TUNEL-positive liver cells in alcohol-fed mice ( /five microscope fields) was significantly higher than in pair-fed control ( / five microscope fields, P 0.05). No significant difference in the TUNEL-positive liver cells was found in rats between pair-fed ( ) and alcohol-fed ( ) animals. Different Expression of BHMT and Selective ER Stress Markers and Transcription Factors in Mouse and Rat Previously we demonstrated that BHMT played an important role in alcohol-induced HHcy, ER stress, and liver injury. 12,23,24 To know whether it is associated with the pathological differences between mouse and rat, we examined BHMT expression in the liver of these animals. Consistent with our previous findings, no significant changes in BHMT protein levels were detected in mice fed alcohol or the high methionine diet (Fig. 4). In contrast, BHMT expression was increased in rats in response to either chronic alcohol or the high methionine diet feed-

5 800 SHINOHARA, JI, AND KAPLOWITZ HEPATOLOGY, March week intragastric alcohol feeding and found no significant difference (Supporting Fig. 1). Furthermore, we previously reported that BHMT messenger RNA and activity were not increased after two or more weeks of ethanol feeding. 13 The rat and mouse promoters share 65% homology, and examination of the sequences in the promoter reveals some transcription factor consensus binding sites which Fig. 2. Fat accumulation in mice fed alcohol intragastrically compared to rats fed alcohol intragastrically. H&E staining (200 ) of liver tissues from (A) mice and from (B) rats. (C) Liver triglycerides and cholesterol in mice and rats fed alcohol intragastrically. CF, pair-fed control; EtOH, fed alcohol; *P 0.05; **P 0.01, compared between CF and EtOH; P 0.05 compared between mice and rats, n 6. ing. Corresponding to this, selective ER stress markers including GRP78, IRE1, and activated SREBP1c were either not increased or slightly increased in rats, whereas all the ER stress markers were significantly increased in alcohol-fed mice (Fig. 4C,D). Although our results show no increase in BHMT in ethanol-fed mice at 4 weeks, to be sure we did not miss a transient early induction, we used western blots normalized to actin in order to examine BHMT expression after Fig. 3. Fat accumulation in mice fed a high methionine, low folate diet (HMLF) orally compared to rats fed HMLF orally. H&E staining (200 ) of liver tissues from (A) mice and from (B) rats. (C) Liver triglycerides and cholesterol in mice and rats fed HMLF. CF, pair-fed control; HM, fed HMLF; *P 0.05, compared between CF and HM; P 0.05 compared between mice and rats, n 3-5.

6 HEPATOLOGY, Vol. 51, No. 3, 2010 SHINOHARA, JI, AND KAPLOWITZ 801 decreased in alcohol-fed rats but not mice. No change was detected in the expression of COUP-TF1, C/EBP, IRF1, and IRF2 in either mice or rats fed alcohol. Comparison of Response in Primary Mouse and Rat Hepatocytes Activities of Human BHMT Promoter. The luciferase expression driven by the human BHMT promoter was detected in both mouse and rat primary hepatocytes after a transient transfection of the BHMT luciferase reporter construct (Fig. 6). In mouse primary hepatocytes, the human BHMT promoter activities were inhibited by more than 50% after treatment of Hcy, which was recovered in the presence of betaine. In comparison, neither Hcy nor betaine treatment exerted significant effects on the promoter activities in primary rat hepatocytes. Effects of Homocysteine on Cell Death and BHMT Expression. Homocysteine treatment induced cell death detected by Sytox green staining in both primary mouse and rat hepatocytes. There were small differences between species in the cell death rate at low concentration range of Hcy (less than 5 mm) (Fig. 7). The species differences of the cell death rate became larger as the Hcy concentration Fig. 4. Expression of betaine-homocysteine methyltransferase (BHMT) and selective ER stress markers in the livers of mice versus rats fed alcohol intragastrically or fed a high methionine low folate diet (HMLF) orally. (A) Western blots of BHMT; (B) relative BHMT protein expression normalized to -actin; (C) western blots of ER markers; and (D) relative levels of ER markers normalized to -actin. CF, pair-fed control; E or EtOH, fed alcohol; H or HM, fed HMLF; GRP78, glucose regulated protein 78; SREBP1, sterol regulatory element binding protein 1; IRE1, the type I transmembrane protein kinase endoribonucleases. *P 0.05; **P 0.01 compared between CF and EtOH, or between CF and HM; P 0.05 compared between mice and rats; n 3. are either present in both species (NF- B, GATA, COUP-TF, HNF4 ) or present in rat but not mouse promoter (e.g., C/EBP, IRF-1, IRF-2). Expression of these transcription factors were examined in mouse and rat in response to chronic alcohol versus pair feeding (Fig. 5). Increase of nuclear NF- B was detected in mice but not rats fed alcohol. Nuclear HNF4 and GATA1 were Fig. 5. Expression of transcription factors in the livers of mice versus rats fed alcohol intragastrically. CF, pair-fed control; E, fed alcohol; NF- B, nuclear factor B; HNF4, hepatic nuclear factor 4; GATA, factor binding the WGATAR consensus sequence; C/EBP, CCAAT-enhanced binding proteins; COUP-TF1, one of the orphan members of the steroid hormone receptor family; IRF1 and IRF2, interferon regulatory factor 1, 2; -actin, for normalization of proteins in the whole protein extracts. Nucleolin, eukaryotic nuclear phosphoprotein used as a marker for nuclear extracts.

7 802 SHINOHARA, JI, AND KAPLOWITZ HEPATOLOGY, March 2010 Fig. 6. Activities of human BHMT promoter and homocysteine-induced hepatocytes. The promoter activities were reported by Luciferase activities which were expressed as ratios of firefly to Renilla activity. Renilla gene was under control of SV40 promoter and was cotransfected. (a) Control, transfected with promoterless firefly construct; (b) transfected with promoterless firefly construct and treated with homocysteine (5 mm); (c) transfected with firefly construct under control of hbhmt promoter, (d) transfected with firefly construct under control of hbhmt promoter treated with homocysteine (5 mm); (e) transfected with firefly construct under control of hbhmt promoter treated with betaine (1 mm); (f) transfected with firefly construct under control of hbhmt promoter in the presence of homocysteine and betaine. Fold-change is compared to (a). *P 0.05 compared between (c) and (d) or (d) and (e), n 3. Cells were treated for 16 hours. increased (greater than 5 mm). At 10 mm, the cell death rate was nearly 40% in mouse hepatocytes whereas the cell death rate was less than 20% in rat hepatocytes. To further define the different BHMT expression, experiments on dose response and time course in response to Hcy treatment were conducted. BHMT expression in mouse hepatocytes was increased by Hcy at 1 mm and the induction was decreased at 5 mm (Fig. 7C). In comparison, BHMT expression started to rise at 0.5 mm and the induction remained from 0.5 through 5 mm. Treatment with 5 mm Hcy increased BHMT expression in mouse hepatocytes at 12 hours, and the induction became minimal at 18 hours (Fig. 7C,D). In contrast, the same Hcy treatment increased BHMT expression in rat hepatocytes as early as 6 hours, and the induction lasted until 18 hours. The results suggest that rat hepatocytes are more resistant than mouse hepatocytes to prolonged and high concentrations of Hcy exposure. In contrast to greater Hcy-induced expression of BHMT in rat hepatocytes, betaine induced BHMT only in mouse hepatocytes (Fig. 8). There was a small decrease in BHMT in mouse but not rat hepatocytes treated with SAM, consistent with studies by others 28 on hbhmt promoter in HepG2 cells. However, under these conditions MTA has no effect. In mouse hepatocytes, Mat1 expression was not affected by betaine, SAM, or MTA treatment (Fig. 8) and was not affected by Hcy treatment (not shown). Discussion Chronic ethanol feeding resulted in greater serum ALT elevation, lipid accumulation, necroinflammation, and focal hepatic cell death in mice than rats. Mice exhibited a striking HHcy but no increase was seen in rats. Similarly, the HMLF diet induced less steatosis, serum ALT increase, and HHcy in rats than in mice. Western blot analysis of BHMT expression showed that rats fed either ethanol or HMLF increased BHMT expression which did not occur in mice. Although an in vivo time course study of Hcy levels is needed to exclude the possibility that an early increase in Hcy in rats fed alcohol or HMLF may be followed by induction of BHMT with subsequent lowering of Hcy, a species difference firmly exists in the response of BHMT. One question could be whether the difference in amount of ethanol given to mice versus rats (twice on a per kilogram per day basis), which is based on higher metabolic rate in mice, is responsible for the more severe alcoholic steatohepatitis in mice. We believe this is unlikely because there was no difference between the two species in the blood alcohol levels at the time of sacrifice. In addition, the findings with the HMLF feeding model show that resistance of the rat to HHcy and steatohepatitis was independent of alcohol. 24 Precisely what alcohol and HMLF have in common to affect BHMT is not certain but seems likely to be related to the effect of both on Hcy metabolism. Mice fed ethanol intragastrically exhibited an increase in GRP78 and IRE1 which was not seen or blunted in the rat and SREBP-1 was increased to a greater extent in mice than rats. Thus, rats are more resistant to ethanol-induced and HMLF-induced steatosis, ER stress, and HHcy, and this correlates with induction of BHMT in rats. These findings support the hypothesis that a key factor in the pathogenesis of alcoholic liver injury is the enhanced ability of rat or impaired ability of mouse to up-regulate BHMT. Because BHMT expression was increased in vivo in alcohol-fed and HMLF-fed rats but not in mice, we examined differences in nuclear extracts for potential transcriptional regulators predicted to interact with the BHMT promoter. Increased nuclear NF- B (p65) was found in mice and decreased HNF4 was found in rats fed alcohol. The theoretical possibility of decreased repression by diminished HNF4 will require further study. However, the difference in p65 is potentially relevant because NF- B has been shown to repress the human BHMT promoter. Thus, one possibility is that alcohol leads to tumor necrosis factor induced or oxidative stress induced activation of NF- B in hepatocytes in the

8 HEPATOLOGY, Vol. 51, No. 3, 2010 SHINOHARA, JI, AND KAPLOWITZ 803 Fig. 7. Effects of homocysteine on cell death and BHMT expression in mouse versus rat primary hepatocytes. (A) Homocysteine-induced cell death in primary mouse hepatocytes; (B) Homocysteine-induced cell death in primary rat hepatocytes; (C) Dose response of BHMT expression to homocysteine exposure for 12 hours; (D) Time course of BHMT expression in response to homocysteine. Graphs depict relative protein expression of BHMT normalized to CoxIV. *P 0.05; **P compared to zero hour or zero concentration, n 3. mouse, which inhibits an adaptive response (BHMT induction) to Hcy accumulation. More work will be needed to address this possibility and to see if NF- B is the cause of the BHMT repression in mice or is simply a reflection of more severe injury. Although a difference in NF- B activity might contribute to blocking BHMT induction, we examined alternative possibilities which might help to explain the species difference. First, we used the human BHMT reporter transfected into mouse and rat hepatocytes. The reporter activity was repressed by Hcy in the mouse cells but not the rat cells. The repression by Hcy was inhibited by concomitant exposure to betaine. These indicate that Hcy either directly or indirectly represses the promoter because of a trans-effect independent of any species difference in the promoter itself, in this case the human promoter, so the repression of BHMT expression by Hcy is context-dependent. Our previous work showed no increase in NF- B activation in Hcy-treated mouse hepatocytes so other mechanisms or responses of mouse hepatocytes to Hcy which account for this repression of BHMT remain to be identified. Aside from some factor repressing or preventing induction of BHMT in mouse liver, the induction in rat liver is a distinct issue. We therefore examined induction of BHMT by Hcy in primary mouse and rat hepatocytes. A species difference was confirmed. Although some induction occurred in mouse hepatocytes, it was of lesser magnitude. Thus, rat hepatocytes exhibited induction of BHMT at lower concentrations of Hcy and after shorter exposure. Clearly, both the human BHMT response and primary hepatocyte experiments support the in vivo observations showing resistance of rats to HHcy coupled with induction of BHMT; however, caution is required in extrapolating the in vitro experiments to the in vivo situation, because the Hcy exposures in vitro are of short

9 804 SHINOHARA, JI, AND KAPLOWITZ HEPATOLOGY, March 2010 Fig. 8. Effects of betaine, S-adenosylmethionine (SAM), and methylthioadenosine (MTA) on BHMT and adenosyltransferase (MAT1) expression in mouse versus rat primary hepatocytes. (A) Protein expression in primary mouse hepatocytes. (B) Relative protein expression in primary mouse hepatocytes. (C) Protein expression in primary rat hepatocytes. (D) Relative protein expression in primary rat hepatocytes. 1, PBS: phosphate buffered saline; 2, betaine (1 mm); 3, PBS: phosphate buffered saline; 4, SAM (3 mm); 5, DMSO, dimethyl sulfoxide (1%, wt/wt); 6, MTA (0.5 mm); Cells were treated for 24 hours; *P 0.05, n 3. duration and at high levels. Nevertheless, the data provide support for the hypothesis that a species difference in the regulation of BHMT exists and may be an important determinant of susceptibility to steatohepatitis. The role of cis-effects vesus trans-effects on the BHMT promoter and the various possible trans-effects in mice and rats need further exploration. Another aspect of BHMT regulation is that its expression can be induced by exogenous betaine. We exposed hepatocytes to 1 mm betaine and observed induction in mouse cells but not rat cells. We did not observe induction by betaine with the human BHMT reporter which might suggest that the induciblity of mouse BHMT by betaine is an intrinsic or cis-effect of the promoter. Again, a species difference is observed and the induction of BHMT by betaine feeding in the mouse may contribute to the protection afforded by betaine. Also of note, hepatic betaine levels were in the millimolar range in mice and rats and not significantly decreased by feeding alcohol or HMLF diet. Because the Michaelis constant (K m )of BHMT for betaine is 50 M, the enzyme is saturated under these conditions, thus the change in BHMT levels (i.e., enzyme velocity, V max ) is the major reason for lowering Hcy and there is no limitation on the availability of betaine. Furthermore, these results suggest that the efficacy of feeding betaine in the mouse is due to induction of BHMT and not simply due to provision of more methyl-donor. In summary, rats are more resistant to HHcy, ER stress, and steatohepatitis in response to alcohol or HMLF feeding. Induction of BHMT in the rat correlates with this response and could be an important determinant of resistance of the rat. The regulation of BHMT requires further exploration of the mechanisms for Hcy-induced repression and/or inhibition of induction in mouse hepatocytes as well as induction in rat hepatocytes. In addition, the extent to which BHMT exerts its protective effect by lowering Hcy versus increasing SAM and/or decreasing SAH require more investigation. Irrespective of this, induction of BHMT appears to be a key protective response. Acknowledgment: This research was supported in part by the National Institute of Alcohol Abuse and Alcoholism (R01AA014428, R01AA018846, and P50AA11999) and by the National Institute of Diabetes and Digestive and Kidney Diseases (P30DK048522). Dr. Shinohara is a postdoctoral researcher in Drs. Ji and Kaplowitz s laboratories. We thank Dr. S. C. Lu, Mr. J. Kuhlenkamp, and Dr. M. Ookhtens for helpful discussion and technical assistance. References 1. Finkelstein JD. Methionine metabolism in liver diseases. Am J Clin Nutr 2003;77: Refsum H, Ueland PM, Nygård O, Vollset SE. Homocysteine and cardiovascular disease. Annu Rev Med 1998;49: Troen AM. The central nervous system in animal models of hyperhomocysteinemia. Prog Neuropsychopharmacol Biol Psychiatry 2005;29: Ji C, Kaplowitz N. Hyperhomocysteinemia, endoplasmic reticulum stress, and alcoholic liver injury. World J Gastroenterol 2004;10: Kaplowitz N, Than TA, Shinohara M, Ji C. Endoplasmic reticulum stress and liver injury. Semin Liver Dis 2007;27: Basseri S, Austin RC. ER stress and lipogenesis: a slippery slope toward hepatic steatosis. Dev Cell 2008;15:

10 HEPATOLOGY, Vol. 51, No. 3, 2010 SHINOHARA, JI, AND KAPLOWITZ Oyadomari S, Harding HP, Zhang Y, Oyadomari M, Ron D. Dephosphorylation of translation initiation factor 2alpha enhances glucose tolerance and attenuates hepatosteatosis in mice. Cell Metab 2008;7: Lee AH, Scapa EF, Cohen DE, Glimcher LH. Regulation of hepatic lipogenesis by the transcription factor XBP1. Science 2008;320: Hamelet J, Demuth K, Paul JL, Delabar JM, Janel N. Hyperhomocysteinemia due to cystathionine beta synthase deficiency induces dysregulation of genes involved in hepatic lipid homeostasis in mice. J Hepatol 2007;46: Watanabe M, Osada J, Aratani Y, Kluckman K, Reddick R, Malinow MR, et al. Mice deficient in cystathionine beta-synthase: animal models for mild and severe homocyst(e)inemia. Proc Natl Acad Sci U S A 1995;92: Chen Z, Karaplis AC, Ackerman SL, Pogribny IP, Melnyk S, Lussier-Cacan S, et al. Mice deficient in methylenetetrahydrofolate reductase exhibit hyperhomocysteinemia and decreased methylation capacity, with neuropathology and aortic lipid deposition. Hum Mol Genet 2001;10: Ji C, Kaplowitz N. Betaine decreases hyperhomocysteinemia, endoplasmic reticulum stress, and liver injury in alcohol-fed mice. Gastroenterology 2003;124: Ji C, Deng Q, Kaplowitz N. Role of TNF-alpha in ethanol-induced hyperhomocysteinemia and murine alcoholic liver injury. HEPATOLOGY 2004;40: Ji C, Mehrian-Shai R, Chan C, Hsu YH, Kaplowitz N. Role of CHOP in hepatic apoptosis in the murine model of intragastric ethanol feeding. Alcohol Clin Exp Res 2005;29: Ji C, Chan C, Kaplowitz N. Predominant role of sterol response element binding proteins (SREBP) lipogenic pathways in hepatic steatosis in the murine intragastric ethanol feeding model. J Hepatol 2006;45: Mato JM, Martínez-Chantar ML, Lu SC. Methionine metabolism and liver disease. Annu Rev Nutr 2008;28: Finkelstein JD. Pathways and regulation of homocysteine metabolism in mammals. Semin Thromb Hemost 2000;26: Finkelstein JD. Homocysteine: a history in progress. Nutr Rev 2000;58: Finkelstein JD, Martin JJ. Methionine metabolism in mammals. Distribution of homocysteine between competing pathways. J Biol Chem 1984; 259: Ji C. Dissection of endoplasmic reticulum stress signaling in alcoholic and non-alcoholic liver injury. J Gastroenterol Hepatol 2008;23(Suppl. 1): S16-S Barak AJ, Kemmy RJ, Tuma DJ. The effect of methotrexate on homocysteine methylating agents in rat liver. Drug Nutr Interact 1982;1: Barak AJ, Beckenhauer HC, Tuma DJ. Hepatic transmethylation and blood alcohol levels. Alcohol Alcohol 1991;26: Ji C, Shinohara M, Kuhlenkamp J, Chan C, Kaplowitz N. Mechanisms of protection by the betaine-homocysteine methyltransferase/betaine system in HepG2 cells and primary mouse hepatocytes. HEPATOLOGY 2007;46: Ji C, Shinohara M, Vance D, Than TA, Ookhtens M, Chan C, et al. Effect of transgenic extrahepatic expression of betaine-homocysteine methyltransferase on alcohol or homocysteine-induced fatty liver. Alcohol Clin Exp Res 2008;32: Tsukamoto H, Mkrtchyan H, Dynnyk A. Intragastric ethanol infusion model in rodents. Methods Mol Biol 2008;447: National Institutes of Health. NIH Guide for the Care and Use of Laboratory Animals, Revised (NIH Publication 86-23) Bethesda, MD: National Institutes of Health; Werstuck GH, Lentz SR, Dayal S, Hossain GS, Sood SK, Shi YY, et al. Homocysteine-induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways. J Clin Invest 2001;107: Ou X, Yang H, Ramani K, Ara AI, Chen H, Mato JM, et al. Inhibition of human betaine-homocysteine methyltransferase expression by S- adenosylmethionine and methylthioadenosine. Biochem J 2007;401: Finkelstein JD, Harris BJ, Kyle WE. Methionine metabolism in mammals: kinetic study of betaine-homocysteine methyltransferase. Arch Biochem Biophys 1972;153: Chern MK, Gage DA, Pietruszko R. Betaine aldehyde, betaine, and choline levels in rat livers during ethanol metabolism. Biochem Pharmacol 2000;60: Finkelstein JD. Inborn errors of sulfur-containing amino acid metabolism. J Nutr 2006;136(6 Suppl.):1750S 1754S.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

9 Metabolic trigger: control of methionine metabolism

9 Metabolic trigger: control of methionine metabolism 9 Metabolic trigger: control of methionine metabolism M.V. Martinov 1,V.M.Vitvitsky 1,E.V.Mosharov 2,R.Banerjee 2,F.I.Ataullakhanov 1 1 National Research Center for Hematology, Moscow, Russia 125167 2

More information

2.5. AMPK activity

2.5. AMPK activity Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic

Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity,

More information

Previous studies established associations of abnormal

Previous studies established associations of abnormal Epigenetic Regulation of Hepatic Endoplasmic Reticulum Stress Pathways in the Ethanol-Fed Cystathionine Beta Synthase Deficient Mouse Farah Esfandiari, 1 Valentina Medici, 1 Donna H. Wong, 1 Soumia Jose,

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Kit for assay of thioredoxin

Kit for assay of thioredoxin FkTRX-02-V2 Kit for assay of thioredoxin The thioredoxin system is the major protein disulfide reductase in cells and comprises thioredoxin, thioredoxin reductase and NADPH (1). Thioredoxin systems are

More information

Supplemental Information

Supplemental Information Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total

More information

Supplemental Material:

Supplemental Material: Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of

SUPPLEMENTAL MATERIALS AND METHODS. Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of SUPPLEMENTAL MATERIALS AND METHODS Puromycin-synchronized metabolic labelling - Transfected HepG2 cells were depleted of cysteine and methionine and then treated with 10 μm puromycin in depletion medium

More information

Bioluminescence Resonance Energy Transfer (BRET)-based studies of receptor dynamics in living cells with Berthold s Mithras

Bioluminescence Resonance Energy Transfer (BRET)-based studies of receptor dynamics in living cells with Berthold s Mithras Bioluminescence Resonance Energy Transfer (BRET)-based studies of receptor dynamics in living cells with Berthold s Mithras Tarik Issad, Ralf Jockers and Stefano Marullo 1 Because they play a pivotal role

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

Fluoro Cholesterol Total Cholesterol Assay Kit

Fluoro Cholesterol Total Cholesterol Assay Kit Fluoro Cholesterol Total Cholesterol Assay Kit Contact Information Address Telephone Toll Free Fax General Information Sales Technical Questions Website Cell Technology Inc 950 Rengstorff Ave Suite D Mountain

More information

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla

More information

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment

(Stratagene, La Jolla, CA) (Supplemental Fig. 1A). A 5.4-kb EcoRI fragment SUPPLEMENTAL INFORMATION Supplemental Methods Generation of RyR2-S2808D Mice Murine genomic RyR2 clones were isolated from a 129/SvEvTacfBR λ-phage library (Stratagene, La Jolla, CA) (Supplemental Fig.

More information

!!"#$%&'#()*+,-).(&"/+0&'12'

!!#$%&'#()*+,-).(&/+0&'12' LAB #: Sample Report PATIENT: Sample Patient ID: SEX: Female DOB: 01/01/1985 AGE: 33 CLIENT #: 12345 DOCTOR: Sample Doctor Doctors Data Inc 3755 Illinois Ave St. Charles, IL 60174 U.S.A.!!"#$%&'#()*+,-).(&"/+0&'12'

More information

ab SREBP-2 Translocation Assay Kit (Cell-Based)

ab SREBP-2 Translocation Assay Kit (Cell-Based) ab133114 SREBP-2 Translocation Assay Kit (Cell-Based) Instructions for Use For analysis of translocation of SREBP-2 into nuclei. This product is for research use only and is not intended for diagnostic

More information

Nature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.

Nature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA. Supplementary Figure 1 Fluorescent titration of probe CPDSA. Fluorescent titration of probe CPDSA (10 um) upon addition of GSH in HEPES (10 mm, ph = 7.4) containing 10% DMSO. Each spectrum was recorded

More information

DAG (Diacylglycerol) Assay Kit

DAG (Diacylglycerol) Assay Kit Product Manual DAG (Diacylglycerol) Assay Kit Catalog Number MET-5028 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Diacylglycerols (DAG) are key intermediates in the

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002

Chapter 10. Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10 Introduction to Nutrition and Metabolism, 3 rd edition David A Bender Taylor & Francis Ltd, London 2002 Chapter 10: Integration and Control of Metabolism Press the space bar or click the mouse

More information

UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY

UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY 1 UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GLUCOSE HOMEOSTASIS An Overview WHAT IS HOMEOSTASIS? Homeostasis

More information

0.5. Normalized 95% gray value interval h

0.5. Normalized 95% gray value interval h Normalized 95% gray value interval.5.4.3.2.1 h Supplemental Figure 1: Symptom score of root samples used in the proteomics study. For each time point, the normalized 95% gray value interval is an averaged

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

Cholesterol and Sphingolipids in Non-Alcoholic fatty liver disease.

Cholesterol and Sphingolipids in Non-Alcoholic fatty liver disease. Cholesterol and Sphingolipids in Non-Alcoholic fatty liver disease. José C. Fernández-Checa Liver Unit, Hospital Clinic CIBEK and IDIBAPS Instituto Investigaciones Biomédicas Barcelona Consejo Superior

More information

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao

More information

Alcoholic hepatitis is a drug-induced disorder

Alcoholic hepatitis is a drug-induced disorder Alcoholic hepatitis is a drug-induced disorder Gyongyi Szabo, MD, PhD Professor of Medicine University of Massachusetts Medical School Source: 2 Sobernation.com Clinical Progression of ALD Mortality Acute

More information

Biochemistry: A Short Course

Biochemistry: A Short Course Tymoczko Berg Stryer Biochemistry: A Short Course Second Edition CHAPTER 31 Amino Acid Synthesis 2013 W. H. Freeman and Company Chapter 31 Outline Although the atmosphere is approximately 80% nitrogen,

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

20X Buffer (Tube1) 96-well microplate (12 strips) 1

20X Buffer (Tube1) 96-well microplate (12 strips) 1 PROTOCOL MitoProfile Rapid Microplate Assay Kit for PDH Activity and Quantity (Combines Kit MSP18 & MSP19) 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 MSP20 Rev.1 DESCRIPTION MitoProfile Rapid Microplate

More information

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well

More information

Chinese Journal of Biochemistry and Molecular Biology , GRP78.

Chinese Journal of Biochemistry and Molecular Biology , GRP78. ISSN 100727626 CN 1123870ΠQ Chinese Journal of Biochemistry and Molecular Biology 2008 6 24 (6) :556 562 78 HepG 2 1), 1), 3), 3), 1), 2), 1) 3 ( 1) ; 2) ; 3) ; 100083) : 2008201231 ; : 2008204202 (No130470846

More information

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.

Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or

More information

Interpretation of the liver hypertrophy in the toxicological evaluation of veterinary medicinal products

Interpretation of the liver hypertrophy in the toxicological evaluation of veterinary medicinal products Provisional translation The Food Safety Commission Final decision on September 7, 2017 This English version of the Commission Decision is intended to be reference material to provide convenience for users.

More information

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice

Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8

More information

Total Phosphatidic Acid Assay Kit

Total Phosphatidic Acid Assay Kit Product Manual Total Phosphatidic Acid Assay Kit Catalog Number MET- 5019 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Phosphatidic Acid (PA) is a critical precursor

More information

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury

Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting. protein3) regulate autophagy and mitophagy in renal tubular cells in. acute kidney injury Sestrin2 and BNIP3 (Bcl-2/adenovirus E1B 19kDa-interacting protein3) regulate autophagy and mitophagy in renal tubular cells in acute kidney injury by Masayuki Ishihara 1, Madoka Urushido 2, Kazu Hamada

More information

Recent Studies of Phenylketonuria By: Jennifer Gastelum Dr. Koni Stone Copyright 2014

Recent Studies of Phenylketonuria By: Jennifer Gastelum Dr. Koni Stone Copyright 2014 Recent Studies of Phenylketonuria By: Jennifer Gastelum Dr. Koni Stone Copyright 2014 Phenylketonuria (PKU) is an autosomal recessive genetic disorder that causes an accumulation of toxic metabolites in

More information

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna

Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna Supplementary Figure 1. PAQR3 knockdown inhibits SREBP-2 processing in CHO-7 cells CHO-7 cells were transfected with control sirna or a sirna targeted for hamster PAQR3. At 24 h after the transfection,

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

CBS Deficient Homocystinuria.

CBS Deficient Homocystinuria. CBS Deficient Homocystinuria. Kenneth N. Maclean PhD University of Colorado School of Medicine Department of Pediatrics The methionine cycle Alternative metabolic fates for Hcy Extrusion into the extracellular

More information

The Interaction of Alcohol and Iron-Overload in the in-vivo Regulation of Iron Responsive Genes

The Interaction of Alcohol and Iron-Overload in the in-vivo Regulation of Iron Responsive Genes Cantaurus, Vol. 5, -, May 7 McPherson College Division of Science and Technology The Interaction of Alcohol and Iron-Overload in the in-vivo Regulation of Iron Responsive Genes Callie Crist, Elizabeth

More information

Glutathione Regulation

Glutathione Regulation The Virtual Free Radical School Glutathione Regulation Dale A. Dickinson 1, Henry Jay Forman 1 and Shelly C. Lu 2 1 University of California, Merced, School of Natural Sciences, P.O. Box 2039, Merced,

More information

Fat Metabolism, Insulin and MTHFR

Fat Metabolism, Insulin and MTHFR Fat Metabolism, Insulin and MTHFR BCAA, SAMe and ACAT Carolyn Ledowsky Overview of This Presentation 1. Fat Metabolism and MTHFR 2. SAMe and Fat Metabolism 3. Acetyl Co A and Fat Metabolism 4. How to Maintain

More information

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis

Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis Dietary α-linolenic acid-rich flaxseed oil prevents against alcoholic hepatic steatosis via ameliorating lipid homeostasis at adipose tissue-liver axis in mice Meng Wang a, Xiao-Jing Zhang a, Kun Feng

More information

complemented with SipA ( SipA/pSipA) or SL1344 WT for 48 hours, after which the

complemented with SipA ( SipA/pSipA) or SL1344 WT for 48 hours, after which the P-gp expression (% of control) 12 1 8 6 4 2 * * Untreated SipA SipA/pSipA WT Supplementary Figure 1. SipA modulates the expression of P-gp in healthy murine intestinal epithelium in vivo. Salmonella Typhimurium

More information

FOR REVIEW. BMB Reports - Manuscript Submission. Manuscript Draft. Manuscript Number: BMB

FOR REVIEW. BMB Reports - Manuscript Submission. Manuscript Draft. Manuscript Number: BMB BMB Reports - Manuscript Submission Manuscript Draft Manuscript Number: BMB-18-095 Title: Insulin Receptor Substrate 2:A Bridge between Hippo and AKT Pathways Article Type: Perspective (Invited Only) Keywords:

More information

Nonalcoholic Steatohepatitis National Digestive Diseases Information Clearinghouse

Nonalcoholic Steatohepatitis National Digestive Diseases Information Clearinghouse Nonalcoholic Steatohepatitis National Digestive Diseases Information Clearinghouse National Institute of Diabetes and Digestive and Kidney Diseases NATIONAL INSTITUTES OF HEALTH Nonalcoholic steatohepatitis

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Supporting Information Table of content

Supporting Information Table of content Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting

More information

What systems are involved in homeostatic regulation (give an example)?

What systems are involved in homeostatic regulation (give an example)? 1 UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GLUCOSE HOMEOSTASIS (Diabetes Mellitus Part 1): An Overview

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Glutathione S-Transferase Assay Kit

Glutathione S-Transferase Assay Kit Glutathione S-Transferase Assay Kit Catalog Number KA1316 96 assays Version: 05 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for

Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for 15 min at 37 C and replaced with fresh complete medium.

More information

5th Amino Acid Assessment Workshop

5th Amino Acid Assessment Workshop 5th Amino Acid Assessment Workshop The In Vivo Sparing of Methionine by Cysteine in Sulfur Amino Acid Requirements in Animal Models and Adult Humans 1,2 Ronald O. Ball,* y3 Glenda Courtney-Martin, y and

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit

Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit PROTOCOL Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit DESCRIPTION Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit Sufficient materials

More information

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

ab Hepatic Lipid Accumulation/ Steatosis Assay Kit

ab Hepatic Lipid Accumulation/ Steatosis Assay Kit ab133131 Hepatic Lipid Accumulation/ Steatosis Assay Kit Instructions for Use For evaluating steatosis risk of drug candidates using Oil Red O to stain neutral lipids in hepatocytes. This product is for

More information

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified

Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified Suppl. Figure 1. T 3 induces autophagic flux in hepatic cells. (A) RFP-GFP-LC3 transfected HepG2/TRα cells were visualized and cells were quantified for RFP-LC3 puncta (red dots) representing both autolysosomes

More information

Mammalian Tissue Protein Extraction Reagent

Mammalian Tissue Protein Extraction Reagent Mammalian Tissue Protein Extraction Reagent Catalog number: AR0101 Boster s Mammalian Tissue Protein Extraction Reagent is a ready-to-use Western blot related reagent solution used for efficient extraction

More information

PLASMA LIPOPROTEINS AND LIPIDS DETERMINATION OF PLASMA CHOLESTEROL AND TRIGLICERIDE LEVEL

PLASMA LIPOPROTEINS AND LIPIDS DETERMINATION OF PLASMA CHOLESTEROL AND TRIGLICERIDE LEVEL PLASMA LIPOPROTEINS AND LIPIDS DETERMINATION OF PLASMA CHOLESTEROL AND TRIGLICERIDE LEVEL Lipids are characterized by low polarity and limited solubility in water. Their plasma concentration is about 500-600

More information

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)

More information

Data Sheet. Notch Pathway Reporter Kit Catalog # 60509

Data Sheet. Notch Pathway Reporter Kit Catalog # 60509 Data Sheet Notch Pathway Reporter Kit Catalog # 60509 6042 Cornerstone Court W, Ste B Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. NOTCH signaling

More information

LDL Uptake Cell-Based Assay Kit

LDL Uptake Cell-Based Assay Kit LDL Uptake Cell-Based Assay Kit Catalog Number KA1327 100 assays Version: 07 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...

More information

The effect of nickel on homocysteine metabolism in patients with end-stage renal disease on hemodialysis and in vitro in peripheral mononuclear cells

The effect of nickel on homocysteine metabolism in patients with end-stage renal disease on hemodialysis and in vitro in peripheral mononuclear cells SHORT THESIS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY (PHD) The effect of nickel on homocysteine metabolism in patients with end-stage renal disease on hemodialysis and in vitro in peripheral mononuclear

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated

More information

Hyperhomocysteinaemia A Risk Factor Worth Considering

Hyperhomocysteinaemia A Risk Factor Worth Considering REVIEW ARTICLE JIACM 2003; 4(2): 147-51 Hyperhomocysteinaemia A Risk Factor Worth Considering Pramood C Kalikiri* At least nine well-known risk factors are known to play a role in the development of coronary

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin

More information

LDL Uptake Cell-Based Assay Kit

LDL Uptake Cell-Based Assay Kit LDL Uptake Cell-Based Assay Kit Item No. 10011125 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION

More information

FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643

FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643 Data Sheet FOXO Reporter Kit PI3K/AKT Pathway Cat. #60643 Background The PI3K/AKT signaling pathway is essential for cell growth and survival. Disruption of this pathway or its regulation has been linked

More information

Homocysteine-induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways

Homocysteine-induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways Homocysteine-induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways Geoff H. Werstuck,, M. Rene Malinow, Richard C. Austin J Clin Invest. 2001;107(10):1263-1273.

More information

APPENDIX Heparin 2 mg heparin was dissolved in 0.9 % NaCl (10 ml). 200 µl of heparin was added to each 1 ml of blood to prevent coagulation.

APPENDIX Heparin 2 mg heparin was dissolved in 0.9 % NaCl (10 ml). 200 µl of heparin was added to each 1 ml of blood to prevent coagulation. APPENDIX 1 Preparation of reagents 1.1. Preparation of dosing solution Nonylphenol 15 mg of Nonylphenol was dissolved in olive oil (10 ml) and used as stock solution. The stock solution was serially diluted

More information

Hyperhomocysteinemia, endoplasmic reticulum stress, and alcoholic liver injury

Hyperhomocysteinemia, endoplasmic reticulum stress, and alcoholic liver injury PO Box 2345, Beijing 100023, China World J Gastroenterol 2004;10(12):1699-1708 Fax: +86-10-85381893 World Journal of Gastroenterology E-mail: wjg@wjgnet.com www.wjgnet.com Copyright 2004 by The WJG Press

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation

More information

PRODUCT INFORMATION & MANUAL

PRODUCT INFORMATION & MANUAL PRODUCT INFORMATION & MANUAL Mitochondrial Extraction Kit NBP2-29448 Research use only. Not for diagnostic or therapeutic procedures www.novusbio.com P: 303.760.1950 P: 888.506.6887 F: 303.730.1966 technical@novusbio.com

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Bachelor Nutrition Science Seminar Nutritional Biochemistry (Module BE2.3) Topics

Bachelor Nutrition Science Seminar Nutritional Biochemistry (Module BE2.3) Topics Nutritional Biochemistry (Module BE2.3) Prof. Dr. Stefan Lorkowski 1 Bachelor Nutrition Science Seminar Nutritional Biochemistry (Module BE2.3) Topics Biosynthesis of amino acids 1. Amino acids: general

More information

Supplementary figure legends

Supplementary figure legends Supplementary figure legends Fig. S1. Lineweaver-Burk plot of putrescine uptake by YeeF. An overnight culture of SK629 was inoculated in 100-mL LBG medium in 500-mL Erlenmeyer flasks. The medium was supplemented

More information

ER stress: Can the liver cope?

ER stress: Can the liver cope? Journal of Hepatology 45 (2006) 321 333 Review ER stress: Can the liver cope? www.elsevier.com/locate/jhep Cheng Ji *, Neil Kaplowitz Gastroenterology/Liver Division, Keck School of Medicine and the Research

More information

Cell Lysis Buffer. Catalog number: AR0103

Cell Lysis Buffer. Catalog number: AR0103 Cell Lysis Buffer Catalog number: AR0103 Boster s Cell Lysis Buffer is a ready-to-use Western blot related reagent solution used for efficient extraction of total soluble protein in nondenatured state

More information

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein.

Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent Protein. prfp-vector RFP Exon1 Intron RFP Exon2 prfp-mir-124 mir-93/124 RFP Exon1 Intron RFP Exon2 Untransfected prfp-vector prfp-mir-93 prfp-mir-124 Supplementary Fig. 1. Delivery of mirnas via Red Fluorescent

More information

High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22

High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Supplementary Information High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Max Gulhane 1, Lydia Murray 1, Rohan Lourie 1, Hui Tong 1, Yong H. Sheng 1, Ran

More information

Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author):

Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author): Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author): This study shows that the inducible camp early repressor (ICER) is involved in development of Th17 cells that are pathogenic

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

S-adenosylmethionine metabolism and liver disease

S-adenosylmethionine metabolism and liver disease CONCISE REVIEW S-adenosylmethionine metabolism and liver disease., 2013; 12 (2): 183-189 March-April, Vol. 12 No.2, 2013: 183-189 183 S-adenosylmethionine metabolism and liver disease José M Mato,* M Luz

More information

20S Proteasome Activity Assay Kit

20S Proteasome Activity Assay Kit 20S Proteasome Activity Assay Kit For 100 Assays Cat. No. APT280 FOR RESEARCH USE ONLY NOT FOR USE IN DIAGNOSTIC PROCEDURES USA & Canada Phone: +1(800) 437-7500 Fax: +1 (951) 676-9209 Europe +44 (0) 23

More information

Improving Access to Quality Medical Care Webinar Series

Improving Access to Quality Medical Care Webinar Series Improving Access to Quality Medical Care Webinar Series Presented by The Arizona Telemedicine Program and the Southwest Telehealth Resource Center 2015 UA Board of Regents Welcome AZ, UT, CO, NM & NV FLEX

More information

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing

More information

Free Fatty Acid Assay Kit (Fluorometric)

Free Fatty Acid Assay Kit (Fluorometric) Product Manual Free Fatty Acid Assay Kit (Fluorometric) Catalog Number STA-619 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Triglycerides (TAG) are a type of lipid

More information