BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

Save this PDF as:

Size: px
Start display at page:

Download "BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice"


1 SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana Montosi, Shanzhuo Chen, Slobodan Vukicevic, Antonello Pietrangelo, Herbert Y. Lin, and Jodie L. Babitt

2 SUPPLEMENTARY MATERIALS AND METHODS Animals All animal protocols were approved by the Institutional Animal Care and Use Committee at the Massachusetts General Hospital (MGH), Children s Hospital Boston (CHB), or the University Hospital of Modena (UHM). Wildtype mice with iron deficiency anemia (WT anemic) were housed in the MGH rodent facility and were generated by placing female C57BL/6 mice on an iron deficient diet (2-6 ppm iron, TD.80396, Harlan Teklad) for 3 weeks until 8-10 weeks of age followed by phlebotomy of 0.4 ml blood by retro-orbital puncture. Mice were sacrificed 24 hours after phlebotomy. In parallel, a control group of female WT C57BL/6 mice were housed in the MGH rodent facility and maintained on a Prolab 5P75 Isopro RMH 3000 diet with 380 ppm iron until sacrifice at 8-10 weeks of age. For BMP6 time course experiments, eight-week-old male 129S6/SvEvTac WT mice housed in the MGH rodent facility and maintained on a Prolab 5P75 Isopro RMH 3000 diet with 380 ppm iron were treated with a single intraperitoneal injection of BMP6 at 500 µg/kg or an equal volume of vehicle alone. Six, 8, or 24 hours after injection, mice were sacrificed and analyzed for serum iron and transferrin saturation. Tissue iron measurement Quantitative measurement of nonheme iron was performed on liver, spleen, heart, and pancreas as previously described (Babitt et al. J Clin Invest. 2007; 117: ). Quantitative real-time RT-PCR Total RNA was isolated from mouse livers and real-time quantification of Hfe or Crp 1

3 relative to Rpl19 mrna were performed using two-step quantitative real-time RT-PCR as previously described (Babitt et al. Nat Genet. 2006; 38: ) using primers: Hfe forward 5 -CACCGCGTTCACATTCTCTAA-3, Hfe reverse 5 - CTGGCTTGAGGTTTGCTCC-3 (Primer Bank ID a1; Spandidos et al. Nucl. Acids Res :D792-9.); and Crp forward 5' ATG GAG AAG CTA CTC TGG TGC 3', Crp reverse 5' ACA CAC AGT AAA GGT GTT CAG TG 3'. Western blot Western blot of liver lysates for phosphorylated Smad1/5/8 relative to total Smad1 and Actin and chemiluminescence quantitation was performed as previously described (Corradini et al. Gastroenterology. 2009;137: ). For Ferroportin Western blots, membrane proteins were extracted using the ProteoJET Membrane Protein Kit (Fermentas), following the manufacturer s instructions. After dilution in 1x NuPAGE LDS Sample Buffer and Sample Reducing Agent (Invitrogen), samples were incubated for 10 minutes at 70 C and 5 minute on ice. Then, 2 µg of spleen proteins or 10 µg of liver proteins per sample were resolved by SDS- PAGE using pre-cast NuPAGE Novex 4 12% Bis-Tris gels (Invitrogen) and transferred onto PDVF membranes, using the liquid transfer method. The blots were blocked with 5% of non-fat dry milk in TBS containing 0.1% Tween-20 (Sigma) and probed overnight at 4 C with rabbit polyclonal antibodies to Ferroportin (1:1000, Alpha Diagnostic) diluted in the same blocking solution. Following washes, the blots were incubated for 1 hour with peroxidase-coupled goat anti-rabbit IgG (1:5000, Sigma). Blots were stripped and re-probed with mouse anti-actin monoclonal antibody (1:10000 Chemicon). Enzyme activity was detected by the Western Lightning Plus-ECL method (Perkin Elmer). Chemiluminescence was quantitated using IPLab Spectrum software version r2 (Scanalytics), by normalizing Ferroportin to Actin. 2

4 3

5 Supplementary Figure 1. Hepatic Hfe mrna is increased in Hfe Tg mice relative to WT mice. Eight-week-old female Hfe Tg mice (N = 6) versus littermate WT mice (N = 6) were analyzed for hepatic Hfe relative to Rpl19 mrna by quantitative real-time RT-PCR. Results are reported as the mean ± SD for the fold change from WT mice. Exact P values are shown for the comparison with WT mice. 4

6 Supplementary Table 1. Hematologic and iron parameters of Hfe Tg male versus female mice Gender n Hgb (g/dl) HCT (%) Serum iron (µg/dl) Tf Sat (%) LIC (µg/g) Male ± ± ± ± ± 2.1 Female ± ± ± ± ± 4.0 Hemoglobin (Hgb), serum iron, transferrin saturation (Tf Sat), and liver iron content (LIC) were measured in 8-week old Hfe Tg male versus female mice on a C57BL/6 background. Data are presented as the mean ± SD. P > 0.05 between genders for all parameters. Male Hfe Tg mice have a similar iron deficiency anemia phenotype compared with female Hfe Tg mice, although there was a trend for a more severe phenotype in the male mice. Genders were therefore matched between treatment groups in BMP6 antibody treatment experiments. 5

7 Supplementary Table 2. Hematologic and iron parameters of Hfe Tg, WT, and anemic WT mice Genotype/ n Hgb (g/dl) Serum iron (µg/dl) Tf Sat (%) LIC (µg/g) Treatment WT ± ± ± 5 55 ± 12 Hfe Tg ± 0.4 ** 82 ± 4 ** 36 ± 2 ** 40 ± 2 ** WT ± ± ± 4 86 ± 9 Anemic WT ± 1.0 ** 154 ± ± 5 * 58 ± 17 ** The hemoglobin (Hgb), serum iron, transferrin saturation (Tf Sat), and liver iron content (LIC) were measured in 8-week old female Hfe Tg versus littermate WT mice, or in 8-10-week-old female control WT mice maintained on a normal diet versus WT mice maintained on an iron deficient diet for 3 weeks and phlebotomized (Anemic WT). All mice were on a C57BL/6 background. Data are presented as the mean ± SD. **P for Hfe Tg versus WT mice or anemic WT mice versus control WT mice. * P = 0.01 for anemic WT mice versus control WT mice. P not significant from WT. Anemic WT mice had a similar reduction in hemoglobin and liver iron content relative to matched WT mice compared with the Hfe Tg mice relative to their WT littermates. Although the anemic WT mice also had slightly reduced serum Tf Sat compared with WT mice, this was considerably less pronounced than in Hfe Tg mice. 6

8 7

9 Supplementary Figure 2. Hepcidin (Hamp), Id1, and Smad7 mrna are decreased in anemic WT mice relative to control WT mice. Eight- to ten-week-old female WT mice maintained on a normal diet (WT, N = 6) versus WT mice maintained on an iron deficient diet for three weeks followed by phlebotomy of 0.4 ml blood (Anemic WT, N = 10) from Supplementary Table 2 were analyzed 24-hours after phlebotomy for hepatic Hamp, Id1, Smad7, and Bmp6 mrna relative to Rpl19 mrna by quantitative real-time RT-PCR. Results are reported as the mean ± SD for the fold change from WT mice. Exact P values (or NS if not significant) are shown for the comparison with control WT mice. 8

10 9

11 Supplementary Figure 3. There is a nonsignificant trend toward increased hepatic P-Smad1/5/8 in Hfe Tg mice versus WT mice. Eight-week-old Hfe Tg mice (N = 6) versus littermate WT mice (N = 6) were analyzed for hepatic P-Smad1/5/8 relative to total Smad1 and Actin by Western blot (A) followed by chemiluminescence quantitation (B-C). Results are reported as the mean ± SD. 10

12 11

13 Supplementary Figure 4. Neutralizing anti-bmp6 antibody decreases hepatic Id1 mrna in Hfe Tg mice. Eight to ten-week-old Hfe Tg mice that received an intraperitoneal injection of BMP6 antibody (BMP6 Ab, N = 5) or vehicle alone (Mock, N = 5) once daily for ten days from Figure 2 were analyzed for hepatic Id1 relative to Rpl19 mrna by quantitative real-time RT-PCR. Results are reported as the mean ± SD. Exact P values are shown for the comparison of BMP6 Ab treatment versus mock treatment. 12

14 13

15 Supplementary Figure 5. Dose and time curve of the effects of exogenous BMP6 administration on serum iron and transferrin saturation in mice. A) Eight to ten week-old male and female Hfe -/- mice and WT mice receiving a single intraperitoneal injection of BMP6 at 100 µg/kg or 250 µg/kg or vehicle alone (Control) as indicated (N = 6-10 per group, genders were matched between groups) from Figure 3 were analyzed for serum transferrin saturation (Tf Sat). BMP6 at 250 µg/kg caused only a nonsignificant trend toward reduced transferrin saturation in Hfe -/- mice. A higher dose of BMP6 at 500 µg/kg was therefore chosen for further experiments. B-C) Eight week-old WT mice on a 129S6/SvEvTac background received a single intraperitoneal injection of BMP6 at 500 µg/kg or an equal volume of vehicle alone (Control), and were sacrificed 6, 8, or 24 hours after injection (N = 6 per group). Serum was analyzed for iron (B) and transferrin saturation (C). Results are reported as the mean ± SD. Exact P values (or NS if not significant) are shown for the comparison between BMP6-treated versus Control mice. 14

16 15

17 Supplementary Figure 6. Exogenous BMP6 administration in Hfe -/- mice causes a trend toward increased hepatic Id1 mrna but does not affect hepatic Crp mrna. Eight-to-ten week-old Hfe -/- mice treated with BMP6 at 500 µg/kg or vehicle alone (Mock) twice daily for 10 days from Figure 4 (N = 8 per group) were analyzed for A) hepatic Id1 relative to Rpl19 mrna and B) hepatic Crp relative to Rpl19 mrna by quantitative realtime RT-PCR. Results are reported as the mean ± SD. NS indicates P > 0.05 for BMP6 treated mice compared to vehicle treated mice. 16

18 17

19 Supplementary Figure 7. Exogenous BMP6 does not affect liver, heart, or pancreas iron content in Hfe -/- mice. A) Eight-to-ten week-old Hfe -/- mice treated with BMP6 at 500 µg/kg or vehicle alone (Mock) twice daily for 10 days from Figure 4 (N = 8 per group) were analyzed for liver, heart, and pancreas iron content. Results are reported as the mean ± SD. All P values were non-significant for the comparison of BMP6 treated mice (black bars) with vehicle treated mice (grey bars). B) Perls Prussian blue staining of liver iron in Mock versus BMP6-treated Hfe -/- mice from panel A (original magnification x10). 18

20 19

21 Supplementary Figure 8. Splenic Ferroportin protein expression is not affected by exogenous BMP6 treatment in Hfe -/- mice, and is not significantly changed in Hfe -/- mice compared with WT mice. A) Eight-to-ten week-old male Hfe -/- mice treated with BMP6 at 500 µg/kg or vehicle alone (Mock) twice daily for 10 days from Figure 4 were analyzed for splenic Ferroportin relative to Actin protein expression by Western blot followed by chemiluminescence quantitation. B) Eight-to-ten week-old male WT mice versus Hfe-/- mice on a C57BL/6 background were analyzed for splenic Ferroportin relative to Actin protein expression by Western blot followed by chemiluminescence quantitation. BMP6 treated Hfe-/- mice on a C57BL/6 background from panel A are also shown as a comparison. Results are reported as the mean ± SD. P values were nonsignificant for comparison between all groups. 20

22 21

23 Supplementary Figure 9. Exogenous BMP6 does not affect liver Ferroportin expression in Hfe -/- mice. Eight-to-ten week-old Hfe -/- mice treated with BMP6 at 500 µg/kg or vehicle alone (Mock) twice daily for 10 days from Figure 4 were analyzed for liver Ferroportin relative to Actin protein expression by Western blot followed by chemiluminescence quantitation. Results are reported as the mean ± SD. The P value was non-significant for the comparison of BMP6 treated mice with vehicle treated mice. 22

BMP6 Treatment Compensates for the Molecular Defect and Ameliorates Hemochromatosis in Hfe Knockout Mice

BMP6 Treatment Compensates for the Molecular Defect and Ameliorates Hemochromatosis in Hfe Knockout Mice GASTROENTEROLOGY 2010;139:1721 1729 BMP6 Treatment Compensates for the Molecular Defect and Ameliorates Hemochromatosis in Hfe Knockout Mice ELENA CORRADINI,*, PAUL J. SCHMIDT, DELPHINE MEYNARD,* CINZIA

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information


CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

More information

3) The sheer number of and inconsistency between different animal models used make the paper difficult to follow and may impact data interpretation:

3) The sheer number of and inconsistency between different animal models used make the paper difficult to follow and may impact data interpretation: Reviewers' comments: Reviewer #1 (Remarks to the Author): In this manuscript, Pasricha et al. show that iron deficiency (ID) and stimulated erythropoiesis suppress hepcidin via distinct processes. They

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

ECL Plex Western Blotting Detection System

ECL Plex Western Blotting Detection System Part of GE Healthcare Data File 28-415-39 AA ECL Plex Western Blotting Detection System Multiplex protein detection based on direct fluorescent CyDye-labeled conjugates ECL Plex fluorescent Western blotting

More information

without LOI phenotype by breeding female wild-type C57BL/6J and male H19 +/.

without LOI phenotype by breeding female wild-type C57BL/6J and male H19 +/. Sakatani et al. 1 Supporting Online Material Materials and methods Mice and genotyping: H19 mutant mice with C57BL/6J background carrying a deletion in the structural H19 gene (3 kb) and 10 kb of 5 flanking

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

The liver hormone hepcidin is a main regulator

The liver hormone hepcidin is a main regulator Serum and Liver Iron Differently Regulate the Bone Morphogenetic Protein 6 (BMP6)-SMAD Signaling Pathway in Mice Elena Corradini, 1,2 Delphine Meynard, 1 Qifang Wu, 1 Shan Chen, 1 Paolo Ventura, 2 Antonello

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Astrocyte-shed extracellular vesicles regulate the peripheral leukocyte response to inflammatory brain lesions

More information

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8

Supplementary information. The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 1 Supplementary information 2 3 The proton-sensing G protein-coupled receptor T-cell death-associated gene 8 4 (TDAG8) shows cardioprotective effects against myocardial infarction 5 Akiomi Nagasaka 1+,

More information

NF-κB p65 (Phospho-Thr254)

NF-κB p65 (Phospho-Thr254) Assay Biotechnology Company Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

ab E3 Ligase Auto- Ubiquitilylation Assay Kit

ab E3 Ligase Auto- Ubiquitilylation Assay Kit ab139469 E3 Ligase Auto- Ubiquitilylation Assay Kit Instructions for Use For testing ubiquitin E3 ligase activity through assessment of their ability to undergo auto-ubiquitinylation This product is for

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Control Pancreatitis Supplementary Figure 2 A Panc Liver SI Spleen H 2 O B EZH2 fl/fl C EZH2 fl/fl 37bp EZH2 ERK2 D E 5 EZH2 fl/fl Fasting Glucose (mg/dl) 2 18 16 14 12 1 8 6 4 2

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Beta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015

Beta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015 Bioinformatics in Medical Product Development SMPD 287 Three Beta Thalassemia Sami Khuri Department of Computer Science San José State University Hemoglobin Outline Anatomy of a gene Hemoglobinopathies

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive

Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,

More information

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen

More information

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

TECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates

TECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates Catalog Number RAB0011 Storage Temperature 20 C TECHNICAL BULLETIN Product Description

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

Human Apolipoprotein A1 EIA Kit

Human Apolipoprotein A1 EIA Kit A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent

More information

Control. csarnt -/- Cre, f/f

Control. csarnt -/- Cre, f/f ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen

More information

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C

TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C Phospho-Stat3 (ptyr 705 ) and pan-stat3 ELISA Kit for detection of human, mouse, or rat phospho-stat3 (ptyr 705 ) and pan-stat3 in cell and tissue lysates Catalog Number RAB0447 Storage Temperature 20

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/-

Bezzi et al., Supplementary Figure 1 *** Nature Medicine: doi: /nm Pten pc-/- ;Zbtb7a pc-/- Pten pc-/- ;Pml pc-/- Pten pc-/- ;Trp53 pc-/- Gr-1 Gr-1 Gr-1 Bezzi et al., Supplementary Figure 1 a Gr1-CD11b 3 months Spleen T cells 3 months Spleen B cells 3 months Spleen Macrophages 3 months Spleen 15 4 8 6 c CD11b+/Gr1+ cells [%] 1 5 b T cells

More information

Mapping the Ligand-binding Site on a GPCR Using Genetically-encoded Photocrosslinkers

Mapping the Ligand-binding Site on a GPCR Using Genetically-encoded Photocrosslinkers Mapping the Ligand-binding Site on a GPCR Using Genetically-encoded Photocrosslinkers Amy Grunbeck, Thomas Huber, Pallavi Sachdev, Thomas P. Sakmar Laboratory of Molecular Biology and Biochemistry, The

More information

Supplementary Information

Supplementary Information Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,

More information

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids

Supplemental Information. Induction of Expansion and Folding. in Human Cerebral Organoids Cell Stem Cell, Volume 20 Supplemental Information Induction of Expansion and Folding in Human Cerebral Organoids Yun Li, Julien Muffat, Attya Omer, Irene Bosch, Madeline A. Lancaster, Mriganka Sur, Lee

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

University of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick

University of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick University of Groningen Vasoregression in incipient diabetic retinopathy Pfister, Frederick IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from

More information

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice

Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian))

Rabbit Polyclonal antibody to NFkB p65 (v-rel reticuloendotheliosis viral oncogene homolog A (avian)) Datasheet GeneTex, Inc : Toll Free 1-877-GeneTex (1-877-436-3839) Fax:1-949-309-2888 GeneTex International Corporation : Tel:886-3-6208988 Fax:886-3-6208989 Date :

More information

Molecular basis of iron homeostasis. and its translation to the clinic. Tomas Ganz, PhD, MD

Molecular basis of iron homeostasis. and its translation to the clinic. Tomas Ganz, PhD, MD Molecular basis of iron homeostasis and its translation to the clinic Tomas Ganz, PhD, MD Systemic iron homeostasis Liver (storage, recycling) Spleen (recycling, storage) Liver Fe 1-2 mg/day Plasma Fe-Tf

More information



More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

More information

EGFR (py1045)/ Pan EGFR (Human) ELISA Kit

EGFR (py1045)/ Pan EGFR (Human) ELISA Kit EGFR (py1045)/ Pan EGFR (Human) ELISA Kit Catalog Number KA2156 96 assays Version: 01 Intended for research use only I. INTRODUCTION EGFR (py1045)/pan EGFR (Human) ELISA (Enzyme-Linked Immunosorbent

More information

Hereditary hemochromatosis (HH) is a common autosomal

Hereditary hemochromatosis (HH) is a common autosomal Mouse strain differences determine severity of iron accumulation in Hfe knockout model of hereditary hemochromatosis Robert E. Fleming*, Christopher C. Holden, Shunji Tomatsu, Abdul Waheed, Elizabeth M.

More information

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit

STAT3 (py705) (Human/Mouse/Rat) ELISA Kit STAT3 (py705) (Human/Mouse/Rat) ELISA Kit Catalog Number KA2175 96 assays Version: 01 Intended for research use only I. INTRODUCTION STAT3 (py705) (Human/Mouse/Rat) ELISA (Enzyme-Linked

More information

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square),

(A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), Supplementary Figures and Tables Figure S1. Validation of EMT-selective small molecules (A) Dose response curves of HMLE_shGFP (blue circle), HMLE_shEcad (red square), and HMLE_Twist (black diamond) cells

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

HiPer Western Blotting Teaching Kit

HiPer Western Blotting Teaching Kit HiPer Western Blotting Teaching Kit Product Code: HTI009 Number of experiments that can be performed: 5/20 Duration of Experiment: ~ 2 days Day 1: 6-8 hours (SDS- PAGE and Electroblotting) Day 2: 3 hours

More information

2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit

2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit 2009 H1N1 Influenza ( Swine Flu ) Hemagglutinin ELISA kit Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as

More information

ab LDL Uptake Assay Kit (Cell-Based)

ab LDL Uptake Assay Kit (Cell-Based) ab133127 LDL Uptake Assay Kit (Cell-Based) Instructions for Use For the detection of LDL uptake into cultured cells. This product is for research use only and is not intended for diagnostic use. Version

More information

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit

STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only Table of Contents Introduction... 3 Principle of the Assay...

More information

Fourth European Symposium on Rare Anaemias. Vita-Salute University - San Raffaele Scientific Institute, Milano

Fourth European Symposium on Rare Anaemias. Vita-Salute University - San Raffaele Scientific Institute, Milano Fourth European Symposium on Rare Anaemias Clara Camaschella Vita-Salute University - San Raffaele Scientific Institute, Milano Sofia, Bulgaria, November 19-20, 2011 The iron cycle Hepcidin (Jordan et

More information

Resistin expression in adipose tissues and its effect on glucose metabolism in rats with brain injury

Resistin expression in adipose tissues and its effect on glucose metabolism in rats with brain injury Resistin expression in adipose tissues and its effect on glucose metabolism in rats with brain injury R. Zhang 1, Z.Y. Wang 1, L.L. Zhu 1, F. Wu 1, D.Q. Chen 1, L.F. Sun 1 and Z.Q. Lu 2 1 Department of

More information

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,

Erzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen, Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.

Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells

More information

Supplementary Materials for

Supplementary Materials for Supplementary Materials for Controlling Long-Term Signaling: Receptor Dynamics Determine Attenuation and Refractory Behavior of the TGF-β Pathway

More information


Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny

More information

Nature Medicine doi: /nm.3150

Nature Medicine doi: /nm.3150 Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG

More information

Iron is the most abundant trace element involved in numerous

Iron is the most abundant trace element involved in numerous Maternal intestinal HIF-2α is necessary for sensing iron demands of lactation in mice Sadeesh K. Ramakrishnan a, Erik R. Anderson a, Angelical Martin a, Brook Centofanti a, and Yatrik M. Shah a,b,1 a Department

More information

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document

Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Graveley Lab shrna knockdown followed by RNA-seq Biosample Preparation and Characterization Document Wet Lab: Sara Olson and Lijun Zhan Computational Lab: Xintao Wei and Michael Duff PI: Brenton Graveley

More information

Targeting of the attenuated diphtheria toxin (adta) into the melanopsin locus. a,

Targeting of the attenuated diphtheria toxin (adta) into the melanopsin locus. a, doi: 1.138/nature6829 a DTA HSV- TK PGK-Neo Targeting construct b kb.85.65 L WT adta/+ adta/ adta Melanopsin (Opn 4) Genomic Locus 1 kb.4 Supplementary Figure 1: Targeting of the attenuated diphtheria

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Reagents and antibodies was purchased from iaffin GmbH & Co KG. Cisplatin (ristol-myers Squibb Co.) and etoposide (Sandoz Pharma Ltd.) were used. Antibodies recognizing

More information

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad

Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay

Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis

More information

Relevant Disclosures

Relevant Disclosures 6/18/215 Therapeutic developments for autoimmune demyelinating diseases: Musings from a MD (Mouse Doctor) Michael K. Racke, M.D. May 28, 215 Relevant Disclosures Editorial Boards for Journal of Neuroimmunology,

More information

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury

HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa

More information

Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness

Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness World Health Organization Recommended laboratory tests to identify influenza A/H5 virus in specimens from patients with an influenza-like illness General information Highly pathogenic avian influenza (HPAI)

More information

WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: Bioelisa HCV 4.0 Number: PQDx Abstract

WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: Bioelisa HCV 4.0 Number: PQDx Abstract WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: Bioelisa HCV 4.0 Number: PQDx 0165-060-00 Abstract Bioelisa HCV 4.0 with product codes 3000-1115 and 3000-1116, manufactured by Biokit

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

References. Plasma renin activity (PRA) PRA was measured by a radioimmunoassay kit (Wallac, Tokyo, Japan).

References. Plasma renin activity (PRA) PRA was measured by a radioimmunoassay kit (Wallac, Tokyo, Japan). Detailed Methods Experiment I enos / mice were purchased from Jackson Laboratory (Bar Harbor, USA). C57BL/6J mice on the same genetic background were purchased from KBT Oriental (Hamamatsu, Japan). Eleven-week-old

More information

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File

Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP T) Supplementary File Dysregulation of Blimp1 transcriptional repressor unleashes p130cas/erbb2 breast cancer invasion (SREP-16-42496-T) Marianna Sciortino 1, Maria del Pilar Camacho Leal 1, Francesca Orso 1, Elena Grassi 1,

More information

Supplementary Materials. Wild-type and mutant SOD1 share an aberrant conformation and

Supplementary Materials. Wild-type and mutant SOD1 share an aberrant conformation and Supplementary Materials Wild-type and mutant SOD1 share an aberrant conformation and a common pathogenic pathway in ALS Daryl A. Bosco, Gerardo Morfini, Murat Karabacak, Yuyu Song, Francois Gros-Louis,

More information

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B)

Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) Figure S1 Generation of γ-gt DTR transgenic mice. (A) Schematic construct of the transgene. (B) PCR identified expected hhb-egf band (left panel) and HA tag band (right) in kidneys of transgenic (TG) mice

More information

Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation. Sarah J. MacDonald Assistant Professor Missouri Valley College

Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation. Sarah J. MacDonald Assistant Professor Missouri Valley College Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation Sarah J. MacDonald Assistant Professor Missouri Valley College Phytoremediation of Organic Compounds Phytodegradation: Plants

More information

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director AlphaScreen : A Straightforward and Powerful Alternative to ELISA Martina Bielefeld-Sévigny Ph.D., R&D Director Overview AlphaScreen - an alternative to ELISA Why an alternative to ELISA? Assay principle

More information

Hepcidin as a therapeutic tool to limit iron overload and improve anemia in β-thalassemic mice

Hepcidin as a therapeutic tool to limit iron overload and improve anemia in β-thalassemic mice Research article Related Commentary, page 4187 Hepcidin as a therapeutic tool to limit iron overload and improve anemia in β-thalassemic mice Sara Gardenghi, 1 Pedro Ramos, 1,2 Maria Franca Marongiu, 1

More information

Metabolic Liver Disease: What s New in Diagnosis and Therapy?

Metabolic Liver Disease: What s New in Diagnosis and Therapy? Metabolic Liver Disease: What s New in Diagnosis and Therapy? Bruce R. Bacon, M.D. James F. King M.D. Endowed Chair in Gastroenterology Professor of Internal Medicine Division of Gastroenterology and Hepatology

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Probe. Hind III Q,! ?R'!! /0!!!!D1"?R'! vector. Homologous recombination

Probe. Hind III Q,!?R'!! /0!!!!D1?R'! vector. Homologous recombination Supple-Zhang Page 1 Wild-type locus Targeting construct Targeted allele Exon Exon3 Exon Probe P1 P P3 FRT FRT loxp loxp neo vector amh I Homologous recombination neo P1 P P3 FLPe recombination Q,!?R'!!

More information

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours)

LPS CD40 + IL-4. Vorinostat (24 Hours) Vorinostat (24 Hours) Panobinostat (24 Hours) Panobinostat (24 Hours) Romidepsin (48 Hours) A) CD + IL- B) LPS ( Hours) ( Hours) Cell number (x1-3 ) 1 1 3.7 M 1. M. M.1 M Cell number (x1 - ) 1 1 3. M 1. M.7 M.38 M Cell number (x1-3 ) Cell number (x1-3 ) 3 1 1 1 ( Hours) 7.nM.nM 1.7nM.nM Romidepsin

More information

Title Modified Western blotting for insulin and other diabetes-associated peptide hormones

Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Supplemental Figures Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Authors Naoyuki Okita, Yoshikazu Higami, Fumio Fukai, Masaki Kobayashi, Miku Mitarai, Takao

More information

ab Hepatic Lipid Accumulation/ Steatosis Assay Kit

ab Hepatic Lipid Accumulation/ Steatosis Assay Kit ab133131 Hepatic Lipid Accumulation/ Steatosis Assay Kit Instructions for Use For evaluating steatosis risk of drug candidates using Oil Red O to stain neutral lipids in hepatocytes. This product is for

More information


SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information