Chinese Journal of Biochemistry and Molecular Biology , GRP78.

Transcription

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology (6) : HepG 2 1), 1), 3), 3), 1), 2), 1) 3 ( 1) ; 2) ; 3) ; ) : ; : (No ) (No ) 3 Tel : (010) ,E2mail : edu. cn Received : January 31, 2008 ;Accepted : April 2,2008 Supported by National Natural Science Foundation of China (No ), Startup Research Fund for ROCS, SEM and Innovation Group Program, NSFC (No ) 78 (glucose regulated protein 78, GRP78), (carbon tetrachloride, CCl 4 ) Hep G 2, O,CCl 4 Hep G 2,, 1 ( sterol regulatory element binding protein 1, SREBP21) 3 3 CoA (HMGCoA ) mrna GRP78 p GL3ΠhGRP78P Hep G 2,,CCl 4 GRP78, GRP78 RNAi psuperπgrp78 Hep G 2 3 Corresponding author Tel : (010) ,E2mail : edu. cn, GRP78 ; GRP78 Hep G 2 CCl 4, HMGCoA mrna SREBP21, ; Hep G 2 GRP78 CCl 4 HMGCoA mrna SREBP21, 7815 % 5115 % ; O,GRP78 Hep G 2.,GRP78 CCl 4 SREBP21 HMGCoA Hep G 2, GRP ; 1 ; ; Q49315,Q59115,Q71 GRP78 Blocks CCl 4 2Induced Lipogenesis in HepG 2 Cells WU Yi2Yuan 1),ZHANGLi2Juan 1), ZHU Rong 3),CHEN Su2Qing 3), LI Xiao2Wen 1),YANG Xiao2Da 2), LI Zai2Quan 1) 3 ( 1) Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, ; 2) Department of Chemical Biology, School of Pharmaceutical Sciences ; 3) National Insititute on Drug Dependence, Peking University Health Science Center, Beijing , China) Abstract To elucidate the effect of glucose regulated protein 78 ( GRP78) on hepatic steatosis, CCl 4 2induced lipid deposition within Hep G 2 cells was adopted. The lipid accumulation in human Hep G 2 cells stimulated by CCl 4 was confirmed by Oil Red O staining assay, and the levels of HMGCoA reductase mrna and SREBP21 protein in CCl 4 2treated Hep G 2 cells were increased to folds ( P < 0105) and 1170 folds of those in control group, respectively. The p GL3ΠhGRP78P reporter vector was constructed, in which the luciferase transcription was driven by human GRP78 promoter. In comparison with control group, the GRP78 transcriptional activity in CCl 4 2treated Hep G 2 cells was significantly enhanced to ( P < 0105) folds. The psuperπgrp78 vector against endogenous GRP78 mrna transcription was constructed and the

2 6 : 78 HepG specific GRP78 gene silencing was confirmed by quantitative RT2PCR. The CCl 4 2induced expression of HMGCoA reductase mrna and SREBP21 protein in those GRP78 gene2silencing Hep G 2 cells was enhanced by 48 % 2 % ( P < 0105) and 138 % higher than that in control cells, whereas overexpression of GRP78 transfected by pcdna311 ( + )ΠhGRP78 plasmid could lead to inhibition of CCl 4 2induced up2regulation of HMGCoA reductase mrna and SREBP21 protein, down to 7815 % 0158 % ( P < 0105) and 5115 %, respectively. The overexpression of GRP78 also ameliorated CCl 4 2induced lipid accumulation within Hep G 2 cells. The gain and loss of function experiment in this research showed that CCl 4 2induced hepatic cell steatosis can be moderated by GRP78 protein, which is endoplasmic reticulum stress hallmark, and that GRP78 may be provided as a novel potential site for interfering with lipogenesis process in patients with hepatic steatosis. Key words glucose regulated protein 78 ; sterol regulatory element binding protein 1 ; endoplasmic reticulum stress ; fatty liver ( nonalcoholic fatty liver disease, NAFLD),, [1 ]. NAFLD,. NAFLD [2 ], [3 ], [4 ], NAFLD. (endoplasmic reticulum stress, ER stress),.,,, [5 ]. Werstuck [6 ],. CCl 4 P450 2E1 (CYP2E1) [7 ],CCl 4. [8 ],CCl 4,., GRP78 SREBP21, GRP78. CCl 4 Hep G 2, CCl 4 GRP78 GRP78 mrna. GRP78 GRP78 CCl 4 Hep G 2, GRP78 CCl Hep G 2 ( ) ; (, ) ; ( Sigma ) ; p GM2T p GL32basic prl2cmv (Promega ) ; ( ) ;psuper ( ) ; pcdna311 ( + ) ( Invitrogen ) ; pcdna311 ( + )ΠhGRP78 ( McMaster R. C. Austin ) ; Hifectin ECL ( ) ; SYBR Green I master mix ReverTra Ace ( TOYOBO ) ; SREBP21 (Santa Cruz ) ; DNA. 112 Hep G 2 10 % DMEM, 37 5 % CO Hep G 2 DNA,PCR GRP78 ( ID : DQ385847) ( ) DNA ( sense : 5 2 AATGGTACCCATAACTGGCAGGAAGGAG23 ;antisense : 5 2ACAAGAGCTCACGAACCAGGCGAAGG23 ) p GM2T, Kpn Sac p GL32basic, GRP78 p GL3ΠhGRP78P. Hep G 2 96,Hifectin p GL3ΠhGRP78P :prl2cmv(20 1),4 h, 24 h, CCl gπml (tunicamycin) [9 ].,Centro LB960 (Berthold ). 114 GRP78 RNAi

3 : GRP78 5 2GATCCCCGATCACAATCACCAATGACTTCAAG AGAGTCATTGGTGATTGTGATCTTTTTA23 ;5 2AGCTTA AAAAGATCACAATCACCAATGACTCTCTTGAAGTCATT GGTGATTGTGATCGGG23, psuper Bgl Hind, psuperπgrp78. Hifectin psuperπgrp78 Hep G 2, RNA, RT2PCR GRP78 HMGCoA ( HMGCR) 32 ( GAPDH) mrna. 115 PCR SYBRGreen I master mix ABI PRISM 7300 ( ABI ) PCR. GAPDH. : HMGCR(sense :5 2AGATAGGAACGGTGGGTGGT23 ; antisense :5 2TCAGGCTGTCTTCTTGGTGC23 ) ; GRP78 (sense :5 2CACGCCGTCCTATGTCGC23 ; antisense :5 2AAATGTCTTTGTTTGCCCACC23 ) ; GAPDH(sense :5 2TGAAGGTCGGAGTCAACGGA23 ; antisense :5 2CCTGGAAGATGGTGATGGGAT23 ). 116 RIPA ( 50 mmolπl Tris2HCl, ph 715,150 mmolπl NaCl,1 % NP240,015 %, 011 % SDS), rπmin 20 min,. Bradford., 8 %,. 1 h, 4 (SREBP21,1 100 ;,1 600)., (1 1000) 1 h, ECL, bandscan O O :,4 %,PBS, 60 %, O 30 min, 60 %, Harris, Nikon Diaphot (400 ) [10 ]. 118 SPSS1110. t. P < CCl 4 4 mmolπl CCl 4 Hep G 2 8 h, O, CCl 4 (Fig. 1). Fig. 1 Formation of cellular lipid droplets in HepG 2 cytoplasm was shown to be induced by CCl 4 The cultured HepG 2 cells were pretreated with or without 4 mmolπl CCl 4 for 8 hours. Then the cells were fixed and stained with Oil Red O (magnified to 400 ). The arrowhead show here positively cellular lipid droplets in the CCl 4 treated cells. (A) Control ; (B) CCl 4 group HMGCoA. 2 mmolπl CCl 4 8 h,hmgcoa mrna, CCl 4,HMGCoA mrna. 4 mmolπl CCl 4 HepG 2 8 h,hmgcoa mrna, ( P < 0105)., 4 mmolπl CCl 4 HepG 2, CCl 4 HMGCoA,.,4 mmolπl CCl 4 HepG 2 8 h, HMGCoA mrna 2 h CCl 4 HepG 2 HMGCoA mrna, (Fig12).

4 6 : 78 HepG Fig. 2 Dose2and time2dependent responses of HMGCoA reductase mrna expression induced by CCl 4 HepG 2 cells were incubated for 8 hours in DMEM plus 10 % FBS with indicated CCl 4 concentrations or for different periods at 4 mmolπl CCl 4 stated above. Total RNA from these cells were extracted and the relative HMGCoA reductase ( HMGCR) mrna ( % of Control) were measured by realtime quantitative RT2PCR ( GAPDH mrna, as internal reference, and the no CCl 4 treat group, as control). Values are expressed as mean standard error ( n = 3). 33 P < 0105 compared to control. (A) Time2 dependent responses of HMGCoA reductase mrna expression induced by CCl 4 ; (B) Dose2 dependent responses of HMGCoA reductase mrna expression induced by CCl 4 SREBP21, LDL HMGCoA HMGCoA FPP squalen.,ccl 4 8 h,2 mmolπl CCl 4 4 mmolπl CCl 4 SREBP , CCl 4 SREBP21 (Fig13). Fig. 3 Induction of SREBP21 protein by CCl 4 stimulation in a dose2 and time2 dependent in the cultured HepG 2 cells The cultured HepG 2 cells were incubated for 8 hours in DMEM plus 10 % FBS with indicated CCl 4 concentrations or for different periods at 4 mmolπl CCl 4 stated above. Immunoblot analysis of SREBP21 protein was performed ( 2actin, as internal reference). The result is demonstrated as relative SREBP21Π 2 actin ratio. Relative SREBP21Π 2actin ratio analyzed by imagine tool bandscan 510,CCl 4 Hep G 2, SREBP21 - HMGCoA. 212 CCl 4 GRP78 mrna GRP78, GRP78. N2,. 115 gπml Hep G 2 16 h, GRP ( P < 0105). 4 mmolπl CCl 4 Hep G 2 8 h, GRP78, ( P < 0105), CCl 4 GRP78 ( Fig14 A B)., PCR, Hep G 2 GRP78 mrna 4 mmolπl CCl 4 8 h, ( P < 0105) (Fig14 C).,CCl 4 GRP78, GRP78 mrna. 213 GRP78 CCl 4 GRP78 psuperπgrp78 Hep G 2,, GRP78 mrna 6419 %, HMGCoA mrna, psuperπgrp78 GRP78, HMGCoA ( Fig15A B), psuperπgrp78 Hep G 2 GRP78. GRP78 CCl 4, psuperπgrp78 GRP78, Hep G 2 CCl 4, HMGCoA

5 Fig. 4 Effects of CCl 4 stimulation on GRP78 Promoter2luciferase activation in dose2 and time2 dependent manner and up2 regulation of endogenous GRP78 mrna induced by CCl 4 HepG 2 cells co2transfected with both of pgl3πhgrp78p and prl2cmv constructs for 24 hours were treated with different doses for 8 hours, or at 4 mmolπl CCl 4 for indicated times. 115 gπ l of Tunicamycin being positive control. The fold change of endogenous GRP78 mrna after treating with 4 mmolπl CCl 4 for 8 hours was monitored by realtime quantitative RT2PCR. Values are expressed as mean standard error ( n = 3), 33 P < 0105 compared to control. (A) CCl 4 stimulation on GRP78 promoter2luciferase activation in dose2dependent manner ; (B) CCl 4 activation in time2dependent manner ; (C) endogenous GRP78 mrna expression in HepG 2 cells induced by CCl 4 stimulation on GRP78 promoter2luciferase Fig. 5 CCl 4 induced2hmgcoa reductase mrna and SREBP21 protein expression of HepG 2 cells were enhanced after endogenous GRP78 silencing HepG 2 cells were transfected with psuperπgrp78 construct carrying specific small interfering RNAs against GRP78 mrnas, and stimulated with or without 4 mmolπl CCl 4 for 8 hours. (A) Real time RT2PCR quantitative assays of GRP78 ; and (B, C) HMGCR mrna relative expression in HepG 2 cells ( GAPDH as internal reference). Values are expressed as mean standard error ( n = 3), 33 P < 0105 compared to control ; (D) Immunoblot analysis of SREBP21 protein was performed ( 2actin as internal reference) 48 % 2 %(Fig15C) ; SREBP %(Fig15D). GRP78 CCl 4 SREBP21 HMGCoA. 214 GRP78 CCl 4 GRP78 Hep G 2, Hep G 2 GRP78 pcdna3. 1 ( + )ΠhGRP781 pcdna311 ( + )ΠhGRP78 Hep G 2, GRP78 mrna ( P < 0105), pcdna311 ( + )Π hgrp78 Hep G 2 GRP78 mrna (Fig16A). 4 mmolπl CCl 4 Hep G 2 8 h, pcdna311 ( + )ΠhGRP78 Hep G 2 HMGCoA mrna

6 6 : 78 HepG % 0158 % ( P < 0105) ( Fig16B), SREBP %(Fig16C) 1 O, pcdna311 ( + )ΠhGRP78 Hep G 2 (Fig17). Fig. 6 CCl 4 induced2hmgcoa reductase mrna and SREBP21 protein expression of HepG 2 cells were ameliorated by overexpression of GRP78 HepG 2 cells were transfected with pcdna311 ( + )ΠhGRP78 construct, and stimulated with or without 4 mmolπl CCl 4 for 8 hours. (A) Real time RT2PCR quantitative assays of GRP78, and (B) HMGCR mrna relative expression folds of those with pcdna311 ( + ) in HepG 2 cells. Values are expressed as mean standard error ( n = 3). 33 P < 0105 compared to control ; (C) Immunoblot analysis of SREBP21 protein was performed ( 2actin, as internal reference) Fig. 7 Accumulation of cellular lipid droplets induced by CCl 4 in HepG 2 cytoplasm was ameliorated by overexpression of pcdna311( + )ΠhGRP78 construct HepG 2 cells were transfected with pcdna311 ( + )ΠhGRP78 construct or pcdna311 ( + ), and stimulated by 4 mmolπl CCl 4 for 8 hours1 HepG 2 cells in received nothing was taken as negative control. Then all of the cells were fixed and stained with Oil Red O. The arrowhead show here positively cellular lipid droplets in the CCl 4 treatment cells (400 ). (A) Control ; (B) pcdna311 ( + ) + CCl 4 ; (C) pcdna3. 1 ( + )ΠhGRP78 + CCl 4, GRP78 SREBP21 HMGCoA,. 3,CCl 4 P450 CYP2E1,,, [11 ]. CCl 4,,, (MDA, ) GRP78, CCl 4, CCl 4, MDA

7 GRP78 [8 ]. Dey [12 ] CCl 4 CYP2E1,, GRP78 mrna. Werstuck [6 ] Hep G 2, SREBP21 IPP HMGCoA,GRP78 GADD153.,CCl 4 GRP78., 3 PERK,IRE1 ATF6 GRP78,, GRP78. PERK,IRE1, ATF6, [13 ]. SREBP21. ATF6,SREBP21, 1 (site21 protease, S1P) 2 (site2 2 protease, S2P) SREBPs,, HMGCoA [14 ]., psuperπgrp78 GRP78, SREBP21 HMGCoA, ; GRP78 CCl 4 SREBP21 HMGCoA, O.,CCl 4, GRP78., GRP78 CCl 4,, GRP78 CCl 4, CCl 4,.,, GRP78,. ( References) [ 2 ] Pagano G, Pacini G, Musso G, et al. Nonalcoholic steatohepatitis, insulin resistance, and metabolic syndrome : further evidence for an etiologic association [J ]. Hepatology, 2002, 35(2) : [ 3 ] Petrosillo G, Portincasa P, Grattagliano I, et al. Mitochondrial dysfunction in rat with nonalcoholic fatty liver Involvement of complex I, reactive oxygen species and cardiolipin [ J ]. Biochim Biophys Acta, 2007, 1767 (10) : [ 4 ] George J, Pera N, Phung N, et al. Lipid peroxidation, stellate cell activation and hepatic fibrogenesis in a rat model of chronic steatohepatitis [J ]. J Hepatology, 2003, 39 (5) : [ 5 ],,. [J ]. (Li Zai2Quan, Zhou Ai2Ru, Tang Chao2Shu. Molecular mechanism on endoplasmic reticulum stress responses[j ]. Chin J Biochem Mol Biol), 2004, 20 (3) : [ 6 ] Werstuck G H, Lentz S R, Dayal S, et al. Homocysteine2induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways [J ]. J Clin Invest, 2001, 107 (10) : [ 7 ] Donthamsetty S, Bhave V S, Mitra M S, et al. Nonalcoholic fatty liver sensitizes rats to carbon tetrachloride hepatotoxicity [ J ]. Hepatology,2007,45 (2) : [ 8 ],,,. [J ]. (Lin Sheng2Li, Zhuo De2Xiang, Wang Xiao2Hong, et al. Oxidative damage and ER stress are implicated in CCl 4 2induced SD rat hepatic steatosis [J ]. Chin J Biochem Mol Biol), 2006, 22 (5) : [ 9 ] Hong M, Lin M Y, Huang J M, et al. Transcriptional regulation of the Grp78 promoter by endoplasmic reticulum stress : role of TFII2I and its tyrosine phosphorylation [J ]. J Biol Chem,2005, 280 (17) : [10 ] Zeng L, Lu M, Mori K, et al. ATF6 modulates SREBP22mediated lipogenesis. [J ]. EMBO J, 2004, 23(4) : [11 ] Chavez E, Reyes2Gordillo K, Segovia J, et al. Resveratrol prevents fibrosis, NF2kappa B activation and TGF2beta increases induced by chronic CCl 4 treatment in rats [J ]. J Appl Toxicol, 2008, 28 (1) : [12 ] Dey A, Kessova I G, Cederbaum A I. Decreased protein and mrna expression of ER stress proteins GRP78 and GRP94 in Hep G 2 cells over2expressing CYP2E1 [ J ]. Arch Biochem Biophys, 2006, 447 (2) : [13 ],,. [J ]. ( Zhuo De2Xiang, Tang Chao2 Shu, Li Zai2Quan. Diversity in gene expression regulation of endoplasmic reticulum stress response[j ]. J Med Mol Biol), 2006, 3 (1) : [14 ] Ye J, Rawson R B, Komuro R, et al. ER stress induces cleavage of membrane2bound ATF6 by the same proteases that process SREBPs [J ]. Mol Cell, 2000, 6 (6) : [ 1 ] Angulo P. Nonalcoholic fatty liver disease [J ]. N Engl J Med,2002, 346(16) :