Spontaneous Recovery From Micronodular Cirrhosis: Evidence for Incomplete Resolution Associated With Matrix Cross-Linking

Transcription

1 GASTROENTEROLOGY 2004;126: Spontaneous Recovery From Micronodular Cirrhosis: Evidence for Incomplete Resolution Associated With Matrix Cross-Linking RAZAO ISSA,* XIAOYING ZHOU,* CHRISTOTHEA M. CONSTANDINOU,* JONATHAN FALLOWFIELD,* HARRY MILLWARD SADLER,* MARIANNA D. A. GACA,* EMMA SANDS,* IBNAUF SULIMAN,* NATHAN TRIM,* ANDREAS KNORR, MICHAEL J. P. ARTHUR,* R. CHRISTOPHER BENYON,* and JOHN P. IREDALE* *Division of Infection Inflammation and Repair, University of Southampton, Southampton General Hospital, Southampton, United Kingdom; and Cardiovascular Research, Bayer AG, Pharma Research, Wuppertal, Germany Background & Aims: Liver fibrosis and cirrhosis result from the excessive secretion of matrix proteins by hepatic stellate cells (HSCs). Previously considered irreversible, we have studied a model of cirrhosis to determine the mechanisms mediating and limiting spontaneous recovery. Methods: A micronodular cirrhosis was induced in rats after 12 weeks of CCl 4 intoxication. Livers were analyzed for evidence of matrix degradation, matrix metalloproteinase (MMP) and tissue inhibitor of metalloproteinase (TIMP) expression, stellate cell apoptosis, tissue transglutaminase (ttg) expression, and matrix cross-linking during spontaneous recovery of up to 366 days. Results: Over 366 days of recovery, micronodular cirrhosis underwent significant remodeling to a macronodular cirrhosis. Expression of collagen-1 and TIMP messenger RNA (mrna) decreased significantly and active MMPs were shown in livers during remodeling of fibrosis. Resolution also was characterized by apoptosis of HSCs, predominantly at the margins of fibrotic septa. Residual septa, not remodeled at 366 days, were characterized by ttg-mediated cross-linking and relative hypocellularity. Conclusion: Recovery from comparatively advanced cirrhosis is possible and results in remodeling from a micronodular cirrhosis to a macronodular cirrhosis. We suggest resolution is limited by ttg-mediated matrix cross-linking and a failure of HSC apoptosis. Fibrosis and cirrhosis of the liver represent major causes of morbidity and mortality worldwide. Hepatic stellate cells (HSCs) are central to the process of both progression and regression of liver fibrosis. Healthy HSCs store vitamin A and occupy a perisinusoidal position in the space of Disse and express desmin and glial fibrillary acidic protein (GFAP). 1,2 During injury, HSCs undergo a phenotypic change termed activation, which results in the loss of stored retinoids and transformation to a myofibroblast-like cell with expression of -smooth muscle action ( -SMA). 1,2 In this activated phenotype, HSCs are known to be the major source of matrix proteins, including interstitial collagens, which characterize fibrosis and ultimately lead to the gross architectural distortion of cirrhosis. 1 In addition, there is now considerable evidence that HSCs are a major source of both matrix-degrading metalloproteinases (MMPs), including those that degrade type I collagen and the potent collagenase inhibitors, and the tissue inhibitors of metalloproteinases (TIMPs) 1 and We and others have reported evidence showing that progression of fibrosis and cirrhosis is associated not only with excess matrix synthesis, but also a failure of matrix degradation. 3,8 17 This has led us to design models to determine directly the reversibility of liver fibrosis. By using rodent models, we recently have shown that advanced fibrosis resulting from both parenchymal and biliary injury is reversible A key feature of the reversal process in both of these disorders is apoptosis of the activated -SMA positive HSCs, which exclusively populate the scarred areas The loss of these cells is associated with both a reduction of hepatic collagen to levels present in normal liver and a diminution of TIMP expression, with a resulting increase in detectable liver collagenolytic activity. The end result of this process is effective matrix remodeling in association with loss of activated -SMA positive stellate cells that, over a comparatively short time frame, leads to a restitution of normal or near-normal liver architecture Abbreviations used in this paper: -SMA, smooth muscle action; GFAP, glial fibrillary acidic protein; HSC, hepatic stellate cell; MMP, matrix metalloproteinase; NGF, nerve growth factor; PCR, polymerase chain reaction; PFO, peakfibrosis; TIMP, tissue inhibitor of metalloproteinase; ttg, tissue transglutaminase; TTBS, Tween tris buffered saline; TUNEL, terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate nick-end labeling by the American Gastroenterological Association /04/$30.00 doi: /j.gastro

2 1796 ISSA ET AL. GASTROENTEROLOGY Vol. 126, No. 7 Previously, the end stage of fibrosis, cirrhosis, was considered to be irreversible, but several lines of evidence point to reversibility of liver fibrosis and cirrhosis in humans. These have included the application of potent antiviral therapies in chronic hepatitis B and C, together with other interventions in a variety of other chronic liver diseases. These studies have provided a series of clinical examples in which dramatic improvement in liver architecture is observed when the underlying liver injury is relieved. 21 Moreover, detailed analysis of explanted liver sections taken at transplantation has shown several features that are entirely consistent with matrix remodeling and degradation of fibrotic septa occurring even in advanced or end-stage cirrhotic disease. 22 Intriguingly, the pattern of matrix remodeling in these disorders is one in which a micronodular cirrhosis becomes transformed to a more macronodular pattern. However, for certain disorders reversibility may not be achieved so easily. Indeed, in hemochromatosis the results for cirrhosis are less dramatic, whereas fibrosis is reversible and the prognosis is improved by venesection. Although supporting the concept that recovery from fibrosis is possible, these examples of reversible human cirrhosis represent snapshots of a process and do not provide the temporal analysis required to monitor the factors that may regulate the process of either recovery or progression. Furthermore, the majority of studies are based on needle biopsy samples, which are open to the criticism that patchy fibrotic change or a macronodular cirrhosis may be sampled in an unrepresentative manner and thereby signal inappropriately advanced recovery. In this report, we describe our development of a rat model in which CCl 4 -induced parenchymal injury was used to induce an established micronodular cirrhosis from which incomplete resolution occurs. We have used this model to analyze the dynamics of matrix degradation and HSC turnover in a manner similar to that previously described in our fibrosis models to determine the mechanisms mediating and limiting spontaneous recovery from cirrhosis. Materials and Methods Models of Advanced Fibrosis and Cirrhosis Fibrosis was induced by the twice weekly injection of CCl 4 in olive oil vehicle in male Sprague Dawley rats ( g) exactly as previously described in a 4-week CCl 4 recovery model. 18 The institutional animal care committee and Home Office approved the protocol for animal treatment used in this study. However, in contrast to our previous model, intoxication with CCl 4 was continued for periods of 6, 8, and 12 weeks. 6-weekestablished fibrosis model. The first cohort of rats was injected with CCl 4 for a total of 6 weeks, animals were killed and their livers were harvested for analysis at peak fibrosis (3 days after final injection) and at 7, 15, and 28 days of spontaneous recovery (n 4 6 at each time point). 8-weekearly cirrhosis model. A further cohort of animals was injected with CCl 4 for 8 weeks, after which animals were killed and their livers were harvested for analysis at peak fibrosis (3 days after final CCl 4 injection) and at 28, 56, and 84 days of spontaneous recovery (n 4 6 for each cohort at each time point). 12-weekmicronodular cirrhosis model. A final cohort of animals was injected with CCl 4 for a total of 12 weeks, after which animals were killed and their livers were harvested for analysis at peak fibrosis (3 days after the final dose of CCl 4 ) and at 7, 15, 28, 84, 168, and 366 days of spontaneous recovery (n 4 6 for each cohort at each time point). After harvesting, livers were divided with a minimum of 2 lobes fixed in formalin for histologic analysis and immunohistochemistry and the remaining liver was snap-frozen for homogenization to extract total liver RNA and total liver protein exactly as previously described. 18 Histologic Analysis Ten percent formalin-fixed paraffin-embedded sections of liver tissue were divided in 3- to 4- m sections by using sterile techniques and mounted onto DNase/RNase-free Vector-bonded slides (Vector Laboratories, Burlingame, CA). Representative sections of each fixed liver were stained with H&E, reticulin, Sirius red, and Shikata orcein according to standard protocols. All histologic analyses then were undertaken by an experienced histopathologist (H.M.S.) in a blinded manner. Determination of Total Liver Collagen Content For the detection and quantification of collagen, 14- m cryotome sections were stained with picrosirius red solution. The extent of liver fibrosis was determined as the proportion of picrosirius-stained area in each section. For each rat, 64 fields of a constant raster of 31 mm 2 were analyzed at 100-fold final magnification. For semiautomated morphometry a Leica DME videomicroscope equipped with motor stage and the Quantimed 500MC (Leica, Germany) software were used. In addition, homogenates of snap-frozen liver were prepared and subjected to acid hydrolysis followed by hydroxyproline analysis exactly as previously described. 18 Livers from untreated rats (n 3) were included in this analysis to provide an index of change relative to normal liver. Detection and Quantitation of Messenger RNA for Collagen-1, TIMP-1, TIMP-2, MMP-13, and -SMA Taqman real-time polymerase chain reaction (PCR) was used to determine the relative expression of messenger RNAs (mrnas) for collagen-1, TIMPs 1 and 2, MMP-13, and -SMA in total RNA extracted from snap-frozen liver by the acid-phenol method. All primers and probes used were de-

3 June 2004 MATRIX CROSS LINKING IN CIRRHOSIS 1797 signed by using the Taqman Primer Expression program, and real-time Taqman PCR mrna quantitation was obtained by using the PE Applied Biosystems 7700 Sequence System (PE Applied Biosystems, Warrington, Cheshire, UK). Primers and probes for Taqman were as follows: (1) gluteraldehyde-3-phosphate dehydrogenase: sense: GGCCTACAT- GGCCTCCAA; antisense: TCTCTCTTGCTCTCAGTATC- CTTGC, probe: AGAAACCCTGGACCACCCAGCCC; (2) TIMP-1: sense: AGCCTGTAGCTGTGCCCCAA, antisense: AACTCCTCGCTGCGGTTCTG, probe: AGAGGCTCTCCA- TGGCTGGGGTGTA; (3) procollagen l 1: sense: TTCAC- CTACAGCACGCTTGTG, antisense: GATGACTGTCTT- GCCCCAAGTT, probe: ATGGCTGCACGAGTCACACCG; (4) -SMA: sense: CGAAGCGCAGAGCAAGAGA, antisense: CATGTCGTCCCAGTTGGTGAT, probe: TCCTGACCCT- GAAGTATCCGATAG; (5) MMP-13: sense: GGTTGAGC- CTGAACTGTTTTTGA, antisense: CTCGTATGCAGCAT- CCACATG, probe: AGTCCTTTTGGCCAGAACTTCCC; (6) TIMP-2: sense: GCCCTATGATCCCATGCTACA, antisense: TCTGTGACCCAGTCCATCCA, probe: CTCCTCCCCGGA- TGAGTGCC. One microgram of first-strand complementary DNA (transcribed from 10 ng RNA) and 0.3 mol/l (of primers and 0.3 mol/l) of probe were used in the 25- L Taqman reaction. Taqman 2 Universal PCR master Mix and 0.2 ml Optical Reaction Tube (PE Applied Biosystems) were used. The conditions of the reaction were as follows: initial steps were 50 C for 2 minutes and 95 C for 10 minutes, followed with a denaturing step for 15 seconds at 95 C, and the annealing/ extension step at 60 C for 1 minute and performed in cycles. Determination of the expression of the housekeeping gene gluteraldehyde-3-phosphate dehydrogenase was used simultaneously and all reactions were undertaken in triplicate. After detection of the threshold cycle for the target mrna in each sample, relative concentrations were calculated and normalized for gluteraldehyde-3-phosphate dehydrogenase expression and expressed as the percentage of expression at peak fibrosis. Four representative livers from each time point were studied in triplicate. In a further experiment, the relative level of specified mrnas were determined in normal untreated liver relative to peak fibrosis and 366-day recovery samples. Detection and Quantitation of Proteins by Western Blotting and Zymography Liver tissues were homogenized in the presence of protease inhibitors (50 mmol/l Tris HCl, ph 7.6, containing 0.25% Triton, 0.15 mol/l NaCl, 10 mmol/l CaCl 2, 0.1 mmol/l phenylmethylsulfonyl fluoride, 10 mol/l leupeptin, 10 mol/l pepstatin, 0.1 mmol/l iodoacetamide, and 25 g/ml aprotinin). A total of 30 g of protein were separated under reducing conditions by using sodium dodecyl sulfate polyacrylamide gel electrophoresis. Proteins were electrotransferred onto polyvinylidene difluoride. The membrane was blocked for 1 hour in 1% to 5% nonfat dry milk in Tween trisbuffered saline (TTBS). Western blot analysis of liver tissue and HSCs was performed by using a monoclonal anti -SMA, -actin antibody (Sigma, Poole, UK); anti MT1-MMP antibody (Chemicon, Harrow, UK); and anti-tissue transglutaminase (ttg) antibody (Stratech Scientific, Luton, UK). Each antibody was used at a concentration of 1:1000. Membranes were incubated overnight with the primary antibody or with nonimmune immunoglobulin G (as negative control) in TTBS, after which the secondary horseradish-peroxidase conjugated antibodies were applied in TTBS containing 0.1% nonfat dry milk for 1 hour. Reactive bands were identified by using enhanced chemiluminescence (ECL; Amersham, Bucks, UK) and autoradiography according to the manufacturer s instructions. For zymography, 25 g of protein from liver homogenates was subjected to 8% sodium dodecyl sulfate polyacrylamide gel electrophoresis in gel containing 1 mg/ml gelatin under nonreducing conditions. After electrophoresis, the gels were washed twice with 2.5% Triton X-100 for 30 minutes to remove sodium dodecyl sulfate. The gels were rinsed briefly with distilled H 2 0 and then incubated overnight at 37 C in proteolysis buffer (50 mmol/l Tris, ph 7.4, 150 mmol/l NaCl, and 5 mmol/l CaCl 2 ). The gels were stained with 0.125% Coomassie brilliant blue for 10 minutes and destained in 10% acetic acid/50% methanol. Detection of ttg-mediated Matrix Cross-Links and ttg For ttg and cross-linking analysis, unfixed 5- m frozen tissues were blocked with 3% bovine serum albumin containing 0.1% Tween 20 and 5% goat serum in the presence of protease inhibitors (1 mmol/l leupeptin, 1 mmol/l benzamidine, 1 mmol/l phenylmethylsulfonyl fluoride, 1 mmol/l pepstatin) and 10 mmol/l ethylenediaminetetraacetic acid. The primary antibody was diluted in blocking buffer and incubated at 4 C overnight. The secondary antibody (1:500 anti-mouse conjugated with Cy 5) was added for 1 hour at room temperature, followed by fixing the sections with icecold methanol for 10 minutes at 4 C and mounting using Vector shield fluorescent mounting medium. Quantitation of -SMA Positive HSC Numbers in Liver Sections The number of -SMA positive HSCs were determined in liver sections at peak fibrosis and during recovery after immunostaining as previously described. 18,19 The number of cells was determined by counting 20 random highpowered fields from each liver section per time point (n 4 6 livers per time point). Dual staining for terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphate nick-end labeling (TUNEL) and -SMA was undertaken and the number of TUNEL-positive apoptotic cells within the fibrotic bands was determined exactly as previously described. 18,19 Immunohistochemistry of Cells Within Fibrotic Bands Representative tissue sections from peak fibrosis and 168 and 366 days of recovery were stained for -SMA, desmin,

4 1798 ISSA ET AL. GASTROENTEROLOGY Vol. 126, No. 7 Table 1. Antibody Conditions Antibody Controls Antigen retrieval Dilution Manufacturer -SMA Muscle Microwave 1/40,000 Clone 1A4 (Sigma, Poole, UK) Desmin Muscle Microwave 1/20 Clone D9 (PROGEN Biotechnik GmbH) GFAP Brain (Protease) for paraffin-embedded 1/2000 AO611 (DAKO, Kidlington, Oxon, UK) tissue or acetone fix for frozen tissue PECAM-1 Liver None 1/65 sc (Santa Cruz Biotechnology Inc., Santa Cruz, CA) ED1 Spleen Microwave 1/150 Clone ED1 (Serotec, Kidlington, Oxon, UK) ED2 Spleen Microwave 1/25 Clone ED2 (Serotec) Lysine-(N- glutamyl) Fibrotic liver None 1/1001 Ab Cam (Cambridge, UK) platelet/endothelial cell adhesion molecule-1 and GFAP, and macrophage markers ED1 and ED2 by immunohistochemistry (Table 1), to identify cells present in the fibrotic bands. Antibodies used were applied at various concentrations (Table 1) to the tissue sections with some requiring additional microwave antigen retrieval, or trypsinization to unmask antigens hidden by cross-linkages that occurred during the tissue fixation process. Positive and relevant negative controls were included for each antibody used (Table 1). The Vectorstain Universal Quick kit (Vector Laboratories Ltd.) was used in the detection of the antigen. Antigen visualization was achieved by addition of diaminobenzedine (DAB) or VIP (Vector) and counterstained with Mayer s Haemulum. Determination of Cellularity of Septa Representative liver sections from the 12-week peak fibrosis time point (3 days after final injection of CCl 4 ) and 366 days of spontaneous recovery after 12 weeks of CCl 4 treatment (n 4 for each time point) were stained with hematoxylin and Sirius red according to standard protocols. The number of nuclei within Sirius red positive areas then were determined, first by counting nuclei using a graticule to determine the overall number per unit area of fibrotic tissue in 10 random high-powered fields. Second, image analysis was used to determine the number of nuclei per unit area of Sirius red positive tissue over 50 randomly selected high-powered fields from each section at the earlier-mentioned time points. Results Experimental Liver Fibrosis and Macronodular Cirrhosis Showed Evidence of Extensive Matrix Remodeling During Spontaneous Recovery All harvested livers in each model were subjected to histologic analysis after picrosirius red and H&E staining and reported blind by H.M.S. as described in the Materials and Methods section. Livers harvested from cohorts of rats treated for 6 weeks with CCl 4 (n 6) showed a septate pattern of fibrosis primarily linking the hepatic (central) veins. One of these 6 livers showed the histologic appearance of an early macronodular cirrhosis. Over a 15- to 28-day recovery period (n 4 6 at each time point), the livers showed a dramatic remodeling of fibrotic matrix with a return to near-normal histology in a manner similar to that observed in our previous study. 18 After 8 weeks of CCl 4 treatment, 5 of the 6 harvested livers showed evidence of cirrhosis, whereas the other liver showed an early septal fibrosis only. Two livers showed a macronodular pattern with septa linking the hepatic veins and enclosing 2 or more intact portal tracts within each nodule. The remaining 3 livers showed an early micronodular pattern with established septa linking hepatic veins and further new matrix bridging these areas to the portal tracts creating micronodules with the portal tract and one or more hepatic veins on their rim. A further cohort of rats treated with CCl 4 for 8 weeks were allowed to spontaneously recover as described in the Materials and Methods section. Over the 84-day recovery period, the septa became progressively remodeled. In the histologic analysis of the cohort of 6 animals allowed to recover for 84 days after 8 weeks of CCl 4, 2 livers showed an attenuated macronodular cirrhosis in which 2 or more portal tracts were deep within the substance of a large nodule. The changes clearly suggested loss of some of the septa that had originally bridged the hepatic veins with the portal tracts. The remaining 4 livers showed evidence of a residual perivenular (central) fibrosis only: there were no bridging septa from the hepatic veins to the portal tracts. In addition, the caliber of the remaining septa was reduced in width compared with peak fibrosis. Experimental Micronodular Cirrhosis Showed Incomplete Matrix Remodeling During Spontaneous Recovery The data from studies of rat livers injured for 6 and 8 weeks suggested that the development of a cirrhosis per se was not associated with irreversible fibrotic change. However, the 8-week model indicated that the development of a more advanced micronodular cirrhosis

5 June 2004 MATRIX CROSS LINKING IN CIRRHOSIS 1799 Figure 1. Histologic appearance of representative livers harvested at peak fibrosis after induction of micronodular cirrhosis by CCl 4 injection for (A) 12 weeks, (B) after 84 days, and (C) after 366 days of spontaneous recovery after staining with Sirius red. At peak fibrosis, there is an established micronodular cirrhosis with dense mature septa bridging hepatic veins and linking these areas with the portal tracts. The septa are highly cellular. (A) Fine collagen fibrils are observed extending into the parenchyma from the fibrotic areas. (B) Little matrix remodeling was observed during the first 28 days of recovery, but from 28 to 84 days of recovery, progressive remodeling of matrix was observed, most obvious with the loss of the most recently formed bridging fibrils and areas of perisinusoidal fibrosis; regenerative nodules were also clearly present and in some areas were no longer bounded by fibrotic tissue. (C) Further recovery to 168 days and 366 days showed an additional loss of matrix to yield an attenuated macronodular cirrhotic pattern with prominent regenerating nodules. (C) Ultimately, residual thin attenuated septa were left (366 days), representing an established macronodular pattern of cirrhosis. might be associated with a failure to undergo complete remodeling during prolonged spontaneous recovery. A further model of micronodular cirrhosis was therefore established. The livers from cohorts of rats treated with CCl 4 for 12 weeks were sectioned and stained with Sirius red and H&E and analyzed at peak fibrosis and for periods of up to 366 days of spontaneous recovery (n 4 6 for each time point). At peak fibrosis all 6 livers showed an established micronodular cirrhosis with relatively broad collagenous septa linking the hepatic veins and bridging these areas of abnormal fibrosis with the portal tracts (Figure 1A). Most portal tracts were involved with only occasional examples of portal tracts isolated within a nodule. The septa were highly cellular, containing numerous elongated nuclei. Fine collagen fibrils also were visible extending into the sinusoids from the fibrotic areas. In addition, in some examples, there was evidence of cholangiolar proliferation and occasional evidence of angiogenesis in the broader septa. There was pronounced evidence of regenerative nodule formation within the parenchyma that produced compression of adjacent cell plates. Over the first days after cessation of CCl 4 dosing, there was histologic evidence of remodeling. Between 28 and 84 days there was continued histologic evidence of matrix remodeling that manifest as the further loss of the most recently formed bridging fibrils that were linking broad septa to the portal tracts. Regression of the perisinusoidal fibrosis also was marked and there was a progressive thinning and loss of the septa. Broad septa interlinking hepatic veins remained, although they were more attenuated. Regenerative nodules were clearly present and were no longer bounded by fibrotic tissue in some areas (Figure 1B). Overall, the appearances were of a micronodular cirrhosis that was undergoing transformation into a macronodular pattern. Moreover, the distribution of the residual septa suggested that these had been established earliest in the progressive injury phase. From 84 to 168 days recovery, there was a further remodeling to yield a macronodular cirrhotic pattern with prominent regenerative nodules. A further cohort of 4 livers was allowed to recover for 366 days. These showed an established macronodular pattern of cirrhosis with thin septa linking some hepatic veins (Figure 1C). The nodules created had 2 or more portal tracts within their boundaries. The distribution of the linking bands correlated with those areas in which the first fibrotic septa had formed in the progressive phase of injury and contributed the most mature fibrotic bands of peak fibrosis. The septa were relatively hypocellular in comparison with earlier time points in the model. In addition, although there was no residual portal bridging, fine disrupted septal remnants could be observed in the periportal areas of these livers. Remodelling of Micronodular Cirrhosis Is Associated With a Decrease in Total Liver Collagen To further quantify the remodeling of fibrosis observed histologically, representative liver sections were stained with Sirius red and subjected to image analysis to determine the area of positive staining. By this method, progressive treatment with CCl 4 resulted in a progressive increase in the area of positive staining from 6 through 12 weeks of treatment (Figure 2). During the 366-day recovery period after 12 weeks of CCl 4, there was a progressive reduction in the area of Sirius red staining, confirming the results obtained by histologic analysis (Figure 2A). By total hydroxyproline analysis, a similar pattern of loss of collagen was observed, indeed by 366 days the hydroxyproline content of treated livers was close to that observed in normal (untreated) liver (Figure 2B). Remodelling of Micronodular Cirrhosis is Associated With a Decrease in Liver Collagen-I mrna Expression The liver expression of collagen-i was determined by Taqman PCR. After 12 weeks of CCl 4 treatment, expression of procollagen I mrna remained significantly increased through the first 28 days of recovery

6 1800 ISSA ET AL. GASTROENTEROLOGY Vol. 126, No. 7 Figure 2. (A) Total liver collagen was determined by image analysis after Sirius red staining of representative liver sections as described in the Materials and Methods section. Progressive treatment with CCl 4 resulted in increased areas of positive staining with Sirius red from 6 through 12 weeks of treatment. During recovery, there was a progressive decrease in Sirius red staining to 366 days of recovery. (B) Hydroxyproline analysis also was undertaken to provide an indirect biochemical measurement of liver collagen and was expressed relative to normal (untreated) liver (control). By this method, a similar pattern of increasing liver collagen content was observed in the progressive phase of injury. Recovery was associated with a decrease in liver hydroxyproline content to levels approaching that observed in untreated liver. before decreasing to low levels at 84 days, after which levels continued to decrease at 168 and 366 days of recovery (Figure 3A). Indeed, after 366 days of recovery the expression of pro collagen-1 mrna was not significantly different than that observed in normal untreated liver. Remodelling of Micronodular Cirrhosis Is Associated With Decreased TIMP Expression and Secretion of Active MMPs Matrix degradation in the liver is mediated by MMPs, which are in turn inhibited by the specific inhibitors TIMP 1 and 2. Taqman real-time PCR was used to quantify expression of MMP-13 (rat interstitial collagenase) and TIMPs 1 and 2 in total liver RNA. TIMP-1 (Figure 3B) and TIMP-2 (Figure 3C) mrnas followed an almost identical pattern to that observed for collagen-i mrna expression. TIMP expression remained increased through the first 28 days of recovery before becoming significantly decreased at 84 days and showed a further more modest reduction in expression through the remainder of the 366-day follow-up period (Figure 3B). Indeed, at 366 days, expression of TIMP-1 mrna was at a level comparable with that observed in untreated normal liver. In contrast, expression of MMP-13 was only significantly increased at the peak fibrosis time point and was strongly correlated with the intense inflammatory response present at this time point and thereafter was detected at low levels through the 366-day recovery period (Figure 3D). Gelatinase A (MMP-2) and MT1-MMP also have been described to have interstitial collagenase activity and might represent important candidate collagenases. 23 Expression of gelatinase A by zymography was increased relative to normal untreated liver after 12 weeks of CCl 4 treatment. Moreover, the activated 66-kilodalton form of gelatinase A was increased at this time point (Figure 4A). Through the first 28 days of the recovery period, expression of both the active and pro-form of gelatinase A remained constant and increased. During the subsequent 56 days of recovery (to 84 days), gelatinase A progressively decreased but in contrast to normal untreated liver active gelatinase A remained detectable (Figure 4A). Gelatinase A was only detectable at low levels, comparable with untreated control livers, and in samples of livers from 168 or 366 days of recovery. Expression of MT1-MMP determined by Western blot analysis showed an identical pattern of expression to gelatinase A being expressed at high levels at peak fibrosis and through the first 28 days of recovery. Thereafter, MT1-MMP showed a progressive decrease through 84 days to 168 days of recovery (Figure 4B). Residual Fibrotic Septa at 366 Days of Recovery Showed -( -Glutamyl) Lysine Cross-Linking The persistence of fibrotic septa from peak fibrosis through 366 days of recovery, despite the presence of

7 June 2004 MATRIX CROSS LINKING IN CIRRHOSIS 1801 Figure 3. Analysis of total liver RNA was undertaken as described in the Materials and Methods section by Taqman PCR in normal, untreated liver and at peak fibrosis 3 days after the last injection of CCl 4 (peak fibrosis [PFO]) during 366 days of recovery (28, 84, 168, and 366 days) after 12 weeks of CCL 4 intoxication as described in the Materials and Methods section. (A) The expression of procollagen-1 initially was constant and showed a progressive decrease during the recovery period only after 28 days of recovery. Expression of (B) TIMP-1 and (C) TIMP-2 showed a similar pattern with significant reductions in mrna expression only occurring after 28 days of recovery. (D) Expression of MMP-13 showed a sudden decrease in expression over the first 28 days of recovery, after which expression remained relatively constant through 366 further days of recovery. (Data are presented as mean SEM for n 4 representative samples at each time point analyzed in triplicate. *P 0.05, **P 0.01 by Mann Whitney.) active MMPs, suggested that a critical change in the matrix may have occurred. The presence of collagen-i in the septa at peak fibrosis and during recovery was confirmed by immunohistochemistry (data not shown). Liver sections at peak fibrosis and all recovery time points to 366 days after 12 weeks CCl 4 treatment were stained with orcein, which binds to elastin and cross-linked collagen fibrils. In addition, liver sections from peak fibrosis after 6 weeks CCl 4 treatment were stained as a control (representing reversible fibrosis). No significant orcein staining was observed in the 6-week peak fibrosis group or at any time point in recovery. In contrast, orcein staining was pronounced in the central area of the broad septa after 12 weeks of CCl 4 (Figure 5A) and was observed in the persistent septa present through all recovery time points to 366 days of recovery (Figure 5B). One major mechanism that might render matrix resistant to degradation results from the formation of ε-( -glutamyl lysine) cross-links, the formation of which are catalyzed by ttg. To determine whether ε-( -glutamyl lysine) crosslinking had occurred, sections were immunostained as described in the Materials and Methods section. Liver sections treated for 6 weeks with CCl 4 (the reversible fibrosis model) were uniformly negative for cross-linking, whereas samples at 12-weeks peak fibrosis showed clear evidence of cross-linking within the central portion of the mature fibrotic septa (Figure 5C D). Moreover, the persistent septa at 168 and 366 days of recovery showed the presence of ε-( -glutamyl) lysine cross-links (Figure 5G H). Homogenates made in neutral buffer of representative livers from the 6 and 12 weeks peak fibrosis time points were subjected to Western analysis for ε-( -glutamyl) lysine cross-links to provide a further analogue of the immunohistochemical data. Western blotting showed a dominant band of 160 kilodaltons in

8 1802 ISSA ET AL. GASTROENTEROLOGY Vol. 126, No. 7 Figure 4. (A) Representative examples of gelatinase A expression determined by zymography as described in the Materials and Methods section. Expression of gelatinase A was increased relative to normal (CON, control) after 12 weeks of CCl 4 treatment (0). In particular, the 66-kilodalton form of gelatinase A also was found to be increased. During recovery, expression of both active and proform of gelatinase A remained increased at 84 days (84d) but by 168 days (168d) expression had decreased to levels comparable with untreated normal controls in all livers studied. (B) Representative examples of MT1-MMP expression was determined by Western blot analysis as described in the Materials and Methods section. MT1-MMP showed an essentially identical expression pattern to gelatinase A, being expressed at high levels through peak fibrosis to 28 days of recovery, whereafter MT1-MMP levels decreased to levels comparable with untreated control (data not shown) by 168 days of recovery. samples of liver at 12-weeks peak fibrosis. In normal untreated liver and 6-week CCl 4 -treated liver, the -( glutamyl) lysine cross-link antigen was either not detected or present at extremely low levels (Figure 5I K). In homogenates from 366 days recovery from 12-weeks CCl 4 treatment, there was clear persistence of the crosslink antigen. Purified collagen-1 treated in vitro with ttg generated an antigen of 160 kilodaltons by Western blotting in parallel experiments. Moreover, treatment of liver homogenates with bacterial collagenase or recombinant MMP-1 resulted in degradation of the 160-kilodalton antigen (data not shown), suggesting the crosslinked antigen, at least in part, represented an in vivo cleaved product of collagen/collagen peptide. Figure 5. (A B) To detect elastin and matrix cross-linking, representative liver sections were analyzed after orcein staining. (C H) Further staining for cross-linking with a specific antibody to matrix cross-links was undertaken and (I K) homogenates from these livers were subjected to Western blot analysis for matrix cross-links. (A B) shows a representative result after orcein staining. (A) Evidence of crosslinking and elastin was observed in the central portion of the most mature fibrotic bands after 12 weeks of CCl 4 treatment (orceinpositive fibrils, arrow). (B) During the 366 days of recovery, there was a loss of matrix, leaving a residual attenuated macronodular cirrhosis in which the residual fibrotic bands showed some orcein positivity (arrow). (C H) Representative liver sections were stained with an antibody directed against -( -glutamyl) lysine matrix (ttg-mediated) cross-links. The central portion of the most mature septa was found to be positive for cross-links in the 12-week peak fibrosis samples (C 40, D with propidium iodide (PI) counterstain 20). Negative control samples were entirely negative (representative example E 10). Positive staining for ttg was observed in areas of fibrosis at 12 weeks peak fibrosis (F 10). After 168 days of recovery, cross-links were immunolocalized to the persistent areas of fibrosis within liver (G 10, H 40). (I K) Western blot analysis of liver homogenates was undertaken by using a cross-link detecting antibody as described in the Materials and Methods section (I, J, and K represent individual representative Western blot analyses). No binding was detected with an antibody directed against matrix cross-links in normal untreated liver (Normal) and minimal binding was observed at 6 weeks peak fibrosis (I, day 0). This signal was no longer detectable after 15 days of spontaneous recovery in the 6-week fibrosis model (I, day 18). In contrast, a band of 160 kilodaltons was detected after Western blot analysis for matrix cross-links in representative liver homogenates from 12 weeks peak fibrosis (J and K, day 0). This signal remained detectable even at 366 days of recovery (K, day 366).

9 June 2004 MATRIX CROSS LINKING IN CIRRHOSIS 1803 Loss of -SMA Positive HSCs During Remodeling of Micronodular Cirrhosis Is Mediated by Apoptosis During progressive fibrosis, after 6 and 8 weeks of CCl 4, the fibrotic septa were highly cellular. Moreover, the cells within the septa were shown to be uniformly -SMA positive. After 12 weeks of CCl 4, all the septa were still highly cellular but the central portion of the Figure 6. Protein extracts from activated HSCs were subjected to Western analysis for ttg. ttg with a molecular weight of 77 kilodaltons was detected in activated HSCs. Lanes 1 3 represent increasing concentrations of cell lysates from activated HSCs. Activated HSCs Express ttg Protein extracts from culture-activated HSCs were subjected to Western analysis for ttg. Activated HSCs showed clear evidence of ttg expression (Figure 6). Furthermore, sections of the 12-week peak fibrosis samples were immunostained for ttg to determine whether it was expressed in vivo during injury. ttg was detected in liver sections and was colocalized to areas of fibrosis (Figure 5F). Remodelling of Micronodular Cirrhosis Is Associated With a Reduction of -SMA Positive HSCs We have shown previously that a key feature of recovery from liver fibrosis is apoptosis of the activated -SMA positive HSCs. To determine the dynamics of -SMA positive HSC loss during remodeling of micronodular cirrhosis, -SMA mrna was determined in total liver RNA by Taqman PCR and liver homogenates were subjected to Western blot analysis for -SMA. Livers also were sectioned and immunostained for -SMA. Increasing duration of treatment with CCl 4 was associated with a progressive increase in the expression of -SMA mrna and protein and the number of activated -SMA positive HSCs within each liver (Figure 7). During remodeling after 12 weeks CCl 4, the level of -SMA mrna decreased to levels comparable with that observed in untreated control livers (Figure 7A). -SMA protein detected by Western blot analysis in liver homogenates (data not shown) and the total number of -SMA positive cells determined in representative liver sections showed a progressive decrease to 366 days of recovery (Figure 7B). Figure 7. (A) The liver levels of -SMA mrna were determined by Taqman PCR of total liver RNA as described in the Materials and Methods section. No significant change in -SMA expression was observed during the first 28 days of recovery after 12 weeks of CCl 4 treatment. However, from 28 through 366 days of recovery, there was a significant decrease in -SMA mrna (n 4 for each time point, *P 0.05 and **P 0.01 by Mann Whitney). After immunostaining of representative sections, the number of -SMA positive cells were counted over 20 random high-powered fields after 6 weeks of CCl 4 (6Wk PFO), 8 weeks of CCl 4 (8Wk PFO), 12 weeks of CCl 4 (12Wk PFO), and at time points during recovery ( days) after 12 weeks of CCl 4. Recovery from fibrosis was associated with a significant diminution in -SMA positive cells over the 366-day time period. (n 4 6 for each time point. *P 0.05 and **P 0.01 by Mann Whitney.)

10 1804 ISSA ET AL. GASTROENTEROLOGY Vol. 126, No. 7 Figure 8. Representative liver sections were dual stained with TUNEL and -SMA as described in the Materials and Methods section. In addition, the total number of apoptotic cells (TUNEL positive) within each fibrotic band were determined at PFO and 168 (168d) and 366 (366d) days of recovery. (A) At each recovery time point, there is evidence of apoptosis of cells within the fibrotic septa (arrow), TUNELpositive cells were detected with red chromogen, -SMA cells were detected with blue chromogen at PFO after 12 weeks of CCl 4.(A) However, the -SMA negative cells, which predominated in the center of the mature fibrotic bands, showed fewer apoptotic figures. (B) The total number of apoptotic figures within fibrotic septa at each time point was determined and is shown. (n 4 6 for each time point data expressed as mean SEM. **P 0.01 by Mann Whitney.) was associated with a progressive loss of -SMA positive stellate cells, at 168 and 366 days the residual septa contained few if any -SMA positive HSCs. In addition, compared with peak fibrosis the septa at 168 and 366 days were relatively hypocellular. By TUNEL staining there was evidence of apoptosis of cells within the fibrotic septa after 12 weeks of CCl 4. Moreover, dual TUNEL and -SMA staining of liver sections during the recovery from cirrhosis indicated that loss of the -SMA positive cells was mediated by apoptosis (Figure 8A B). Apoptotic HSCs were most numerous in these areas in which matrix remodeling took place and in which a sustained level of HSC apoptosis was observed (Figure 8A). In the central region of the most mature septa relatively few apoptotic cells were observed (Figure 8A). At all time points studied, apoptosis of cells within the scar occurred predominantly at the margin of the septa. The reduction in cellularity of the residual scar during recovery was quantified as described in the Materials and Methods section. Both manual counting under light microscopy with a graticule (data not shown) and image analysis showed a significant decrease in cellularity in the residual fibrotic septa at 366 days of recovery compared with fibrotic areas at peak fibrosis after 12 weeks of CCl 4 (Figure 9). To further characterize the HSC population within and around the septa, representative sections at peak fibrosis and 168 and 366 days of recovery were immunostained for -SMA, desmin, and GFAP. In addition, most mature septa, linking hepatic veins and characterized by evidence of collagen cross-linking (see previously), contained relatively few -SMA positive cells (Figure 8A). Conversely, the margins of these mature septa and the areas rich in perisinusoidal collagen were also highly cellular and exclusively populated with -SMA positive cells (Figure 8A). In addition, the more recently established septa, including the septa bridging to the portal tracts, were exclusively populated by -SMA positive cells. With recovery, matrix remodeling occurred in those areas in which -SMA positive cells predominated. Moreover, because the remodeling Figure 9. Decreasing cellularity of residual scar tissue occurs with recovery. Sections were stained with H&E and Sirius red and subjected to image analysis as described in the Materials and Methods section. By this method, there was a significant decrease in the cellularity of the scar per unit area of Sirius red positive tissue comparing PFO after 12 weeks of CCL 4 with 366 days (366d) of recovery. (n 4 for each time point, data are expressed as mean SEM. *P 0.05 by Mann Whitney.)

11 June 2004 MATRIX CROSS LINKING IN CIRRHOSIS 1805 the central portion of the most mature fibrotic septa, in which cells were most frequently -SMA negative and matrix cross-linking was shown (see previously), the cells were positive for desmin. After recovery, at 168 and 366 days, the persistent septa were populated almost exclusively by -SMA negative, desmin-positive cells (Figure 10). Cells in the middle and margins of the septa were positive for GFAP but negative for markers of Kupffer cells and macrophages (ED1, ED2), lymphocytes (CD3), and endothelial cells (platelet/endothelial cell adhesion molecule-1) (data not shown). ED1- and ED2-positive cells were observed at the margins of the septa at all time points studied. Figure 10. The intermediate filament expression of the cells populating the septa was determined by staining for -SMA and desmin as described in the Materials and Methods section. (A) Cells in the most recently formed septa and bridging septa, perisinoisodal areas, and at the margins of mature septa were found to be -SMA positive, however, (B) the cells at the center of the most mature septa generally were found to be -SMA negative. (B) Nevertheless, all these cells were shown to be desmin positive. By 366 days recovery, the residual cells within the fibrotic bands were found to be almost uniformly -SMA negative. (C) -SMA staining (left panel top and bottom) with parallel analysis for Sirius red (right panel top and bottom) in pericentral fibrotic areas (top) and attenuated residual septa (bottom) are shown. (D) Residual septa at 366 days of recovery were uniformly desmin positive. these sections also were stained for markers of other candidate cells (CD3, ED1, ED2, and platelet/endothelial cell adhesion molecule-1). Analysis of sections stained with these markers showed that at peak fibrosis the cells in the perisinusoidal fibrosis, the most recently developed septa, and at the margins of the more mature septa were largely -SMA, GFAP, and desmin (Figure 10) positive. With recovery these cells were progressively lost through apoptosis (see previously). By contrast, in Discussion We have established and characterized a rodent model of 12 weeks of CCl 4 treatment, which leads to micronodular cirrhosis. After cessation of CCl 4, this micronodular cirrhosis undergoes remodeling to yield a macronodular cirrhosis. The residual macronodular change does not undergo complete remodeling to normal even after a year of recovery. Our data provide evidence that recovery from advanced experimental cirrhosis occurs but is incomplete. By directly comparing the residual septa in this model with those in our previous recovery studies 18 and our studies of fibrosis and early cirrhosis after 6 and 8 weeks of CCl 4 treatment, we have identified histologic and biochemical features associated with irreversibility. Two key observations are that persistent septa are ttg cross-linked and that HSCs within the septa are -SMA negative and, unlike those that occur at the margin of resolving septa, seem less susceptible to apoptosis. Indeed, HSCs that are GFAP and desmin positive are present within the persistent septa even after a year of recovery, but the residual septa are relatively hypocellular. Our model of reversible cirrhosis represents an important experimental tool, but it is not without limitations. First, the technology does not exist to study the fate of the matrix or the cellular components longitudinally within a given area of fibrotic change in the liver of individual rats. We have analyzed the changes in the histology and composition of the hepatic matrix in cohorts of rats during spontaneous recovery after induction of experimental fibrosis and have, therefore, interpreted our observations cautiously. We have not shown conclusively that the induced cirrhotic lesion is irreversible. To do so would involve following-up a cohort of rats in which CCl 4 cirrhosis was induced until their natural deaths. Rather, we have established a cirrhotic lesion in rats that persists for in excess of one third of their life

12 1806 ISSA ET AL. GASTROENTEROLOGY Vol. 126, No. 7 span and is associated with limited remodeling over the second 6 months of recovery. We suggest that this model is likely to reflect the pattern of events in tissue remodeling in human cirrhosis, for example, after successful antiviral therapy in chronic hepatitis B virus or hepatitis C virus induced disease. Our results provide no support for the concept that the cirrhotic process may progress even after withdrawal of the injurious agent. Indeed, there is a dramatic remodeling of the fibrosis during the year of spontaneous recovery. One clear conclusion is that the remodeling occurs initially and substantively in the least mature areas of fibrosis. This results in a loss of a micronodular to favor a macronodular pattern with contemporaneous hepatocyte regenerative activity. Our observations mirror exactly those described by Wanless et al. 22 in explanted human liver and supports the model proposed by that group for matrix remodeling and the development of macronodular change in end-stage human cirrhosis. The loss of -SMA positive HSCs in the less mature septa and perisinusoidal areas correlated with matrix degradation both chronologically and topographically. In contrast, the central areas of the most mature septa in which -SMA negative GFAP-positive and desminpositive cells predominated represented those areas in which matrix degradation was incomplete even after 366 days of recovery. Resolution of fibrosis in the less mature septa, perisinoidal areas, and margins of mature septa followed an identical pattern to that we have observed in our previous models. Specifically, matrix remodeling was correlated with a decrease in expression of procollagen-i and TIMPs 1 and 2 ultimately to normal levels and apoptosis of the -SMA positive HSCs and other myofibroblasts In comparison with our previous studies, the loss of the -SMA positive cell population in the 12-week CCl 4 cirrhosis model occurred over a considerably longer period (28 56 days) than that observed in our previous fibrosis model (3 7 days). 18 This suggests the intriguing possibility that the more extensive scarring in the 12-week model may promote survival of HSCs and other myofibroblasts. We have recently shown that collagen-i may directly or indirectly provide a key survival signal to activated -SMA positive HSCs 24,25 and TIMP-1 (which is more persistent in the 12-week model) also promotes HSC survival. 20 Taken together with the results presented here, these data suggest there is a close link between the persistence of collagen-i rich matrix and survival of -SMA positive HSCs and other myofibroblasts, whereas, conversely, matrix degradation is associated with HSC apoptosis. Moreover, the persistent desmin-positive, GFAP-positive, -SMA negative cells may continue to express genes promoting fibrosis (e.g., collagen-i and TIMP-1). An important issue is the nature of the MMPs involved in remodeling of the liver scar. The expression of 2 candidate collagenases during recovery, namely MT1- MMP and gelatinase A, was detected through the period in which remodeling of fibrosis occurred. In contrast, the expression of MMP-13 was relatively unchanged throughout the model, being raised only at the first study time point. The expression of MMP-13 was strongly correlated with the presence of inflammation, an observation we have made also with a recent murine fibrosis model 25 and in contrast to our previous study of hepatic fibrosis, in which liver harvest was commenced as hepatic inflammation decreased. 18 These data strongly suggest that the major matrix remodeling occurs as a result of MMP-2 and MT1-MMP expression. 23 Although MMP-13 may play a key role in initiating matrix degradation, intriguingly Watanabe et al., by using a similar model, 26,27 recently have described a similar pattern of MMP-2 and MT1-MMP expression in resolving liver fibrosis while showing transient expression of MMP-13 only. Moreover, they have shown localization of MMP-2 and MT1-MMP to -SMA positive HSCs during remodeling of liver fibrosis. Therefore, there is a growing body of evidence supporting a role for MMP-2 and MT1-MMP in the resolution of liver fibrosis. Furthermore, MMP-2 is activated during HSC apoptosis 28 thereby linking loss of HSCs with matrix degradation. With respect to MMP-13 and MMP-2, the pattern of expression also would be consistent with origin from Kupffer cells or other components of the inflammatory infiltrate. Additional stimuli potentially mediating HSC apoptosis include Fas stimulation and nerve growth factor (NGF) stimulation. 29,30 However, the role of Fas is likely to be complex because Fas/Fas-L signaling may enhance fibrosis via hepatocytes apoptosis. 31 Nevertheless, despite the presence of active collagenolytic MMPs in recovering liver, matrix degradation was incomplete even after 366 days of recovery. The work presented here suggests that increased crosslinking of matrix in the 12-week model might explain its relative resistance to degradation, despite the presence of active forms of MMPs. Because the observation that the fibrotic bands failed to undergo complete remodeling in the 12-week model of fibrosis corresponded topographically to the distribution of septa established earliest in the progressive injury phase, we undertook a series of experiments to determine if there was evidence of matrix cross-linking, which is a feature of matrix maturation First, we showed that culture-activated