Nature Immunology doi: /ni.2771

Size: px
Start display at page:

Download "Nature Immunology doi: /ni.2771"

Transcription

1 Supplementary Figure 1. Lymphadenopathy, mitogen response, effector cells, and serum Ig assessment. (a) Computerized Tomography (CT) images demonstrating lymphadenopathy (arrows) in patient F.II.1 and absence of spleen (removed surgically). (b) Three dimensional surface rendered image with cut plane at level of porta hepatis showing lymph node masses surrounding the portal vein and adjacent vasculature (darker red mass within white oval). (c) 3 H- Thymidine incorporation in counts per minute (CPM) to assess proliferation of PBMCs after three days in response to the indicated stimulus. Each symbol represents an individual healthy control subject (Ctrl, n = 10) or patient (Pt, n = 10). Small horizontal lines indicate mean (± s.d.). * P < , ** P = , *** P < , **** P < (Mann- Whitney test). (d) Cumulative data for multiple healthy controls (Ctrl, n = 8) and patients (Pt, n = 9) showing % CCR7 - negative cells among CD8 + T cells in the peripheral blood. Small horizontal lines indicate mean (± s.d.). * P < (unpaired t- test). (e) IgM (left) and IgA (right) serum concentrations as a function of the patient's age. Dotted lines indicate the upper and lower boundaries of the normal range from healthy subjects. Data are representative of ten independent experiments with one patient each (c), four independent experiments (d) or two to ten separate measurements over time for each of the nine indicated patients. 1

2 Supplementary Figure 2. Patient B cell defects. (a) The proportion of total B cells (i.e., CD20 + cells) within the lymphocyte population of healthy controls (Ctrl, n = 6) compared to patients (Pt, n = 7). Small horizontal lines indicate mean (± s.d.). (b, c) Expression of (b) CD5 on transitional and naïve B cells and of (c) surface IgG and IgA on memory B cells from healthy controls (red histogram) and patients (blue histogram) was determined by flow cytometry. (d) CFSE- labeled naïve B cells were cultured with CD40L, CD40L+CpG, CD40L+anti- Ig or CD40L together with IL- 4, IL- 10, or IL- 21 for 5 days before being assessed for dilution of the dye in healthy control (Ctrl, red) and patient (Pt, blue) samples. (e) Expression of AICDA mrna was determined by quantitative PCR after stimulation of naïve B cells with the indicated stimulus. (f,g) Secretion of IgM, IgG, and IgA by stimulated naïve (f) and memory (g) B cells was determined by ELISA. Values for healthy controls (Ctrl) and patients (Pt) are given as mean ± sem of replicate cultures. * P = 0.03, ** P = (unpaired t- test). Data are representative of four independent experiments (b,c), two independent experiments (e), three independent experiments (f) or two independent experiments (g) or are from five independent experiments (a) or one experiment (d). 2

3 Supplementary Figure 3. Alignment of amino acid sequence of human p110α (PIK3CA) with that for human p110δ (PIK3CD). Residues mutated in our patients are shown in yellow, cyan and magenta. 3

4 Supplementary Figure 4. Hyperphosphorylation of Akt and intact association of mutant p110δ with p85α. (a) Quantification of band intensities for the immunoblot shown in Fig. 2d in which serum- starved, activated T cells were assessed for p110δ, Akt, p- Akt (S473), and β- tubulin in patients D.II.1, D.II.2, and E.1 compared to three healthy controls (Ctrl) with 10 min anti- CD3 stimulation (+) or not ( ). Total Akt values were normalized to β- tubulin abundance, then the ratio of p- Akt (S473) to normalized Akt was graphed. Small horizontal lines indicate mean (± s.d.). * P = , ** P = 0.01, *** P = (unpaired t- test). (b) Summary of p- Akt (S473) by flow cytometry comparing mean fluorescence intensity (MFI). Basal p- Akt (S473) in paired (i.e., cultured for 4

5 the same duration) T cell blasts from healthy controls (Ctrl, n = 5) and patients (Pt, n = 5) (left) or induced p- Akt (S473) after 10 min stimulation with anti- CD3 in T cell blasts from Ctrl (n = 3) and Pt (n = 3) (right, with mean (± s.d.)) are shown. * P = 0.02 (paired t- test), ** P = 0.03 (unpaired t- test). (c) Immunoblots for the indicated proteins using PBMC lysates from patients with mutant p110δ or healthy controls (Ctrl) after stimulation with beads coated with anti- CD3 and anti- CD28 for 10 min (+) or not ( ). (d,e) Representative histograms (left) and cumulative MFI data (right) for flow cytometry staining for p- Akt (T308) in patient (Pt, n = 3) versus healthy control (Ctrl, n = 3) T cell blasts, gating on CD4 + or CD8 + cells. Small horizontal lines indicate mean (± s.d.). * P = 0.03 (unpaired t- test). (f) Quantification of band intensities for the immunoblot shown in Fig. 2e together with data from two additional independent experiments. Numbers indicate the relative ratio (WT set to 1.0) of p- Akt (S473) to total Akt normalized for Flag expression. Small horizontal lines indicate mean (± s.d.). * P = 0.05, ** P = (unpaired t- test). (g) Immunoblot for p- Akt (S473) and β- tubulin on lysates from the human H9 T cell line overexpressing WT or the indicated mutant p110δ. (h) Immunoprecipitates (IP) of empty vector (EV), wild- type (WT), or mutant p110δ fused to a Flag epitope in HEK293T cells overexpressing p85α were blotted with antibodies against p85α, the Flag epitope, β- actin or immunoglobulin heavy chain (IgH). Data are from one experiment with three patients (a) or three independent experiments (f) or are representative of three independent experiments (b,d,e), four independent experiments with one patient each (c) or two independent experiments (g,h). 5

6 Supplementary Figure 5. Patient CD8 + T cells are hyperactivated with characteristics of enhanced effector function. (a) Cumulative data for MHC class I- peptide tetramer (Tet) stains for EBV lytic (Ctrl n = 4 and Pt n = 4) and EBV latent antigens (Ctrl n = 3 and Pt n = 3). (b) Flow cytometry of gated EBV lytic and latent antigen- specific CD8 + T cells, stained for CCR7 and CD45RA. The percent of total events is shown in quadrants. (c) CD38 expression on the populations identified in (a) for patient G.1 (blue) compared to those for a healthy control (Ctrl, red). (d) Cumulative data for intracellular IFN- γ production in CD8 + T cell blasts from healthy controls (Ctrl, n = 3) versus patients (Pt, n = 4). Small horizontal lines indicate mean (± s.d.). P = 0.09 (unpaired t- test). (e) Cumulative data for granzyme B expression in CD4 + or CD8 + T cell blasts stimulated with low- dose, 6

7 immobilized anti- CD3. Small horizontal lines indicate mean (± s.d.). * P = 0.003, ** P = 0.01 (unpaired t- test). (f) Total LAMP- 1 levels in activated CD8 + T cells from patients A.1 and G.1 compared to healthy control (Ctrl). (g) Cytolysis of P815 targets by anti- CD3- mediated redirected lysis for the indicated patients (Pt, n = 4) and healthy controls (Ctrl, n = 4). (h) Composite data for % CD57 + CD8 + T cells in patient (Pt, n = 4) versus healthy control (Ctrl, n = 4) PBMCs. Small horizontal lines indicate mean (± s.d.). * P = (unpaired t- test). Data are from three (latent) or four (lytic) independent experiments (a) or three independent experiments (h) or are representative of four independent experiments (b,c,g) or two independent experiments (d,e,f). 7

8 Supplementary Figure 6. Expression of PD- 1 on CD3 + cells in peripheral blood. PBMCs were gated on CD3 + cells and assessed for CD45RA versus PD- 1 expression in indicated patients (Pt, n = 7) and healthy controls (Ctrl, n = 2 adult and n = 2 pediatric). Data are representative of four independent experiments. 8

9 Supplementary Figure 7. Normal expression of signaling molecules in patient T cell blasts. (a) Immunoblots for PTEN, PKCθ, p110δ, p- Erk, total Erk, and β- tubulin in T cell lysates from patients E.1 and F.II.1 or healthy control (Ctrl) cells stimulated with anti- CD3 for the times indicated in minutes (min). (b) Immunoblot for the PH domain- containing ARF6, p27 kip1, and β- tubulin in indicated patient (n = 5 samples) and healthy control (Ctrl, n = 5 samples) T cell blasts after 10- min stimulation with anti- CD3 (+) or not ( ). Data are from one experiment with two (a) or five (b) different patient samples. 9

10 Supplementary Figure 8. Increased, glucose- and amino acid- dependent basal S6 phosphorylation and glucose uptake in patient T cell blasts. (a) Cumulative flow cytometric analysis of mean fluorescence intensity (MFI) for stimulated and unstimulated, permeabilized patient (Pt) or healthy control (Ctrl) T cell blasts after staining for p- S6 (S235, S236). Paired healthy control and patient blasts (i.e., cultured for the same duration) are connected by a line. * P = 0.04 (paired t- test). (b) Data from the same experiment as that shown in Fig. 4c but where cells were first rested in PBS for 2 hr before flow cytometric analysis of p- S6 (S235, S236) in unstimulated T cell blasts from patients G.1, D.II.1, and D.II.2 compared to healthy controls (Ctrl). (c) Glucose uptake by flow cytometric analysis of 2- NBDG fluorescence (linear MFI) after a 20- minute incubation period in glucose- starved T cell blasts from healthy controls (Ctrl, n = 3) and patients (Pt, n = 3). Paired healthy control and patient blasts (i.e., cultured for the same duration) are connected by a line. * P = 0.03 (paired t- test). Data are from three independent experiments (a) or one experiment with three different patients (b) or are representative of five independent experiments (c). 10

11 Supplementary Figure 9. CT images comparing hepatosplenomegaly and lymphadenopathy in patient A.1 before and after treatment with rapamycin. Coronal reformations at the level of the tracheal bifurcation reveal more severe hepatosplenomegaly, hilar and mediastinal adenopathy, and splaying of tracheal bifurcation before (a) compared to after (b) rapamycin treatment. 11

12 Race Haitian/Hispanic Caucasian Kinase Domain Helical Domain C2 Domain A.1 B.III.1 C.1 D.I.1 D.II.1 D.II.2 E.1 F.II.1 G.1 African American (deceased) Caucasian Caucasian Caucasian Asian Caucasian African American CMV PCR serology CMV lymphadenitis **POS N/A - ON IVIG YES NEG NAIVE NO N.D. NEG POS NO YES POS YES NEG POS NO NEG POS YES NEG Naïve NO NEG N/A- ON IVIG NO Highest EBV load (copies/μl) Bacterial infections Lympho- proliferation Sites of mucosal lymphoid aggregates Other pathology 3,850 15,000 5,000 1,900 1,100 <250 63,350 2,250 20,050 infections, bronchiectasis infections infections, H. influenza meningitis infections infections infections infections, bronchiectasis infections infections, bronchiectasis Diffuse LAP, HSM Cervical LAP Diffuse LAP, HSM N.D. Diffuse LAP, HSM NO Diffuse LAP Diffuse LAP, HSM Diffuse LAP, HSM Airways and GI mucosa Autoimmune cytopenia, nodular regenerative hyperplasia of the liver Airways (obstructive) N.D. Airways and GI mucosa Airways and GI mucosa (partial obstruction) N.D. N.D. N.D. NO Pharyngeal mucosa Eosinophilic esophagitis Airways (obstructive) NO N.D. Autoimmune cyopenia, splenectomy Airways and GI mucosa Autoimmune cyopenia, splenectomy, pseudotumor cerebri Supplementary Table 1. Additional table of clinical findings. POS = positive; NEG = negative; N/A = not applicable; IVIG = intravenous immunoglobulin; N.D. = not determined; LAP = lymphadenopathy; HSM = hepatosplenomegaly; GI = gastrointestinal; **Chronic intermittent viremia. 12

13 Name Sequence 5ʹ - - 3ʹ Ta GC% Size PIK3CD_2F CTTCCAAAGGTCTCACCCAG PIK3CD_2R TCTCTGAGCACCAAGGTCTG PIK3CD_3_4F* CAGCTCTCCACCCTCCCT PIK3CD_3_4R* CACAGACACCTGGCAAACAC PIK3CD_5F CAGGTGTCTGTGCATGTGTG PIK3CD_5R CACCCAGGCCCTATCCAG PIK3CD_6F AATCCTGGTGTCCAGGGAG PIK3CD_6R GTAGCACATGGAGTTGGACG PIK3CD_7F CTGCACTTTGAGCCGTGTTA PIK3CD_7R CCAGGATACAGCCACCTTGT PIK3CD_8F TTCAAGGGGGAGACTGACAC PIK3CD_8R GTACTGGCTCTCCGGGGT PIK3CD_9_10F GTCTGGAGGCCCCTGAGT PIK3CD_9_10R CAGGGAGCACCCTCTGAAG PIK3CD_11_12F CATATCTGGGGCCTTCCC PIK3CD_11-12R GTGGGTAGCCAGAGGCTGT PIK3CD_13F ACCCTTACCCTGACCACCTC PIK3CD_13R AGCTGCCCTCTGGAGAAGT PIK3CD_14F AGCTCCCTCCTGTCCTGAGT PIK3CD_14R AGACTCAGGGGCTGGGATT PIK3CD_15F CCTCGCTAGGTCCTGCTG PIK3CD_15R GGATTCCCAGACGCTCAG PIK3CD_16_17F CCTGAGCGTCTGGGAATC PIK3CD_16_17R CTAGGAGCACCCCAGGACC PIK3CD_18F CCAGAAACTCACGCTTCTCC PIK3CD_18R ATGCCACCTTCAACAAGGAC PIK3CD_19F GAGTTTCTGGGGCTCAAGTG PIK3CD_19R CTTGGAAAGGAGAGGGAACC PIK3CD_20F GGAGCTGCAAAATGGTATGG PIK3CD_20R CAGAGCTGTGTGCTAGGCAG PIK3CD_21F GTCTCCCCTGGATTCTCTCC PIK3CD_21R AACCTCTGCCCTGTTCCCT PIK3CD_22F GGAGTTCCCAGAGCCTCACT PIK3CD_22R CCCTCCTAGGTCACATTGCT PIK3CD_23F CTCTGAAGTCCCCAGAGAGG PIK3CD_23R TCCTGAGGACCAGCGTAGAT PCR cycling conditions: 94 C for 2 min, [94 C for 30 s, 60 C for 30 s, 72 C for 1 min] (30 cycles), 4 C hold Sequencing cycling conditions were as follows: 96 C for 30 s, [96 C for 30 s, 60 C for 4 min] (30 cycles), 4 C hold *Betaine (5 M) (Sigma- Aldrich) was added 1 M (final) in the PCR and sequencing reactions for exons 3 and 4 Supplementary Table 2. PCR and sequencing primers with cycling conditions. 13

14 Somatic p110α Mutations in Cancer N345K E542K and E545K H1047R Mechanism Disrupts inhibition of p110 by p85 by hindering the interaction of p110 C2 domain with p85 i- SH2 domain Disrupts inhibition of p110 by p85 by blocking the interaction between p110 helical domain and p85 N- SH2 domain Promotes association with the plasma membrane, mimics Ras binding, and causes activating conformational changes in the activation loop Supplementary Table 3. Residues of human p110α commonly mutated in cancers map to the patient mutation sites in p110δ and suggest pathogenic mechanisms. 14

HD1 (FLU) HD2 (EBV) HD2 (FLU)

HD1 (FLU) HD2 (EBV) HD2 (FLU) ramer staining + anti-pe beads ramer staining a HD1 (FLU) HD2 (EBV) HD2 (FLU).73.11.56.46.24 1.12 b CD127 + c CD127 + d CD127 - e CD127 - PD1 - PD1 + PD1 + PD1-1 1 1 1 %CD127 + PD1-8 6 4 2 + anti-pe %CD127

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation

Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured

Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna

More information

Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to

Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to Class II tetramer staining Commercially available HLA Class II tetramers (Beckman Coulter) conjugated to PE were combined with dominant HIV epitopes (DRB1*0101-DRFYKTLRAEQASQEV, DRB1*0301- PEKEVLVWKFDSRLAFHH,

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb

More information

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with

Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)

More information

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/9/430/ra57/dc1 Supplementary Materials for The 4E-BP eif4e axis promotes rapamycinsensitive growth and proliferation in lymphocytes Lomon So, Jongdae Lee, Miguel

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the

Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Supporting Information Table of Contents

Supporting Information Table of Contents Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting

More information

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were

Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)

More information

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Primary Immunodeficiency

Primary Immunodeficiency Primary Immunodeficiency DiGeorge Syndrome Severe Combined Immunodeficiency SCID X-Linked Agammaglobulinemia Common variable immunodeficiency (CVID) IgA deficiency Hyper- IgM Syndrome Wiskott-Aldrich syndrome

More information

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep

The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima

More information

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs

Supplementary Table 1 Clinicopathological characteristics of 35 patients with CRCs Supplementary Table Clinicopathological characteristics of 35 patients with CRCs Characteristics Type-A CRC Type-B CRC P value Sex Male / Female 9 / / 8.5 Age (years) Median (range) 6. (9 86) 6.5 (9 76).95

More information

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated

More information

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.

Follicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development. Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/471/eaah5085/dc1 Supplementary Materials for Phosphorylation of the exocyst protein Exo84 by TBK1 promotes insulin-stimulated GLUT4 trafficking Maeran Uhm,

More information

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the

and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University

Medical Virology Immunology. Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Medical Virology Immunology Dr. Sameer Naji, MB, BCh, PhD (UK) Head of Basic Medical Sciences Dept. Faculty of Medicine The Hashemite University Human blood cells Phases of immune responses Microbe Naïve

More information

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +

W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 + F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures

Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along

More information

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.

Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray

More information

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD SUPPLEMENTARY FIGURE 1 0 20 50 80 100 IL-17RD (ng) S1a S1b S1c IL-17RD β-actin kda S1d - si sc Il17rd Il17ra rig/s15-574 - 458-361 bp S1f S1g S1h S1i S1j Supplementary Figure 1. Knockdown of IL-17RD enhances

More information

Supplemental Table I.

Supplemental Table I. Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,

More information

The Adaptive Immune Response. B-cells

The Adaptive Immune Response. B-cells The Adaptive Immune Response B-cells The innate immune system provides immediate protection. The adaptive response takes time to develop and is antigen specific. Activation of B and T lymphocytes Naive

More information

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6. Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,

More information

Is it CVID? Not Necessarily HAIG TCHEUREKDJIAN, MD

Is it CVID? Not Necessarily HAIG TCHEUREKDJIAN, MD Is it CVID? Not Necessarily HAIG TCHEUREKDJIAN, MD Current Paradigm of Pathogenesis Genetic defect(s) Molecular defect(s) Cellular defect(s) Clinical disease Current Paradigm of Pathogenesis Genetic defect(s)

More information

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood

Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood Supplementary Figure 1. ALVAC-protein vaccines and macaque immunization. (A) Maximum likelihood tree illustrating CRF01_AE gp120 protein sequence relationships between 107 Envs sampled in the RV144 trial

More information

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Peli1 negatively regulates T-cell activation and prevents autoimmunity Peli1 negatively regulates T-cell activation and prevents autoimmunity Mikyoung Chang 1,*, Wei Jin 1,5,*, Jae-Hoon Chang 1, Yi-chuan Xiao 1, George Brittain 1, Jiayi Yu 1, Xiaofei Zhou 1, Yi-Hong Wang

More information

Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads

Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads Representative example of comparative ex vivo tetramer enrichment performed in three independent experiments with either conventional

More information

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands

Cytotoxicity assays. Rory D. de Vries, PhD 1. Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Cytotoxicity assays Rory D. de Vries, PhD 1 1 Viroscience lab, Erasmus MC, Rotterdam, the Netherlands Anti-influenza immunity Humoral / CD4+ / CD8+ / NK? Function of CTL Elimination of virus-infected cells?

More information

Adaptive Immunity: Humoral Immune Responses

Adaptive Immunity: Humoral Immune Responses MICR2209 Adaptive Immunity: Humoral Immune Responses Dr Allison Imrie 1 Synopsis: In this lecture we will review the different mechanisms which constitute the humoral immune response, and examine the antibody

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supplementary Figure 1

Supplementary Figure 1 d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue

More information

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All

MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used

More information

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN

B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification

More information

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast

Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast Supplementary Figure 1. Double-staining immunofluorescence analysis of invasive colon and breast cancers. Specimens from invasive ductal breast carcinoma (a) and colon adenocarcinoma (b) were staining

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver

More information

The Adaptive Immune Responses

The Adaptive Immune Responses The Adaptive Immune Responses The two arms of the immune responses are; 1) the cell mediated, and 2) the humoral responses. In this chapter we will discuss the two responses in detail and we will start

More information

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28

SUPPLEMENTARY INFORMATION. Supp. Fig. 1. Autoimmunity. Tolerance APC APC. T cell. T cell. doi: /nature06253 ICOS ICOS TCR CD28 TCR CD28 Supp. Fig. 1 a APC b APC ICOS ICOS TCR CD28 mir P TCR CD28 P T cell Tolerance Roquin WT SG Icos mrna T cell Autoimmunity Roquin M199R SG Icos mrna www.nature.com/nature 1 Supp. Fig. 2 CD4 + CD44 low CD4

More information

Supplemental Figure 1. Gating strategies for flow cytometry and intracellular cytokinestaining

Supplemental Figure 1. Gating strategies for flow cytometry and intracellular cytokinestaining Supplemental Figure 1. Gating strategies for flow cytometry and intracellular cytokinestaining of PBMCs. Forward scatter area (FSC-A) versus side scatter area (SSC-A) was used to select lymphocytes followed

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic

Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2

More information

SUPPLEMENTARY FIGURES AND TABLE

SUPPLEMENTARY FIGURES AND TABLE SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna

More information

NC bp. b 1481 bp

NC bp. b 1481 bp Kcna3 NC 11 178 p 1481 p 346 p c *** *** d relative expression..4.3.2.1 CD4 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna Kcna6 Kcna7 Kcnn4 relative expression..4.3.2.1 CD8 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna

More information

Nature Medicine doi: /nm.3957

Nature Medicine doi: /nm.3957 Supplementary Fig. 1. p38 alternative activation, IL-21 expression, and T helper cell transcription factors in PDAC tissue. (a) Tissue microarrays of pancreatic tissue from 192 patients with pancreatic

More information

supplemental Figure 1

supplemental Figure 1 supplemental Figure 1 A T cell T1 anti-ny-eso-117-16/hla-a*:1 CDζ CH/CH scfv B T cell T1 anti-ny-eso-117-16/hla-a*:1 CDζ CH/CH scfv C T cell BW1/6 anti-cea CDζ CH/CH scfv supplemental Figure 1.79.9.87

More information

Putting it Together. Stephen Canfield Secondary Lymphoid System. Tonsil Anterior Cervical LN s

Putting it Together. Stephen Canfield Secondary Lymphoid System. Tonsil Anterior Cervical LN s Putting it Together Stephen Canfield smc12@columbia.edu Secondary Lymphoid System Tonsil Anterior Cervical LN s Axillary LN s Mediastinal/Retroperitoneal LN s Thoracic Duct Appendix Spleen Inguinal LN

More information

TACI triggers immunoglobulin class switching by activating B cells through the adaptor protein MyD88

TACI triggers immunoglobulin class switching by activating B cells through the adaptor protein MyD88 Revised NI-A13051-T, He et al. TACI triggers immunoglobulin class switching by activating B cells through the adaptor protein MyD88 Bing He, 1* Raul antamaria, 2* Weifeng Xu, 1 Montserrat Cols, 1 Kang

More information

Supplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific

Supplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific SUPPLEMENTARY FIGURE LEGEND Supplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific CD4 + T cells correlates with intracellular CTLA-4 levels. (a) Comparative CTLA-4 levels

More information

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS

IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LECTURE: 07 Title: IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LEARNING OBJECTIVES: The student should be able to: The chemical nature of the cellular surface receptors. Define the location of the

More information

Supplementary Information:

Supplementary Information: Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema

More information

Supplementary Materials

Supplementary Materials Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay

More information

Supplementary. presence of the. (c) mrna expression. Error. in naive or

Supplementary. presence of the. (c) mrna expression. Error. in naive or Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated

More information

Determinants of Immunogenicity and Tolerance. Abul K. Abbas, MD Department of Pathology University of California San Francisco

Determinants of Immunogenicity and Tolerance. Abul K. Abbas, MD Department of Pathology University of California San Francisco Determinants of Immunogenicity and Tolerance Abul K. Abbas, MD Department of Pathology University of California San Francisco EIP Symposium Feb 2016 Why do some people respond to therapeutic proteins?

More information

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György

More information

IgG3 regulates tissue-like memory B cells in HIV-infected individuals

IgG3 regulates tissue-like memory B cells in HIV-infected individuals SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41590-018-0180-5 In the format provided by the authors and unedited. IgG3 regulates tissue-like memory B cells in HIV-infected individuals Lela

More information

Eosinophils are required. for the maintenance of plasma cells in the bone marrow

Eosinophils are required. for the maintenance of plasma cells in the bone marrow Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7

More information

Nature Immunology doi: /ni.3268

Nature Immunology doi: /ni.3268 Supplementary Figure 1 Loss of Mst1 and Mst2 increases susceptibility to bacterial sepsis. (a) H&E staining of colon and kidney sections from wild type and Mst1 -/- Mst2 fl/fl Vav-Cre mice. Scale bar,

More information

Supplementary Data Table of Contents:

Supplementary Data Table of Contents: Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells

Akt and mtor pathways differentially regulate the development of natural and inducible. T H 17 cells Akt and mtor pathways differentially regulate the development of natural and inducible T H 17 cells Jiyeon S Kim, Tammarah Sklarz, Lauren Banks, Mercy Gohil, Adam T Waickman, Nicolas Skuli, Bryan L Krock,

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2

ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/3/114/ra23/dc1 Supplementary Materials for Regulation of Zap70 Expression During Thymocyte Development Enables Temporal Separation of CD4 and CD8 Repertoire Selection

More information

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr

Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr Supplementary Figure 1 Chemokine and chemokine receptor expression during muscle regeneration (a) Analysis of CR3CR1 mrna expression by real time-pcr at day 0, 1, 4, 10 and 21 post- muscle injury. (b)

More information

Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author):

Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author): Reviewers' comments: Reviewer #1 Expert in EAE and IL-17a (Remarks to the Author): This study shows that the inducible camp early repressor (ICER) is involved in development of Th17 cells that are pathogenic

More information

A mechanism for glycoconjugate vaccine activation of the adaptive immune system and its implications for vaccine design

A mechanism for glycoconjugate vaccine activation of the adaptive immune system and its implications for vaccine design A mechanism for glycoconjugate vaccine activation of the adaptive immune system and its implications for vaccine design Fikri Y. Avci 1,2, Xiangming Li 3, Moriya Tsuji 3, Dennis L. Kasper 1,2* Supplementary

More information

Supplementary Figure 1 Maschalidi et al.

Supplementary Figure 1 Maschalidi et al. a 1% 5% % 1% 5% % OVAb βgal activity A.U. (x1 4 ) 2 1 5 βgal activity A.U. (x1 4 ) 2 1 BSAb 2 hours 4 hours OVAb BSAb OVAb BSAb,1 1 1 1 SIINFEKL (ng/ml) CFSE b Beads Alexa488 (%) 8 6 4 2 ** ** 1:1 5:1

More information

Mouse Clec9a ORF sequence

Mouse Clec9a ORF sequence Mouse Clec9a gene LOCUS NC_72 13843 bp DNA linear CON 1-JUL-27 DEFINITION Mus musculus chromosome 6, reference assembly (C57BL/6J). ACCESSION NC_72 REGION: 129358881-129372723 Mouse Clec9a ORF sequence

More information

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).

Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1). Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed

More information

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural and Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Mutational analysis of the SA2-Scc1 interaction in vitro and in human cells. (a) Autoradiograph (top) and Coomassie stained gel (bottom) of 35 S-labeled Myc-SA2 proteins (input)

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23

<10. IL-1β IL-6 TNF + _ TGF-β + IL-23 3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF

More information

Principles of Adaptive Immunity

Principles of Adaptive Immunity Principles of Adaptive Immunity Chapter 3 Parham Hans de Haard 17 th of May 2010 Agenda Recognition molecules of adaptive immune system Features adaptive immune system Immunoglobulins and T-cell receptors

More information

Immunobiology 7. The Humoral Immune Response

Immunobiology 7. The Humoral Immune Response Janeway Murphy Travers Walport Immunobiology 7 Chapter 9 The Humoral Immune Response Copyright Garland Science 2008 Tim Worbs Institute of Immunology Hannover Medical School 1 The course of a typical antibody

More information

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable

(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon

More information

Supplemental information

Supplemental information Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman

More information

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis

Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis

More information

Form 2033 R3.0: Wiskott-Aldrich Syndrome Pre-HSCT Data

Form 2033 R3.0: Wiskott-Aldrich Syndrome Pre-HSCT Data Key Fields Sequence Number: Date Received: - - CIBMTR Center Number: CIBMTR Recipient ID: Has this patient's data been previously reported to USIDNET? USIDNET ID: Today's Date: - - Date of HSCT for which

More information

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice

Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Choi YL, Soda M, Yamashita Y, et al. EML4-ALK mutations in

More information

SUPPLEMENT Supplementary Figure 1: (A) (B)

SUPPLEMENT Supplementary Figure 1: (A) (B) SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with

More information

B cell activation and antibody production. Abul K. Abbas UCSF

B cell activation and antibody production. Abul K. Abbas UCSF 1 B cell activation and antibody production Abul K. Abbas UCSF 2 Lecture outline B cell activation; the role of helper T cells in antibody production Therapeutic targeting of B cells 3 Principles of humoral

More information

chapter 17: specific/adaptable defenses of the host: the immune response

chapter 17: specific/adaptable defenses of the host: the immune response chapter 17: specific/adaptable defenses of the host: the immune response defense against infection & illness body defenses innate/ non-specific adaptable/ specific epithelium, fever, inflammation, complement,

More information