Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma"

Transcription

1 Immunity Supplemental Information Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Brian D. Hondowicz, Dowon An, Jason M. Schenkel, Karen S. Kim, Holly R. Steach, Akshay T. Krishnamurty, Gladys J. Keitany, Esteban N. Garza, Kathryn A. Fraser, James J. Moon, William A. Altemeier, David Masopust, and Marion Pepper

2 Figure S1. Hondowicz et al. A. Derp : RFGISNYCQIYPPNVNKIREAL * B. allergic challenge Day sac (D3-19 post-challenge) Day i.n. HDM (23 μg Derp1) Day 1-14 i.n. HDM (5.75 μg Derp1) Inject α Thy1.2 i.v.

3 Figure S2. Hondowicz et al. A. Ex vivo Lung 4 3 % hucd2 + (IL-4) % IL-13 + (egfp) 2 1 Derp1 - Derp1 + Derp1 - Derp1 + B. In vitro Lung * IL-4 (pg/ml) 5 * IL-5 (pg/ml) 5 * IL-13 (pg/ml) 5 1 No peptide Peptide No peptide Peptide No peptide Peptide 1 IFN-γ (pg/ml) 5 IL-17 (pg/ml) 5 No peptide Peptide No peptide Peptide

4 Figure S3. Hondowicz et al. A. Day i.n. HDM Wait for days 5 days i.n. HDM 9 days i.p. FTY72 1. Pre-bleed for blood CD4 + T cell numbers 2. Measure D3 post-challenge airway hyper-responsiveness 3. Inject αthy1.2-pe i.v. 3 minutes prior to death 4. Flow cytometric analysis

5 Figure S4. Hondowicz et al. A. WT CD25KO Spleen and Lns Blood CCR CXCR % CCR WT * CD25 KO % CXCR p =.6 WT CD25 KO

6 Figure S5. Hondowicz et al. A. CD69 Lung WT CD62L CD25KO %CD WT * CD25 KO

7 Figure S6. Hondowicz et al. A. hucd2 (IL-4) WT CD25KO CXCR % hucd2 + (IL-4) WT CD25 KO

8 Supplemental Methods ELISAs 5-6 x 1 6 cells from the lungs were plated in a 24 well plate and stimulated with 1µg of Derp1( ) peptide or no Derp1 peptide. All wells received anti-il- 4R (2.5µg/ml) (M1) to block IL-4 consumption as previously described (Fernandez-Botran et al., 1999). Cells were incubated at 37 C for 3 days and supernatants were collected and assayed for IL-4, IL-5, IL-13, IL-17, and IFN-γ by ELISAs purchased from Ebioscience and performed based on their instructions. Immunofluorescent staining of lungs Lungs from unimmunized or sensitized mice were embedded in OCT and flash frozen. Sections (8µm) were fixed in acetone and then stained with biotinconjugated anti-cd4 (RM4-5; ebioscience), and AlexaFlour488-conjugated anti- CD31 (39; BioLegend). Cy3-conjugated Streptavidin (Jackson Immunoresearch) were used as a secondary antibody. Images were acquired using a Nikon Eclipse 9i microscope and NIS Elements BR (Build 738) software was used for the capture of individual images for each channel. Raw TIFF files were imported in Adobe Photoshop for overlay of single channel images and editing. H&E and PAS staining of lungs

9 Lungs were inflated and fixed with 1% neutral buffered formalin and paraformaldehyde embedded sections were made for H&E and PAS staining of lung sections. PAS slides were scanned in brightfield at 2X magnification using the Hamamatsu NanoZoomer Digital Pathology System. The digital images were then imported into Visiopharm software for quantitative analysis. Using the Visiopharm Image Analysis module, regions of interest (ROIs) around the tissues were automatically detected using the feature HDAB Hematoxylin with a median filter of 7 pixels by 7 pixels. The software converted the initial digital image into grayscale values using two features, H&E - Hematoxylin and H&E - Eosin. Protocols were then developed utilizing the software to label positive mucin staining and the hematoxylin counter stain, using a project specific configuration based on a threshold of pixel values. Images were processed in batch mode using this configuration to generate the desired outputs. The ROIs were sampled at 1 percent. Cell Enrichment and Flow Cytometry Single cell suspensions were stained with Derp1:I-A b tetramer conjugated to APC or PE for 1 hour at room temperature. Cells were then washed and incubated with anti-apc or PE microbeads (Miltenyi Biotec) for 3 minutes. Tetramer positive cells were enriched as previously described (Moon et al.). If cells were stained with CXCR5 or CCR7 they were added first to the surface stain for 4 minutes at room temperature then the all other surface markers were added on ice for 2 minutes. The following surface stains were used: (purchased from BD Biosciences, Ebioscience, and Biolegend): anti-murine CD4 (BV51, BV65,

10 BV711) (RM4-5), anti-cd8 (PerCP-Cy5.5, BV51, BV65, BV786) (53-6.7), B22 (PerCP-Cy5.5, efluor 45, PE-CF594) (RA3-6B2), anti-cd11b (PerCP-Cy5.5, efluor 45, PE-CF594) (M1/7), anti-cd11c (PerCP-Cy5.5, efluor 45, PE- CF594) (N418), anti-cd44-alexa Fluor 7 (IM7), anti-cxcr5 (PE, PE-Cy7, Biotin) (2G8), anti-pd1 (FITC, PE-Cy7, efluor 45, PE-eFluor 61, BV65) (J43) anti-cd45.1 (APC-eFluor 78, BV65) (A2), anti-cd45.2 (FITC, V5, BV51, PE-eFluor 61) (14), anti-cd69 (FITC, Biotin, BV51, PerCP-Cy5.5, PE) (H1.2F3), anti-ccr7 (Biotin, PerCP-Cy5.5) (4B12), anti-cd62l (FITC, efluor 45, BV65, BV786) (Mel-14), anti-cd25 (FITC, PerCP-Cy5.5, BV51, PEeFluor 61) (PC61), anti-siglec F-PE (E5-244), anti-cd3 (FITC, BV421) (145-2C11), anti-class II- APC (M5/114), anti-ccr4 PE (2G12), anti- CXCR3 PerCP- Cy5.5 (CXCR3-173), anti-ccr6 BV421 (29-2L17), and anti-human CD2-Biotin (RPA-2.1). Biotinylated antibodies were detected with Streptavidin BV65. All cells were run on the LSR II or Canto RUO (BD) and analyzed using FlowJo software (Treestar). Airway Hyper-responsiveness Three days after the last secondary immunization dose some mice were measured for airway hyperresponsivness by methacholine challenge. Briefly, mice were anesthetized with 9mg/kg pentobarbital i.p. and intubated via tracheotomy. The mice are placed on a ventilator and paralyzed with vecuronium (.6 mg/kg). After 5 minutes, the mice are first challenged with PBS and then progressively challenged with methacholine ( mg/ml (PBS), mg/ml, 12.5 mg/ml, and 5 mg/ml) and airway resistance is measured. After all

11 measurements are completed mice are euthanized by pentobarbital (9 mg/kg) followed by sternotomy. The percent increase in airway resistance was calculated with the following formula: ((average resistance at 3.125, 12.5, or 5 mg/ml of methacholine average resistance at mg/ml of methacoline, PBS)/(average resistance at mg/ml of methacholine, PBS))*1. Parabiosis surgery Naïve CD C57BL/6J mice and HDM immunized CD C57BL/6J mice were shaved along opposite lateral flanks. Skin was then wiped clean of fur with 7% alcohol prep pads and betadine solution. Mirrored incisions were then made on the lateral aspects of both mice and surgical staples were used to proximate the skin and conjoin the mice. Additionally, 5, vicryl sutures were placed through the olecranon and knee joints to secure the legs. Ten days after surgery, recirculation was assessed in peripheral blood. Conjoined mice were euthanized 16 days after surgery. Statistical Analysis Statistical significance was determined when p <.5 via the two-tailed t test for all experiments. A paired t-test was used to compare WT versus CD25KO cells in individual mixed bone marrow chimeras or peptide stimulated cultures versus unstimulated cells from the same mouse. A Wilcoxon signed-rank sum test was used for parabiosis experiments. Supplemental Figure Legends Figure S1 related to Figure 1. Allergic immunization protocol.

12 A) A previously described immunogenic region of the Der p1 protein (11-131) was tested with two different Derp1:I-A b tetramers ( and ). B) Sensitization and challenge protocol using HDM. The amount of Derp1 protein in the HDM preparation is indicated. Figure S2 related to Figure 2. Derp cytokine production in the lung. Lung cells produce IL-4, IL-5, and IL-13 in response to Derp peptide. A) Bar graphs show the average percentage (+/- S.D.) of IL-4 (left) (KN2 mice) and IL-13 (right) (egfp mice) in the lung from CD4 + Derp1 - cells versus CD4 + Derp1 + cells three days post-challenge. The data is the combined average from 2-3 independent experiments (n=5 for IL-4 expression, n=6 for IL-13 expression). (*) indicates significant difference between Derp1 - and Derp1 + cells (p<.5). B ) The bar graphs depict the indicated cytokine production from lung cells that were stimulated with or without 1 µg Derp peptide for three days in culture from mice 5-6 days after sensitization. The data is compiled from 2-3 independent experiments with a total of 3-6 mice. (*) indicates significant difference between cells that were stimulated with Derp1 peptide versus unstimulated cells (p<.5). Figure S3 related to Figure 5. FTY72 treatment protocol. A) Immunization timeline for FTY72 experiments.

13 Figure S4 related to Figure 6. CCR4 and CXCR3 expression on CD4+ Derp1+ six days after primary sensitization. A) The representative contour plots, from 2-4 independent experiments, depict CCR4 and CXCR3 expression from the spleen/lymph nodes (top) or blood (bottom) six days after primary sensitization from CD4 + Derp1 + WT or CD25KO cells in a CD25KO mixed bone marrow chimera. (*)(p<.5) indicates that CCR4 expression is significantly different in WT Derp1 + cells versus CD25KO Derp1 + T cells. In the CXCR3 line graph there are three lines but only two can be seen because two data points were superimposable. Figure S5 related to Figure 6. CD69 expression from Derp1 + CD25KO cells is lower compared to Derp1 + WT cells in the lungs from WT:CD25KO mixed bone marrow chimera mice. The representative contour plots gated on CD4 + Derp1 + T cells of WT or CD25KO origin from the lungs show the levels of CD69 expression. The scatterplot shows the percentage of Thy1.2 - Derp1 + cells from the lungs of WT or CD25KO origin that are CD69 +. (*) (p<.5) indicates that CD4 + Derp1 + T cells in the lung of WT origin have significantly greater expression of CD69 compared to CD25KO CD4 + Derp1 + T cells in the lung. The data in the bar graphs were compiled from 5 independent experiments with a total of 1 mice. Figure S6 related to Figure 6. IL-2 signaling is not required for IL-4 production 6 days after primary sensitization. The KN2 reporter gene was bred onto the CD25KO background and IL-4 (hucd2) expression was compared

14 between WT KN2 cells and CD25KO KN2 cells in a WT KN2 /+: CD25KO KN2/+ mixed bone marrow chimera. Representative contour plots depict IL-4 (hucd2) from CD4 + Derp1 + cells in the spleen/lymph nodes of WT or CD25KO origin. The bar graph is the average (+/- S.D.) IL-4 (hucd2) expression from three independent experiments with a total of 5 mice.

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-

Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone

More information

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity

L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,

More information

SUPPORTING INFORMATIONS

SUPPORTING INFORMATIONS SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor

More information

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik

Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

Supplementary Figure 1. Example of gating strategy

Supplementary Figure 1. Example of gating strategy Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte

More information

Supplementary Materials for

Supplementary Materials for immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef

More information

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)

Fluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD) Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,

More information

Fisher et al. Supplemental Figure 1

Fisher et al. Supplemental Figure 1 Supplemental Figure 1 A TNF IL-1 IL-6 CCL2 CCL5 CXCL10 pg/mg total protein 50 30 10 4,000 3,000 2,000 1,000 n.d. 1 1 14,000 12,000 10,000 8,000 6,000 4,000 2,000 6,000,000 CT26 5,000 16,000 B16 4,000 12,000

More information

Supporting Information

Supporting Information Supporting Information Idoyaga et al. 10.1073/pnas.0812247106 SSC a) Single cell suspension 99 Aqua b) Live cells 96 -W c) Singlets 92 -A CD19+ER119 d) CD19 ER119 cells 97 CD3 e) CD3 cells 27 f) DX5 cells

More information

a surface permeabilized

a surface permeabilized a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected

More information

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells

Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Immunity, Volume 4 Supplemental Information Chitin Activates Parallel Immune Modules that Direct Distinct Inflammatory Responses via Innate Lymphoid Type 2 and T Cells Steven J. Van Dyken, Alexander Mohapatra,

More information

MagniSort Mouse CD4 Naive T cell Enrichment Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

MagniSort Mouse CD4 Naive T cell Enrichment Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 2 MagniSort Mouse CD4 Naive T cell Enrichment Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse splenocytes were unsorted (left) or sorted with the MagniSort Mouse CD4

More information

Tbk1-TKO! DN cells (%)! 15! 10!

Tbk1-TKO! DN cells (%)! 15! 10! a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8

More information

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance

Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather

More information

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was

Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver

More information

Differential Response of Respiratory Dendritic Cell Subsets to Influenza Virus Infection

Differential Response of Respiratory Dendritic Cell Subsets to Influenza Virus Infection JOURNAL OF VIROLOGY, May 2008, p. 4908 4919 Vol. 82, No. 10 0022-538X/08/$08.00 0 doi:10.1128/jvi.02367-07 Copyright 2008, American Society for Microbiology. All Rights Reserved. Differential Response

More information

Supporting Information

Supporting Information Supporting Information Soltani et al. 10.1073/pnas.1102715108 SI Experimental Procedures Evaluation of Mice and Drug Administration. IPGTT, insulin tolerance test, and glucagon tolerance test were performed

More information

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and

for six pairs of mice. (b) Representative FACS analysis of absolute number of T cells (CD4 + and SUPPLEMENTARY DATA Supplementary Figure 1: Peripheral lymphoid organs of SMAR1 -/- mice have an effector memory phenotype. (a) Lymphocytes collected from MLNs and Peyer s patches (PPs) of WT and SMAR1

More information

Supporting Information

Supporting Information Supporting Information Shime et al. 1.173/pnas.11139919 SI Methods Reagents. was purchased from GE Healthcare, which was free from LPS contamination. TNF-α and IFN-β ELISA kit was purchased from eioscience

More information

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism

Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte

More information

Supplemental Materials

Supplemental Materials Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood

Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood Antibody-mediated depletion of CD19-CAR T cells Supplemental 1 Supplemental Materials Supplemental Figure 1. Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood cells were

More information

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director

AlphaScreen : A Straightforward and Powerful Alternative to ELISA. Martina Bielefeld-Sévigny Ph.D., R&D Director AlphaScreen : A Straightforward and Powerful Alternative to ELISA Martina Bielefeld-Sévigny Ph.D., R&D Director Overview AlphaScreen - an alternative to ELISA Why an alternative to ELISA? Assay principle

More information

Supplemental Information. Human CD1c + Dendritic Cells Drive. the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF-

Supplemental Information. Human CD1c + Dendritic Cells Drive. the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF- Immunity, Volume 38 Supplemental Information Human CD1c + Dendritic Cells Drive the Differentiation of CD103 + CD8 + Mucosal Effector T Cells via the Cytokine TGF- Chun I. Yu Christian Becker Yuanyuan

More information

Effect of Antiretroviral Therapy on HIV-mediated Impairment of the Neutrophil

Effect of Antiretroviral Therapy on HIV-mediated Impairment of the Neutrophil Online Data Supplement Effect of Antiretroviral Therapy on HIV-mediated Impairment of the Neutrophil Antimycobacterial Response David M Lowe, Nonzwakazi Bangani, Rene Goliath, Beate Kampmann, Katalin A

More information

Challenges in Development and Validation of an Intracellular Cytokine Staining assay

Challenges in Development and Validation of an Intracellular Cytokine Staining assay Challenges in Development and Validation of an Intracellular Cytokine Staining assay Jenny Hendriks, Crucell Hatching @ EBF, Brussels, June 202 www.crucell.com Vaccines vs Protein therapeutics Protein

More information

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice

T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice SUPPLEMENTAL METHODS T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice Florian Wiede 1, Benjamin J. Shields 1, Sock Hui Chew 1, Konstantinos Kyparissoudis 2,

More information

Supplemental Information. Human Circulating PD-1 + CXCR3 CXCR5 + Memory. Tfh Cells Are Highly Functional and Correlate

Supplemental Information. Human Circulating PD-1 + CXCR3 CXCR5 + Memory. Tfh Cells Are Highly Functional and Correlate Immunity, Volume 39 Supplemental Information Human Circulating PD-1 + CXCR3 CXCR5 + Memory Tfh Cells Are Highly Functional and Correlate with Broadly Neutralizing HIV Antibody Responses Michela Locci,

More information

Optimizing Intracellular Flow Cytometry

Optimizing Intracellular Flow Cytometry Optimizing Intracellular Flow Cytometry Detection of Cytokines, Transcription Factors, and Phosphoprotein by Flow Cytometry Presented by Erika O Donnell, PhD, BD Biosciences 23-14876-00 Outline Basic principles

More information

DURACLONE IF BE CERTAIN ABOUT THE RESPONSE. l res. a il n c n. For Research Use Only - Not for use in Diagnostic procedures

DURACLONE IF BE CERTAIN ABOUT THE RESPONSE. l res. a il n c n. For Research Use Only - Not for use in Diagnostic procedures DURACLONE IF earch tria l res lc a om ic il n c n nio pa Yo ur BE CERTAIN ABOUT THE RESPONSE For Research Use Only - Not for use in Diagnostic procedures BE CERTAIN ABOUT THE RESPONSE The sensitive and

More information

MagniSort Mouse CD4 T cell Enrichment Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

MagniSort Mouse CD4 T cell Enrichment Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 2 MagniSort Mouse CD4 T cell Enrichment Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Mouse splenocytes were unsorted (left) or sorted with the MagniSort Mouse CD4 T cell

More information

Supplemental materials

Supplemental materials Supplemental materials 1 Supplemental Fig. 1 Immunogram This immunogram summarizes patient clinical data and immune parameters at corresponding time points for Patient IMF-32. The top panel illustrates

More information

Optimizing Intracellular Flow Cytometry:

Optimizing Intracellular Flow Cytometry: Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors Presented by Jurg Rohrer, PhD, BD Biosciences 23-10780-00 Outline Introduction Cytokines Transcription

More information

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells

Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,

More information

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods

Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary

More information

IFN-γ Secretion Assay Detection Kit (PE) human

IFN-γ Secretion Assay Detection Kit (PE) human Miltenyi Biotec GmbH Friedrich-Ebert-Straße 68 51429 Bergisch Gladbach, Germany Phone +49 2204 8306-0 Fax +49 2204 85197 macs@miltenyibiotec.de Miltenyi Biotec Inc. 12740 Earhart Avenue Auburn CA 95602,

More information

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation

IMMUNOLOGICAL MEMORY. CD4 T Follicular Helper Cells. Memory CD8 T Cell Differentiation IMMUNOLOGICAL MEMORY CD4 T Follicular Helper Cells Memory CD8 T Cell Differentiation CD4 T Cell Differentiation Bcl-6 T-bet GATA-3 ROR t Foxp3 CD4 T follicular helper (Tfh) cells FUNCTION Provide essential

More information

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

More information

DEVELOPMENTAL VALIDATION OF SPERM HY-LITER EXPRESS Jennifer Old, Chris Martersteck, Anna Kalinina, Independent Forensics, Lombard IL

DEVELOPMENTAL VALIDATION OF SPERM HY-LITER EXPRESS Jennifer Old, Chris Martersteck, Anna Kalinina, Independent Forensics, Lombard IL DEVELOPMENTAL VALIDATION OF SPERM HY-LITER EXPRESS Jennifer Old, Chris Martersteck, Anna Kalinina, Independent Forensics, Lombard IL Background and Introduction SPERM HY-LITER is the first immunofluorescent

More information

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide

Supplementary Information. Tissue-wide immunity against Leishmania. through collective production of nitric oxide Supplementary Information Tissue-wide immunity against Leishmania through collective production of nitric oxide Romain Olekhnovitch, Bernhard Ryffel, Andreas J. Müller and Philippe Bousso Supplementary

More information

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze.

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze. This document is available at www.stemcell.com/pis Catalog #18765 EasySep Mouse CD4+CD62L+ T Cell Isolation Kit For processing 1x 10^9 cells Description Isolate highly purified naïve CD4+ T cells (CD4+CD62L+)

More information

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.

Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni. Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and

More information

Direct TLR2 Signaling Is Critical for NK Cell Activation and Function in Response to Vaccinia Viral Infection

Direct TLR2 Signaling Is Critical for NK Cell Activation and Function in Response to Vaccinia Viral Infection Direct TLR2 Signaling Is Critical for NK Cell Activation and Function in Response to Vaccinia Viral Infection Jennifer Martinez 1, Xiaopei Huang 2, Yiping Yang 1,2 * 1 Department of Immunology, Duke University

More information

Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3-

Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3- Supplemental Data Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3- GFP tumors in mice either injected with control or clodronate-containing liposomes and stained for macrophages using

More information

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze.

COMPONENT NAME COMPONENT # QUANTITY STORAGE SHELF LIFE FORMAT. Store at 2-8 C. Do not freeze. Store at 2-8 C. Do not freeze. This document is available at www.stemcell.com/pis Catalog #18765 EasySep Mouse CD4+CD62L+ T Cell Isolation Kit For processing 1x 10^9 cells Description Isolate highly purified naïve CD4+ T cells (CD4+CD62L+)

More information

Gladstone Institutes, University of California (UCSF), San Francisco, USA

Gladstone Institutes, University of California (UCSF), San Francisco, USA Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of

More information

Recommended Protocols for Phospho Protein Detection in Human Cells

Recommended Protocols for Phospho Protein Detection in Human Cells Recommended Protocols for Phospho Protein Detection in Human Cells Depending on subcellular localization of the phospho protein of interest, as well as epitope susceptibility to cell fixing and permeabilizing

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Autoimmunity in MFG-E8 deficient mice is associated with altered trafficking and enhanced cross-presentation of apoptotic cell antigens

Autoimmunity in MFG-E8 deficient mice is associated with altered trafficking and enhanced cross-presentation of apoptotic cell antigens Research article Autoimmunity in MFG-E8 deficient mice is associated with altered trafficking and enhanced cross-presentation of apoptotic cell antigens YuFeng Peng 1 and Keith B. Elkon 1,2 1 Division

More information

SUPPLEMENTARY FIGURE 1

SUPPLEMENTARY FIGURE 1 SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T

More information

Serum IgE clearance is facilitated by human FcεRI internalization

Serum IgE clearance is facilitated by human FcεRI internalization Serum IgE clearance is facilitated by human FcεRI internalization Research article Alexandra M. Greer, 1 Nan Wu, 1 Amy L. Putnam, 2 Prescott G. Woodruff, 3 Paul Wolters, 3 Jean-Pierre Kinet, 4 and Jeoung-Sook

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10134 Supplementary Figure 1. Anti-inflammatory activity of sfc. a, Autoantibody immune complexes crosslink activating Fc receptors, promoting activation of macrophages, and WWW.NATURE.COM/NATURE

More information

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed

Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed Supplementary Figure 1. Expression of EPO and EPOR during self-limited versus delayed inflammation resolution. a: Flow cytometry analysis showing the electronic gating strategy used to identify peritoneal

More information

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A

Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG

More information

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 CHRISTOPH RADER, 2 MIKHAIL POPKOV, JOHN A. NEVES, AND CARLOS F. BARBAS III 2 Department of Molecular Biology and The

More information

Post- Selection Purity Spleen VAT Spleen <B576/26-A>: B220

Post- Selection Purity Spleen VAT Spleen <B576/26-A>: B220 B Cells Promote Insulin Resistance through Modulation of T Cells and Production of Pathogenic IgG Antibodies Daniel A. Winer*, Shawn Winer*, Lei Shen*, Persis P. Wadia, Jason Yantha, Geoffrey Paltser,

More information

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)

Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.) Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor

More information

Upregulation of Tim-3 and PD-1 expression is associated with tumor antigen specific CD8 + T cell dysfunction in melanoma patients

Upregulation of Tim-3 and PD-1 expression is associated with tumor antigen specific CD8 + T cell dysfunction in melanoma patients Ar ticle Upregulation of Tim-3 and PD-1 expression is associated with tumor antigen specific CD8 + T cell dysfunction in melanoma patients Julien Fourcade, 1 Zhaojun Sun, 1 Mourad Benallaoua, 1 Philippe

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

ezkine Th1/Th17 Whole Blood Intracellular Cytokine Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures.

ezkine Th1/Th17 Whole Blood Intracellular Cytokine Kit Catalog Number: RUO: For Research Use Only. Not for use in diagnostic procedures. Page 1 of 3 ezkine Th1/Th17 Whole Blood Intracellular Cytokine Kit RUO: For Research Use Only. Not for use in diagnostic procedures. Staining of human whole blood with the ezkine Th1/Th17 Whole Blood Intracellular

More information

The Annexin V Apoptosis Assay

The Annexin V Apoptosis Assay The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.

More information

B and T lymphocyte attenuator regulates CD8 + T cell intrinsic homeostasis and memory cell generation

B and T lymphocyte attenuator regulates CD8 + T cell intrinsic homeostasis and memory cell generation 27 Nature Publishing Group http://www.nature.com/natureimmunology B and T lymphocyte attenuator regulates CD8 + T cell intrinsic homeostasis and memory cell generation Carsten Krieg 1, Onur Boyman 1,2,

More information

Human Apolipoprotein A1 EIA Kit

Human Apolipoprotein A1 EIA Kit A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent

More information

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL).

Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). Supplementary Figure 1. NAFL enhanced immunity of other vaccines (a) An over-the-counter, hand-held non-ablative fractional laser (NAFL). (b) Depiction of a MTZ array generated by NAFL. (c-e) IgG production

More information

Specific CD8 T cells in IgE-mediated allergy correlate with allergen dose and allergic phenotype

Specific CD8 T cells in IgE-mediated allergy correlate with allergen dose and allergic phenotype Specific CD8 T cells in IgE-mediated allergy correlate with allergen dose and allergic phenotype Juan A. Aguilar-Pimentel, Francesca Alessandrini, Katharina M. Huster, Thilo Jakob, Holger Schulz, Heidrun

More information

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES

Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature19814 Figure 3e - - - Beads: Hep SA Sup Hep SA Sup Hep - SA - Sup 150 102 76 102 76 Blot: NP-1 Blot: MECA-32 Blot: VEGF Figure 3f Rbt IgG ctrl IP VEGF IP Extended

More information

Factors Which Predispose to the Onset of Autoimmune Disease. A Senior Honors Thesis

Factors Which Predispose to the Onset of Autoimmune Disease. A Senior Honors Thesis Factors Which Predispose to the Onset of Autoimmune Disease A Senior Honors Thesis Presented in Partial Fulfillment of the Requirements for graduation with distinction in Biology in the College of Biological

More information

Supporting Information

Supporting Information Supporting Information Carpenito et al. 10.1073/pnas.0813101106 SI Materials and Methods Generation of Antimesothelin T-Body Molecules. The antimesothelin scfv (SS1)-PE38 (1) was used as a template for

More information

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet

TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details

More information

Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures

Technical Resources. BD Immunocytometry Systems. FastImmune Intracellular Cytokine Staining Procedures FastImmune Intracellular Cytokine Staining Procedures BD has developed protocols for the detection of intracellular cytokines in activated lymphocytes and in activated monocytes. The procedures have been

More information

The Role of CD4 T Cells in the Pathogenesis of Murine AIDS

The Role of CD4 T Cells in the Pathogenesis of Murine AIDS JOURNAL OF VIROLOGY, June 2006, p. 5777 5789 Vol. 80, No. 12 0022-538X/06/$08.00 0 doi:10.1128/jvi.02711-05 Copyright 2006, American Society for Microbiology. All Rights Reserved. The Role of CD4 T Cells

More information

Supplementary webappendix

Supplementary webappendix Supplementary webappendix This webappendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Portevin D, Moukambi F, Clowes P, et

More information

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function.

ONLINE SUPPLEMENT MATERIAL. CD70 limits atherosclerosis and promotes macrophage function. ONLINE SUPPLEMENT MATERIAL CD7 limits atherosclerosis and promotes macrophage function. Holger Winkels* 1,2, Svenja Meiler* 1,2, Esther Smeets* 2, Dirk Lievens 1, David Engel 3, Charlotte Spitz 1, Christina

More information

H5N1 ( Avian Flu ) Hemagglutinin ELISA Pair Set

H5N1 ( Avian Flu ) Hemagglutinin ELISA Pair Set H5N1 ( Avian Flu ) Hemagglutinin ELISA Pair Set Catalog Number : SEK002 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized

More information

Effective Targeting of Quiescent Chronic Myelogenous

Effective Targeting of Quiescent Chronic Myelogenous Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,

More information

Chronic thoracic spinal cord injury impairs CD8 + T-cell function by up-regulating programmed cell death-1 expression

Chronic thoracic spinal cord injury impairs CD8 + T-cell function by up-regulating programmed cell death-1 expression Zha et al. Journal of Neuroinflammation 2014, 11:65 JOURNAL OF NEUROINFLAMMATION RESEARCH Open Access Chronic thoracic spinal cord injury impairs CD8 + T-cell function by up-regulating programmed cell

More information

Obesity reversibly depletes the basal cell population and enhances mammary epithelial cell estrogen receptor alpha expression and progenitor activity

Obesity reversibly depletes the basal cell population and enhances mammary epithelial cell estrogen receptor alpha expression and progenitor activity Chamberlin et al. Breast Cancer Research (2017) 19:128 DOI 10.1186/s13058-017-0921-7 RESEARCH ARTICLE Open Access Obesity reversibly depletes the basal cell population and enhances mammary epithelial cell

More information

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)

- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml) Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of

More information

A Microfluidic ExoSearch Chip for Multiplexed Exosome Detection Towards Bloodbased Ovarian Cancer Diagnosis

A Microfluidic ExoSearch Chip for Multiplexed Exosome Detection Towards Bloodbased Ovarian Cancer Diagnosis Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2015 Supplementary Information A Microfluidic ExoSearch Chip for Multiplexed Exosome Detection

More information

Yi Liu 1, 2, 4, Lihui Xu 3, 4, Yiqun Jiang 1, Jianfang Sun 1, 5 and Xianhui He 2, 5. Key Words: LCMV, CD8 T cell, peptide vaccine, phenotype, PD-1

Yi Liu 1, 2, 4, Lihui Xu 3, 4, Yiqun Jiang 1, Jianfang Sun 1, 5 and Xianhui He 2, 5. Key Words: LCMV, CD8 T cell, peptide vaccine, phenotype, PD-1 Cellular & Molecular Immunology 431 Article Phenotypic and Functional Analysis of LCMV gp33-41-specific CD8 T Cells Elicited by Multiple Peptide Immunization in Mice Revealed the Up-regulation of PD-1

More information

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons

Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

The Pennsylvania State University. The Graduate School. Department of Comparative Medicine HOW IMMUNOLOGICAL STUDIES ARE BEING INFLUENCED BY

The Pennsylvania State University. The Graduate School. Department of Comparative Medicine HOW IMMUNOLOGICAL STUDIES ARE BEING INFLUENCED BY The Pennsylvania State University The Graduate School Department of Comparative Medicine HOW IMMUNOLOGICAL STUDIES ARE BEING INFLUENCED BY HELICOBACTER HEPATICUS STATUS IN THE MOUSE COLONIES A Thesis in

More information

ASSESSING THE FUNCTION OF EBV-SPECIFIC CD4 + T cells

ASSESSING THE FUNCTION OF EBV-SPECIFIC CD4 + T cells ASSESSING THE FUNCTION OF EBV-SPECIFIC CD4 + T cells BY BENJAMIN JAMES MECKIFF A thesis submitted to the University of Birmingham for the degree of MRes in Cancer Sciences School of Cancer Sciences College

More information

Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D.

Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D. Regulation of anti-tumor immunity through migration of immune cell subsets within the tumor microenvironment Thomas F. Gajewski, M.D., Ph.D. Professor, Departments of Pathology and Medicine Program Leader,

More information

Supplementary Information

Supplementary Information Supplementary Information Memory-type ST2 + CD + T cells participate in the steroid-resistant pathology of eosinophilic pneumonia Naoko Mato 1, 2, Kiyoshi Hirahara 2, Tomomi Ichikawa 2, Jin Kumagai 2,

More information

This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S.

This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S. This is an by copyright after embargo allowed publisher s PDF of an article published in Jablonska, J., Leschner, S., Westphal, K., Lienenklaus, S., Weiss, S. Neutrophils responsive to endogenous IFN-β

More information

Neonatal Exposure to Microbial Phosphorylcholine Modulates the Development of House Dust Mite Allergy During Adult Life

Neonatal Exposure to Microbial Phosphorylcholine Modulates the Development of House Dust Mite Allergy During Adult Life Neonatal Exposure to Microbial Phosphorylcholine Modulates the Development of House Dust Mite Allergy During Adult Life J. Sides SEM Preeyam Patel Mentor: Dr John Kearney 015 CAMBAC Research Day 9/18/15

More information

T cell memory Friday, February 10, 17

T cell memory Friday, February 10, 17 T cell memory 2-10-2017 expansion contraction memory recall EFFECTORS 10 6 pathogen load secondary challenge MEMORY 10 2 NAIVE 2 7-8 30 >1 year days post-infection In mouse, ~100 naïve, CD8s become ~3x10

More information

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set

Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Influenza A H1N1 (Swine Flu 2009) Hemagglutinin / HA ELISA Pair Set Catalog Number : SEK001 To achieve the best assay results, this manual must be read carefully before using this product and the assay

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Automated manufacture of T-cell immunotherapies using gamma retroviral transduction. Lee Markwick, PhD. AMC, Manchester March 2018

Automated manufacture of T-cell immunotherapies using gamma retroviral transduction. Lee Markwick, PhD. AMC, Manchester March 2018 Automated manufacture of T-cell immunotherapies using gamma retroviral transduction Lee Markwick, PhD AMC, Manchester March 2018 Automated generation of CAR T cells Starting material d0 T cell enrichment

More information

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC

5K ALDEFLUOR-positive/ CXCR1-negative. 5K ALDEFLUOR-positive/ CXCR1-positive BAAA BAAA CXCR1-APC BAAA BAAA CXCR1-APC A +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-negative BAAA BAAA CXCR-APC B +DEAB -DEAB K ALDEFLUOR-positive/ CXCR-positive BAAA BAAA CXCR-APC C Supplemental Figure. Tumorigenicity of the ALDEFLUOR-positive/CXCR-positive

More information

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes

TLR2- and Dectin 1 Associated Innate Immune Response Modulates T-Cell Response to Pancreatic b-cell Antigen and Prevents Type 1 Diabetes Diabetes Volume 64, April 2015 1341 Subha Karumuthil-Melethil, 1 M. Hanief Sofi, 2 Radhika Gudi, 3 Benjamin M. Johnson, 2 Nicolas Perez, 1 and Chenthamarakshan Vasu 2,3 TLR2- and Dectin 1 Associated Innate

More information