Supplementary Table S1: PCR protocols used for genotyping

Zurich Open Repository and Archive

University of Zurich Zurich Open Repository and Archive Winterthurerstr. 190 CH-8057 Zurich http://www.zora.uzh.ch Year: 2007 Adrenergic receptor genotype but not perioperative bisoprolol therapy may determine

Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage

Myoglobin A79G polymorphism association with exercise-induced skeletal muscle damage T. Cui and M.S. Jiang College of Physical Education, Shandong University of Finance and Economics, Ji nan, Shandong,

Total genomic DNA was extracted from either 6 DBS punches (3mm), or 0.1ml of peripheral or

Material and methods Measurement of telomere length (TL) Total genomic DNA was extracted from either 6 DBS punches (3mm), or 0.1ml of peripheral or cord blood using QIAamp DNA Mini Kit and a Qiacube (Qiagen).

altona RealStar Instructions for Use RealStar CMV PCR Kit /2017 EN DIAGNOSTICS

altona DIAGNOSTICS Instructions for Use RealStar CMV PCR Kit 1.2 08/2017 EN RealStar RealStar CMV PCR Kit 1.2 For research use only! (RUO) 021202 INS-021200-EN-S01 48 08 2017 altona Diagnostics GmbH Mörkenstr.

Supplementary information

Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!

attomol HLA-B*27-Realtime LT 2 Assay for the detection of the human HLA-B*27-locus using LightCycler (Do not use for tissue typing!) For in vitro diagnostic use only! 50 determinations Order number: 95

Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,

The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,

SUPPLEMENTAL MATERIAL

SUPPLEMENTAL MATERIAL Clinical perspective It was recently discovered that small RNAs, called micrornas, circulate freely and stably in human plasma. This finding has sparked interest in the potential

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

Association of Arg16Gly Polymorphism of the Beta-2 Adrenergic receptor with Baroreflex Sensitivity and Indices of Autonomic Cardiovascular Modulation

Association of Arg16Gly Polymorphism of the Beta-2 Adrenergic receptor with Baroreflex Sensitivity and Indices of Autonomic Cardiovascular Modulation Ochoa JE 1,2, Correa M 1,5, Gallo J 3,5, McEwen J 1,3,

pulmonary artery vasoreactivity in patients with idiopathic pulmonary arterial hypertension

Supplementary material Jonas K, Magoń W, Waligóra M, et al. High density lipoprotein cholesterol levels and pulmonary artery vasoreactivity in patients with idiopathic pulmonary arterial hypertension Pol

Supplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2

Supplementary Figure 1 Forest plots of genetic variants in GDM with all included studies. (A) IGF2BP2 rs4402960, (B) MTNR1B rs10830963, (C) TCF7L2 rs7903146, (D) IRS1 rs1801278, (E) PPARG rs1801282, (F)

(DNA) Real-time PCR. Exicycler 96 Rotor-Gene Q/6000 PCR

Real-Time (DNA) Real-time Exicycler 96 Rotor-Gene Q/6000 IU Mix1 Mix2 IU/μl IU/μl IU/μl IU/μl IU/μl IPC NTC C 1 Lot# 2 Freeze & thawing 1 MSDS: Material Safety Data Sheets (TaqMan Real-time ' FAM ' BHQ1

Signaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana

Biochemistry: Signaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana 38 CAMERON E. NIENABER ʻ04 Abstract Long recognized as essential plant nutrients and metabolites, inorganic and organic

A copy can be downloaded for personal non-commercial research or study, without prior permission or charge

Van der Walt, D., Cloete, S.W.P., Storbeck, K., and Swart, P. (2009) The role of Cytochrome P450 17-alpha-Hydroxylase/ 17,20-Lyase (CYP17) in the stress coping ability in a divergently selected Merino

Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women

www.bioinformation.net Volume 13(5) Hypothesis Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women Maniraja Jesintha

Long-term prognostic value of N-Terminal Pro-Brain Natriuretic Peptide (NT-proBNP) changes within one year in patients with coronary heart disease

Long-term prognostic value of N-Terminal Pro-Brain Natriuretic Peptide (NT-proBNP) changes within one year in patients with coronary heart disease D. Dallmeier 1, D. Rothenbacher 2, W. Koenig 1, H. Brenner

Supplementary Figure 1

Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression

Nature Genetics: doi: /ng.2995

Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation

Chapter 4 INSIG2 Polymorphism and BMI in Indian Population

Chapter 4 INSIG2 Polymorphism and BMI in Indian Population 4.1 INTRODUCTION Diseases like cardiovascular disorders (CVD) are emerging as major causes of death in India (Ghaffar A et. al., 2004). Various

Relative activity (%) SC35M

a 125 Bat (H17N) b 125 A/WSN (H1N1) Relative activity (%) 0 75 50 25 Relative activity (%) 0 75 50 25 0 Pos. Neg. PA PB1 Pos. Neg. NP PA PB1 PB2 0 Pos. Neg. NP PA PB1 PB2 SC35M Bat Supplementary Figure

MRP1 polymorphisms (T2684C, C2007T, C2012T, and C2665T) are not associated with multidrug resistance in leukemic patients

MRP1 polymorphisms (T2684C, C2007T, C2012T, and C2665T) are not associated with multidrug resistance in leukemic patients F. Mahjoubi, S. Akbari, M. Montazeri and F. Moshyri Clinical Genetics Department,

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence

Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β

An Evolution of Michigan s SCID Algorithm

An Evolution of Michigan s SCID Algorithm A qualitative approach for the T cell receptor excision circle (TREC) assay for the detection of primary immune deficiency syndromes (PIDS) demonstrates better

Association between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer

Association between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer M.G. He, K. Zheng, D. Tan and Z.X. Wang Department of Hepatobiliary Surgery, Nuclear Industry 215 Hospital

Mycoplasma Total Solution. Mycoplasma Detection Mycoplasma Elimination Mycoplasma Prevention Cell Freezing Medium (Mycoplasma Free)

Mycoplasma Total Solution Mycoplasma Detection Mycoplasma Elimination Mycoplasma Prevention Cell Freezing Medium (Mycoplasma Free) Mycoplasma Detection Mycoplasma Detection CellSafe s Mycoplasma Detection

Supplementary Table 1. List of primers used in this study

Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3

Biomarkers in Acute Cardiac Disease Samir Arnaout, M.D.FESC Associate Professor of Medicine Internal Medicine i & Cardiology American University of Beirut Time course of the appearance of various markers

Instructions for Use. RealStar Influenza Screen & Type RT-PCR Kit /2017 EN

Instructions for Use RealStar Influenza Screen & Type RT-PCR Kit 4.0 05/2017 EN RealStar Influenza Screen & Type RT-PCR Kit 4.0 For research use only! (RUO) 164003 INS-164000-EN-S01 96 05 2017 altona

Title: PGx250: An Exploratory Pharmacogenetic Analysis of Asthma Exacerbations in African-Americans treated

GSK Medicine: Fluticasone propionate/salmeterol Study No.: SFA115050 Title: PGx250: An Exploratory Pharmacogenetic Analysis of Asthma Exacerbations in African-Americans treated with Advair Start Date (FPA

SUPPLEMENTARY INFORMATION

Haematopoietic stem cell release is regulated by circadian oscillations Simón Méndez-Ferrer *, Daniel Lucas *, Michela Battista * and Paul S. Frenette * Mount Sinai School of Medicine, *Departments of

NATIONAL INSTITUTE FOR HEALTH AND CLINICAL EXCELLENCE Centre for Clinical Practice

NATIONAL INSTITUTE FOR HEALTH AND CLINICAL EXCELLENCE Centre for Clinical Practice Review consultation document Review of Clinical Guideline (CG95) Chest pain of recent onset: Assessment and diagnosis

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6

Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population

Int J Clin Exp Med 2014;7(12):5832-5836 www.ijcem.com /ISSN:1940-5901/IJCEM0002117 Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk

To estimate the serum level of N-terminal pro-brain natriuretic peptide levels in acute coronary syndrome

Original Research Article To estimate the serum level of N-terminal pro-brain natriuretic peptide levels in acute coronary syndrome Mohamed Yasar Arafath 1, K. Babu Raj 2* 1 First Year Post Graduate, 2

Assay Location Primer TaqMan probe Reference

Table S1. Primers and TaqMan probes for picoliter-ddpcr Assay Location Primer TaqMan probe Reference Exon 19 deletion assay a Exon 19 GCACCATCTCACAATTGCCAG VIC-CAGAAGGTGAGAAAGTT-MGB Reference probe Original

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described

Association between interleukin-17a polymorphism and coronary artery disease susceptibility in the Chinese Han population

Association between interleukin-17a polymorphism and coronary artery disease susceptibility in the Chinese Han population G.B. Su, X.L. Guo, X.C. Liu, Q.T. Cui and C.Y. Zhou Department of Cardiothoracic

Association between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population

Association between ERCC1 and ERCC2 polymorphisms and breast cancer risk in a Chinese population R. Zhao and M.F. Ying Department of Pharmacy, Sir Run Run Shaw Hospital, School of Medicine, Zhejiang University,

Supplementary Information

Supplementary Information Detection and differential diagnosis of colon cancer by a cumulative analysis of promoter methylation Qiong Yang 1,3*, Ying Dong 2,3, Wei Wu 1, Chunlei Zhu 1, Hui Chong 1, Jiangyang

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Generation of a conditional allele of the Kindlin-2 gene. (A) A restriction map of the relevant genomic region of Kindlin-2 (top), the targeting construct

AmoyDx TM BRAF V600E Mutation Detection Kit

AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background

Diagnostic Methods of HBV and HDV infections

Diagnostic Methods of HBV and HDV infections Zohreh Sharifi,ph.D Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine Hepatitis B-laboratory diagnosis Detection

CLINICAL INVESTIGATIONS

CLINICAL INVESTIGATIONS Anesthesiology 2003; 98:1315 27 2003 American Society of Anesthesiologists, Inc. Lippincott Williams & Wilkins, Inc. Preconditioning by Sevoflurane Decreases Biochemical Markers

Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3.

Table S1. Primers and PCR protocols for mutation screening of MN1, NF2, KREMEN1 and ZNRF3. MN1 (Accession No. NM_002430) MN1-1514F 5 -GGCTGTCATGCCCTATTGAT Exon 1 MN1-1882R 5 -CTGGTGGGGATGATGACTTC Exon

Instructions for Use. RealStar Influenza S&T RT-PCR Kit /2017 EN

Instructions for Use RealStar Influenza S&T RT-PCR Kit 3.0 01/2017 EN RealStar Influenza S&T RT-PCR Kit 3.0 For research use only! (RUO) 163003 INS-163000-EN-S02 96 01 2017 altona Diagnostics GmbH Mörkenstr.

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ

Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,

Table I: PHT1 transporter family comparison at the amino acid level. BLAST program was used to obtain percentage of similarity and identity (in bold).

Supplemental Tables Table I: PHT1 transporter family comparison at the amino acid level. BLAST program was used to obtain percentage of similarity and identity (in bold). PHT1;1 PHT1;2 PHT1;3 PHT1;4 PHT1;5

Supplementary Figure 1

A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

Gender: M Chart No: Fasting: Yes. Boston Heart HDL Map TM Test 1 ApoA-I (mg/dl) levels in HDL particles. α Range > <14 mg/dl. α-2 50.

Pro vider: Ordering Provider 123 Main Street Anytown, ST 12345 Account No: DOB: 00/00/1950 Framingham Risk Score: Patient Info: FAMILY HIST CVD Lipid, Lipoprotein and Apolipoprotein Tests Total Cholesterol

Proceedings of the 36th World Small Animal Veterinary Congress WSAVA

www.ivis.org Proceedings of the 36th World Small Animal Veterinary Congress WSAVA Oct. 14-17, 2011 Jeju, Korea Next Congress: Reprinted in IVIS with the permission of WSAVA http://www.ivis.org 14(Fri)

Chapter 6. Candidate gene analysis Part II

Chapter 6 Candidate gene analysis Part II Relationship of Beta2-Adrenergic Receptor polymorphism with obesity in type 2 diabetes mellitus Jonathan H van Tilburg, 1 Cisca Wijmenga, 1 Leida Roseman, 1 Eric

(DNA) Real-time PCR. Exicycler 96 Rotor-Gene Q/6000 PCR

Real-Time (DNA) Real-time Exicycler 96 Rotor-Gene Q/6000 IU Mix1 Mix2 IU/μl IU/μl IU/μl IU/μl IU/μl IPC NTC C 1 Lot# 2 Freeze & thawing 1 MSDS: Material Safety Data Sheets Real- (TaqMan time ' FAM ' BHQ1

Supplementary methods:

Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

Association between interleukin gene polymorphisms and risk of recurrent oral ulceration

Association between interleukin gene polymorphisms and risk of recurrent oral ulceration C. Jing and J.-Q. Zhang Department of Stomatology, The First Affiliated Hospital of PLA General Hospital, Beijing,

Chlamydia pneumoniae PCR reagents Detection with real time PCR reagents

Chlamydia pneumoniae PCR reagents Detection with real time PCR reagents Overview:... 1 Products... 2 C. pneumoniae FAM-BHQ1 Primer-probe PP3400 0.055ml... 2 AttoMaster 2X Mix for qpcr AM10 1.25 ml... 2

PREDICTUS - USE OF SYSTEM BIOLOGY TO PREDICT AND DIAGNOSE TRANSITORY ISCHEMIA AND ISCHEMIC TOLERANCE

PREDICTUS - USE OF SYSTEM BIOLOGY TO PREDICT AND DIAGNOSE TRANSITORY ISCHEMIA AND ISCHEMIC TOLERANCE Francisco Purroy García Hospital Universitari Arnau de Vilanova, Lleida Joaquim Egea Navarro Faculty

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).

Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:

Non-competitive Internal Control Concept for PCR-based Qualitative Assays

Christian O. Simon Roche Molecular Diagnostics Rotkreuz, CH Non-competitive Internal Control Concept for PCR-based Qualitative Assays 23 rd SoGAT Meeting, 16 th 17 th April, 2012, Vilnius, Lithuania Design

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

Supplementary Figure 1

Supplementary Figure 1 6 HE-50 HE-116 E-1 HE-108 Supplementary Figure 1. Targeted drug response curves of endometrial cancer cells. Endometrial cancer cell lines were incubated with serial dilutions of

M. Khanna and S. Visuri

The ProPneumo1 Assay: Detection of Chlamydophila pneumoniae, Mycoplasma pneumoniae, and an Internal Control Using Multiplex PCR on Multiple Real Time PCR Systems S. Dollhopf,, W. Majewski,, P. Douglass,

Lack of association between ERCC5 gene polymorphisms and gastric cancer risk in a Chinese population

Lack of association between ERCC5 gene polymorphisms and gastric cancer risk in a Chinese population J.J. Lu, H.Q. Zhang, P. Mai, X. Ma, X. Chen, Y.X. Yang and L.P. Zhang Gansu Provincial Hospital, Donggang

Supplementary Material

Supplementary Material 2 4 6 Single-locus gene screening methods We screened for single nucleotide polymorphisms (SNPs) at 16 candidate immune genes (Table S1) by initially sequencing three captive-bred

SALSA MLPA KIT P060-B2 SMA

SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the

Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.

competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)

Importance of changes in thoracic and abdominal aortic stiffness following stent graft implantation

14/9/2018 Importance of changes in thoracic and abdominal aortic stiffness following stent graft implantation Christos D. Liapis, MD, FACS, FRCS, FEBVS Professor (Em) of Vascular Surgery National & Kapodistrian

Supplemental Information. Figures. Figure S1

Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the

SALSA MLPA probemix P169-C2 HIRSCHSPRUNG-1 Lot C As compared to version C1 (lot C1-0612), the length of one probe has been adjusted.

mix P169-C2 HIRSCHSPRUNG-1 Lot C2-0915. As compared to version C1 (lot C1-0612), the length of one has been adjusted. Hirschsprung disease (HSCR), or aganglionic megacolon, is a congenital disorder characterised

THE ROLE OF microrna POLYMORPHISMS IN GASTRIC CANCER PATHOGENESIS

UNIVERSITY OF MEDICINE AND PHARMACY CRAIOVA DOCTORAL SCHOOL THE ROLE OF microrna POLYMORPHISMS IN GASTRIC CANCER PATHOGENESIS PhD THESIS ABSTRACT SCIENTIFIC ADVISOR: PROF. UNIV. DR. ION ROGOVEANU PhD student:

Research Article Association of TAP Gene Polymorphisms and Risk of Cervical Intraepithelial Neoplasia

Disease Markers Volume 35 (2013), Issue 2, Pages 79 84 http://dx.doi.org/10.1155/2013/368732 Research Article Association of TAP Gene Polymorphisms and Risk of Cervical Intraepithelial Neoplasia Camilla

WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT. Product: Alere q HIV-1/2 Detect WHO reference number: PQDx

WHO Prequalification of In Vitro Diagnostics PUBLIC REPORT Product: Alere q HIV-1/2 Detect WHO reference number: PQDx 0226-032-00 Alere q HIV-1/2 Detect with product codes 270110050, 270110010 and 270300001,

IL10 rs polymorphism is associated with liver cirrhosis and chronic hepatitis B

IL10 rs1800896 polymorphism is associated with liver cirrhosis and chronic hepatitis B L.N. Cao 1, S.L. Cheng 2 and W. Liu 3 1 Kidney Disease Department of Internal Medicine, Xianyang Central Hospital,

Quantity in. Unit of Measure. (If Applicable) 1 each Anode Buffer Reservoir Jar 1 Applied Biosystems $101.65

CONTRACT 1-09-65-05 Consumable DNA Kits and Reagent Supplies Supplement 2 2/24/2011 ATTACHMENT A Contract Pricing (Rev 2/24/11) Contract Line Item 1 each Anode Buffer Reservoir Jar 1 Applied Biosystems

Zhu et al, page 1. Supplementary Figures

Zhu et al, page 1 Supplementary Figures Supplementary Figure 1: Visual behavior and avoidance behavioral response in EPM trials. (a) Measures of visual behavior that performed the light avoidance behavior

SALSA MLPA probemix P241-D2 MODY mix 1 Lot D2-0716, D As compared to version D1 (lot D1-0911), one reference probe has been replaced.

mix P241-D2 MODY mix 1 Lot D2-0716, D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent

Supplementary Material

Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

MRC-Holland MLPA. Description version 19;

SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL

RIDA GENE HLA-B27 PY0205

RIDA GENE HLA-B27 PY0205 R-Biopharm AG, An der neuen Bergstraße 17, 64297 Darmstadt, Germany Phone: +49 (0) 61 51 81 02-0 / Fax: +49 (0) 61 51 81 02-20 1. Intended use For in vitro diagnostic use. With

Complicated viral infections

Complicated viral infections Clinical case discussion Diagnostic dilemmas NSW State Reference Laboratory for HIV St Vincent s Hospital Sydney Diagnostic dilemmas Indeterminate or discordant serology (western

2 International Conference on Predictive, Preventive and Personalized Medicine and Molecular Diagnostics

Dr. Cristina Patassini 2 International Conference on Predictive, Preventive and Personalized Medicine and Molecular Diagnostics Las Vegas, 3-5 november 2014 Obesity worldwide According to the World Health

Hepatitis C Virus Genotype 2 may not be detected by the Cobas AmpliPrep/Cobas. TaqMan HCV Test, version 1.0

JCM Accepts, published online ahead of print on 25 September 2013 J. Clin. Microbiol. doi:10.1128/jcm.02102-13 Copyright 2013, American Society for Microbiology. All Rights Reserved. 1 2 Hepatitis C Virus

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized

NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY. 16th International WAVLD symposium, 10th OIE Seminar

NEXT GENERATION SEQUENCING OPENS NEW VIEWS ON VIRUS EVOLUTION AND EPIDEMIOLOGY S. Van Borm, I. Monne, D. King and T. Rosseel 16th International WAVLD symposium, 10th OIE Seminar 07.06.2013 Viral livestock

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan

Supplementary Table 1. The distribution of IFNL rs and rs and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC

Supplementary Table 1. The distribution of IFNL rs12979860 and rs8099917 and Hardy-Weinberg equilibrium Genotype Observed Expected X 2 P-value* CHC rs12979860 (n=3129) CC 1127 1145.8 CT 1533 1495.3 TT

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

An Update & Suggestions on How to Use It

Information as of November 2014 NT-proBNP NT-proBNP may be used to help detect, diagnose and evaluate the severity of heart failure. An Update & Suggestions on How to Use It ExamOne s NT-proBNP Experience

Supplementary information. Supplementary figure 1. Flow chart of study design

Supplementary information Supplementary figure 1. Flow chart of study design Supplementary Figure 2. Quantile-quantile plot of stage 1 results QQ plot of the observed -log10 P-values (y axis) versus the

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity

Supplementary Figure 1 Binding capacity of DNA-barcoded MHC multimers and recovery of antigen specificity (a, b) Fluorescent-based determination of the binding capacity of DNA-barcoded MHC multimers (+barcode)

Association of plasma uric acid with ischemic heart disease and blood pressure:

Association of plasma uric acid with ischemic heart disease and blood pressure: Mendelian randomization analysis of two large cohorts. Tom M Palmer, Børge G Nordestgaard, DSc; Marianne Benn, Anne Tybjærg-Hansen,

Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical

Supplementary Figure 1. Quantile-quantile (Q-Q) plots. (Panel A) Q-Q plot graphical representation using all SNPs (n= 13,515,798) including the region on chromosome 1 including SORT1 which was previously

A. One to three months of age. Anterior Lens (Mean ± SEM) Posterior Lens (Mean ± SEM) Mid Lens (Mean ± SEM) Cornea (Mean ± SEM) Genotype

Supplementary Table 1. Location of lens opacification in Aldh1a1(-/-), Aldh3a1(-/-) single and Aldh1a1(-/-)/Aldh3a1(-/-) double knockout mice (DKO) at different ages. A. One to three months of age Genotype

This supplementary material has been provided by the authors to give readers

Supplementary Online Content LI D, Radulescu A, Shrestha RT, et al. Association of biotin ingestion with performance of hormone and nonhormone assays in healthy adults. JAMA. doi:1.11/jama.217.1375 efigure

Nature Genetics: doi: /ng Supplementary Figure 1. Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms.

Supplementary Figure 1 Immunofluorescence (IF) confirms absence of H3K9me in met-2 set-25 worms. IF images of wild-type (wt) and met-2 set-25 worms showing the loss of H3K9me2/me3 at the indicated developmental

β 1 Adrenergic Receptor Polymorphism-Dependent Differences

GENETIC-AF Phase II Trial of Pharmacogenetic Guided Beta-Blocker Therapy with Bucindolol vs. Metoprolol for the Prevention of Atrial Fibrillation/Flutter in Heart Failure William T. Abraham, MD Professor

Influenza A viruses Detection with real time RT-PCR reagents

Influenza A viruses Detection with real time RT-PCR reagents Overview:... 1 Products... 2 Influenza A matix FAM-BHQ1 PP500 0.055ml... 2 Influenza A Plasmid 200 pg/ml PLAS500 0.25ml... 2 Detection Influenza