Supplemental Tables and Figures
|
|
- Shon Ralph Blankenship
- 6 years ago
- Views:
Transcription
1 Supplemental Tables and Figures Post-zygotic de novo changes in glutamate and dopamine pathways may explain discordance of monozygotic twins for schizophrenia Castellani, CA., Melka, MG., Gui, JL., Gallo, AJ., O Reilly, RL., Singh, SM The University of Western Ontario
2 Figure S1-A. Circos plot of high confidence unique mutations in the affected member of Family 1. These variations were unshared between twins and not found in either parent. Blue represents a gain and red represents a loss. Outside track=snvs, Indels, Subs, Middle track=cnvs and Inside track= SVs. The arrow represents an inter chromosomal event.
3 Figure S1-B. Circos plot of high confidence unique mutations in the affected member of Family 2. These variations were unshared between twins. Blue represents a gain and red represents a loss. Outside track=snvs, Indels, Subs, Middle track=cnvs and Inside track= SVs.
4 Figure S2. Call Quality of raw variant calls.
5 Figure S3. Read Depth Density of raw variant calls. Outliers (above 250) were not included
6 Figure S4. Venn diagram of shared top 20 canonical pathways found to be overrepresented by variants in the sequencing dataset of affected and unaffected twins. The pathways from the unaffected twin in Family 1 and Family 2 have been merged to represent 36 unique pathways (4 shared). The 18 pathways unique to unaffected twins are broken down into 11 from Family 1 and 7 in Family 2.
7 Table S1. Structural Variants unique to the affected member of Family 1 (I-2-1). Shared identity is based on a 50% reciprocal overlap rule. Chr Start End Size (bp) SV Type Gene(s) Father Mother Inheritance Deletion 0 Present Absent Inherited Deletion 0 Present Present Inherited Deletion 0 Present Absent Inherited Deletion C1orf168 Present Present Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Present Inherited Deletion PDE4DIP Present Present Inherited Deletion PDE4DIP Present Present Inherited Deletion 0 Present Present Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Present Inherited Deletion MYT1L Present Absent Inherited Deletion 0 Present Present Inherited Deletion LOC Present Present Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Present Inherited Deletion 0 Present Present Inherited Deletion 0 Present Absent Inherited Deletion GALNTL2 Present Absent Inherited Deletion 0 Present Present Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Absent Inherited
8 Deletion 0 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Present Inherited Deletion ANTXR2 Present Present Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion LOC ;TPPP Present Present Inherited Deletion 0 Present Absent Inherited Deletion GHR Present Absent Inherited Deletion 0 Present Present Inherited Deletion REEP5 Present Absent Inherited Deletion LMNB1 Present Absent Inherited Deletion LOC Present Present Inherited Deletion UIMC1 Present Absent Inherited Deletion 0 Present Present Inherited Deletion 0 Present Absent Inherited Deletion PKHD1 Present Absent Inherited Deletion 0 Present Present Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Present Inherited Deletion ANLN Present Absent Inherited
9 Deletion ABHD11;AUTS2;BAZ1B;BCL7B;C7orf42;CALN1;CLDN3;CLD N4;DNAJC30;FKBP6;FZD9;GTF2IRD2P;LOC ;LOC ;LOC ;LOC ;LOC ;LOC ;LOC442572;LOC644794;LOC729156;ML XIPL;NCF1B;NSUN5;NSUN5C;PMS2L4;POM121;RABGEF1;S BDS;SBDSP;SPDYE7P;SPDYE8P;STAG3L3;STAG3L4;STX1A;T BL2;TRIM50;TRIM74;TYW1;TYW1B;VPS37D;WBSCR17;WB SCR22;WBSCR26;WBSCR27;WBSCR28 Present Present Inherited Deletion 0 Present Present Inherited Deletion MUC12 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Present Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Present Inherited Deletion 0 Present Present Inherited Deletion 0 Present Absent Inherited Deletion DAB2IP Present Absent Inherited Deletion 0 Present Absent Inherited Deletion C9orf98 Present Absent Inherited Deletion DNAJC1 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion KCNMA1 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion OR52N1;OR52N5 Present Absent Inherited Deletion MICAL2 Present Present Inherited Deletion 0 Present Present Inherited
10 Deletion 0 Present Present Inherited Deletion LOC Present Absent Inherited Deletion A2ML1 Present Present Inherited Deletion 0 Present Absent Inherited Deletion ANKS1B Absent Absent De novo Deletion MAPKAPK5 Present Absent Inherited Deletion 0 Present Absent Inherited Deletion 0 Absent Present Inherited Deletion ZDHHC20 Present Absent Inherited Deletion 0 Absent Absent De novo Deletion 0 Present Absent Inherited Deletion FUT8 Present Absent Inherited Deletion 0 Absent Absent De novo Deletion 0 Present Absent Inherited Deletion 0 Absent Present Inherited Deletion 0 Present Present Inherited Deletion 0 Absent Absent De novo Deletion LASS3 Present Present Inherited Deletion 0 Present Absent Inherited Deletion 0 Present Present Inherited Deletion NXN Absent Present Inherited Deletion 0 Absent Absent De novo Deletion LOC ;XYLT2 Present Present Inherited Deletion 0 Absent Absent De novo Deletion 0 Present Absent Inherited Deletion 0 Present Present Inherited Deletion 0 Absent Absent De novo
11 Deletion 0 Absent Absent De novo Deletion EMR3 Present Present Inherited Deletion 0 Present Absent Inherited Deletion 0 Absent Absent De novo Deletion PLTP Absent Present Inherited Deletion 0 Absent Present Inherited Deletion A4GALT Present Absent Inherited Deletion FAM19A5 Present Present Inherited Deletion 0 Absent Absent De novo X Deletion 0 Present Absent Inherited X Deletion 0 Absent Present Inherited X Deletion CLCN5 Absent Absent De novo Tandem Dup ACAP3;ACTRT2;AGRN;AJAP1;ARHGEF16;ATAD3A;ATAD3B; ATAD3C;AURKAIP1;B3GALT6;C1orf159;C1orf170;C1orf174 ;C1orf222;C1orf70;C1orf86;C1orf93;CALML6;CCDC27;CCN L2;CDC2L1;CDC2L2;CPSF3L;DFFB;DVL1;FAM132A;FLJ1410 0;FLJ39609;FLJ42875;GABRD;GLTPD1;GNB1;HES4;HES5;IS G15;KIAA0495;KIAA0562;KIAA1751;KLHL17;LOC ;LOC ;LOC ;LOC ;LOC ;LOC ;LOC ;LOC ;LO C ;LOC ;LOC ;LOC ;LOC ;LOC ;LOC ;LOC10 Absent Absent De novo ;LOC115110;LOC148413;LOC284661;LOC388588; LOC401934;LOC441869;LOC643988;LOC728661;LOC ;LRRC47;MEGF6;MIB2;MMEL1;MMP23A;MMP23B;MO RN1;MRPL20;MXRA8;NADK;NOC2L;PANK4;PEX10;PLCH2; PLEKHN1;PRDM16;PRKCZ;PUSL1;RER1;SAMD11;SCNN1D; SDF4;SKI;SLC35E2;SSU72;TAS1R3;TMEM52;TMEM88B;TN FRSF14;TNFRSF18;TNFRSF4;TP73;TPRG1L;TTLL10;UBE2J2; VWA1;WDR Tandem Dup 0 Absent Absent De novo
12 Tandem Dup TPO Absent Present Inherited Tandem Dup 0 Present Absent Inherited Tandem Dup 0 Present Absent Inherited Tandem Dup 0 Absent Absent De novo Tandem Dup COL23A1 Absent Present Inherited Tandem Dup LOC Absent Absent De novo Tandem Dup PRKAR1B Present Present Inherited Tandem Dup 0 Present Present Inherited Tandem Dup 0 Absent Absent De novo Tandem Dup 0 Absent Absent De novo Tandem Dup NTM Absent Absent De novo Tandem Dup 0 Absent Absent De novo Tandem Dup 0 Present Present Inherited Tandem Dup SNORD Absent Absent De novo Tandem Dup 0 Absent Present Inherited Tandem Dup GZMM Absent Absent De novo Tandem Dup 0 Present Absent Inherited Tandem Dup C20orf39 Present Absent Inherited / / Distal Dup 0 Absent Present Inherited / / Distal Dup LOC Present Absent Inherited / / Distal Dup LOH12CR1 Present Present Inherited / / Distal Dup MGAT4C Present Absent Inherited / / Distal Dup 0 Present Absent Inherited / / Distal Dup 0 Absent Present Inherited
13 / / Distal Dup 0 Absent Present Inherited / / Distal Dup DHRSX;LOC ;LOC Present Absent Inherited / / Distal Dup XAGE-4;XAGE3 Absent Present Inherited Interchrom CDC27 Absent Absent De novo
14 Table S2. Structural Variants unique to the affected member of Family 2 (II-2-1). Shared identity is based on a 50% reciprocal overlap rule. Chr Start End Size (bp) SV Type Gene(s) Deletion Deletion Deletion INADL Deletion Deletion Deletion C4BPA Deletion Deletion Deletion Deletion Deletion DHX Deletion Deletion Deletion Deletion Deletion Deletion ATP2B Deletion Deletion Deletion Deletion Deletion Deletion Deletion 0
15 Deletion Deletion KIAA Deletion Deletion Deletion Deletion Deletion Deletion Deletion Deletion MARVELD Deletion C5orf Deletion LOC Deletion COL23A Deletion Deletion Deletion TMEM170B Deletion Deletion Deletion Deletion Deletion PRIM Deletion AIM Deletion FAM184A Deletion Deletion Deletion OPRM Deletion 0
16 Deletion Deletion PTPRN Deletion Deletion Deletion Deletion Deletion Deletion CCNY Deletion Deletion Deletion ACSL Deletion OVCH Deletion Deletion Deletion Deletion Deletion CASP Deletion ZNF Deletion TMEM132D Deletion Deletion Deletion GPC Deletion Deletion Deletion Deletion Deletion 0
17 Deletion WDR Deletion LOC Deletion Deletion TYRO Deletion MGA Deletion TRPM Deletion Deletion Deletion CRTC Deletion Deletion CHD Deletion GSPT Deletion PRKCB Deletion Deletion RPH3AL Deletion RPH3AL Deletion Deletion LOC Deletion Deletion B4GALNT Deletion Deletion Deletion TFG/GPR Deletion Deletion ZNF Deletion Deletion LOC647946
18 Deletion SLC14A Deletion Deletion DCC Deletion Deletion AP3D Deletion CLPTM Deletion Deletion PIGU Deletion Deletion Deletion CLIC Deletion Deletion SYN Deletion 0 X Deletion DMD X Deletion DACH2 X Deletion Tandem Dup Tandem Dup Tandem Dup CLSTN Tandem Dup Tandem Dup LOC ;LPA;LPAL Tandem Dup PRKAR1B Tandem Dup Tandem Dup LOC Tandem Dup Tandem Dup C10orf51
19 Tandem Dup Tandem Dup CRIP Tandem Dup CLEC17A X Tandem Dup / / / / / XAGE4;ALAS2;APEX2;FAM104B;FAM120C;FAM156A;FAM156B;FGD1 ;FOXR2;GNL3L;GPR173;HSD17B10;HUWE1;IQSEC2;ITIH5L;KDM5C;LO C ;LOC ;LOC ;LOC ;LOC ;LOC644893;MAGED2;MAGEH1;PAGE2;PAGE2B;PAGE3;PAGE 5;PFKFB1;PHF8;RIBC1;SMC1A;SNORA11;TRO;TSPYL2;TSR2;USP51;W NK3;XAGE / Distal Dup / Distal Dup / Distal Dup MUC3A / Distal Dup / Distal Dup REPS2
CITATION FILE CONTENT/FORMAT
CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined
More informationNature Biotechnology: doi: /nbt.1904
Supplementary Information Comparison between assembly-based SV calls and array CGH results Genome-wide array assessment of copy number changes, such as array comparative genomic hybridization (acgh), is
More informationSVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN
SVIM: Structural variant identification with long reads DAVID HELLER MAX PLANCK INSTITUTE FOR MOLECULAR GENETICS, BERLIN JUNE 2O18, SMRT LEIDEN Structural variation (SV) Variants larger than 50bps Affect
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13908 Supplementary Tables Supplementary Table 1: Families in this study (.xlsx) All families included in the study are listed. For each family, we show: the genders of the probands and
More informationNature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationMultiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016
Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics
More informationSupplemental Table 1. List of genes and mature shrna sequences identified from the shrna screen in BRCA2-mutant PEO1 cells.
Guillemette_Supplemental Table 1 Gene Mature Sequence Gene Mature Sequence ATTCATAGGATGTCAGCAG LOC157193 TATGCGTAAGTAATAAATTGCT TTAGTTCTGTCTTGGAGG LOC152225 CGCATATATGTTCTGACTT ALDH2 CACTTCAGTGTATGCCT
More informationSupplementary Information. Supplementary Figures
Supplementary Information Supplementary Figures.8 57 essential gene density 2 1.5 LTR insert frequency diversity DEL.5 DUP.5 INV.5 TRA 1 2 3 4 5 1 2 3 4 1 2 Supplementary Figure 1. Locations and minor
More informationSupplementary Information: Differential methylation of the TRPA1 promoter in pain sensitivity
Supplementary Information: Differential methylation of the TRPA1 promoter in pain sensitivity Bell JT, Loomis AK, Butcher LM, Gao F, Zhang B, Hyde CL, Sun J, Wu H, Ward K, Harris J, Scollen S, Davies MN,
More informationSupplementary Figures. Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated. for each lesion type.
Supplementary Figures Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated for each lesion type. a b Supplementary Figure 2. Non-negative matrix factorization-derived
More informationMerging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines
Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines Tracy Brandt, Ph.D., FACMG Disclosure I am an employee of GeneDx, Inc., a wholly-owned
More informationLecture 20. Disease Genetics
Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying
More informationFamily Tree. Family Health Tree Map your family s history of hereditary ATTR amyloidosis
Family Tree Family Health Tree Map your family s history of hereditary ATTR amyloidosis Chart your family s health history This chart can help you map your family s health history and determine who may
More informationNature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.
Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read
More informationRare Disease Research and the UK 100,000 Genome Project
Rare Disease Research and the UK 100,000 Genome Project Prof F Lucy Raymond MA DPhil FRCP Department of Medical Genetics University of Cambridge UK Flr24@cam.ac.uk Copenhagen October Precision Medicine
More informationwater flows over gills What is meant by the term gas exchange? (1) Suggest three ways in which fish gills are adapted for efficient gas exchange.
1 Fish breathe by opening their mouths to allow water containing oxygen to pass over their gills. This is shown in the diagram. water flows in through mouth gill (a) (i) Gas exchange takes place in the
More informationAn Introduction to Quantitative Genetics I. Heather A Lawson Advanced Genetics Spring2018
An Introduction to Quantitative Genetics I Heather A Lawson Advanced Genetics Spring2018 Outline What is Quantitative Genetics? Genotypic Values and Genetic Effects Heritability Linkage Disequilibrium
More informationSupplementary Information to
Supplementary Information to Exome sequencing to identify de novo mutations in sporadic ALS trios Alessandra Chesi 1,11, Brett T. Staahl 2, Ana Jovicic 1, Julien Couthouis 1, Maria Fasolino 3, Alya R.
More information'Translating massively parallel sequencing into clinical diagnostics.
'Translating massively parallel sequencing into clinical diagnostics. SA Pathology at the Women s and and The University of Adelaide Adelaide, Australia MPS is revolutionising genetics & biology - >100
More informationRNA SEQUENCING AND DATA ANALYSIS
RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length
More informationIVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois
FERTILITY AND STERILITY VOL. 80, NO. 4, OCTOBER 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A. CASE REPORTS Preimplantation
More informationHuman Genetic Diseases (non mutation)
mutation) Pedigrees mutation) 1. Autosomal recessive inheritance: this is the inheritance of a disease through a recessive allele. In order for the person to have the condition they would have to be homozygous
More informationB. male gametes that may be carried by the wind
1. Which characteristic of sexual reproduction has specifically favored the survival of animals that live on land? A. fusion of gametes in the outside environment B. male gametes that may be carried by
More informationSupplementary Table 1. Information on the 174 single nucleotide variants identified by whole-exome sequencing
Supplementary Table 1. Information on the 174 single nucleotide s identified by whole-exome sequencing Chr Position Type AF exomes Database 1 10163148 A/G UBE4B missense 0.000326 1534 2 98 1 4.44 Damaging
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationGenome - Wide Linkage Mapping
Biological Sciences Initiative HHMI Genome - Wide Linkage Mapping Introduction This activity is based on the work of Dr. Christine Seidman et al that was published in Circulation, 1998, vol 97, pgs 2043-2048.
More informationLTA Analysis of HapMap Genotype Data
LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap
More informationFrontiers in Personalized Medicine. PW-GW-AS DNA sequencing Reverse human genetics
Frontiers in Personalized Medicine PW-GW-AS DNA sequencing Reverse human genetics Published Genome-Wide Associations through 06/2011, 1,449 published GWA at p 5x10-8 for 237 traits NHGRI GWA Catalog www.genome.gov/gwastudies
More informationPedigree Analysis. A = the trait (a genetic disease or abnormality, dominant) a = normal (recessive)
Pedigree Analysis Introduction A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships. These diagrams make it easier to visualize
More informationSbarrato_Supplementary_Fig1
Sbarrato_Supplementary_Fig1 Supplementary Figure 1. Translatome analysis of CLL patients based on IGVH mutational status ) Profile for the translatome of unmutated IGVH CLL versus mutated IGVH CLL pa9ents.
More informationRNA SEQUENCING AND DATA ANALYSIS
RNA SEQUENCING AND DATA ANALYSIS Download slides and package http://odin.mdacc.tmc.edu/~rverhaak/package.zip http://odin.mdacc.tmc.edu/~rverhaak/rna-seqlecture.zip Overview Introduction into the topic
More informationTITLE: Genetic and Epigenetic Differences in Monozygotic Twins with NF1
AD AWARD NUMBER: W81XWH-10-1-0867 TITLE: Genetic and Epigenetic Differences in Monozygotic Twins with NF1 PRINCIPAL INVESTIGATOR: Elizabeth K. Schorry, M.D. CONTRACTING ORGANIZATION: Cincinnati Children's
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
More informationGenetic mates SNPedia write-ups Final Next-gen sequencing Mike Snyder QA: new technology and the future
Genetic mates SNPedia write-ups Final Next-gen sequencing Mike Snyder QA: new technology and the future Genetic Mates Jonathan Mortensen/Francisco Gimenez Will need class to upload data Tuesday night Analyze
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationA genome-wide association study identifies vitiligo
A genome-wide association study identifies vitiligo susceptibility loci at MHC and 6q27 Supplementary Materials Index Supplementary Figure 1 The principal components analysis (PCA) of 2,546 GWAS samples
More informationDevelopmental Psychology 2017
Developmental Psychology 2017 Table of Contents Lecture Notes pp. 2-29 Theorists, Theories & Evaluation pp. 29 36 Revision Questions (for all lectures) pp. 36-54 Lecture Notes Intro to Development Development
More informationClinical evaluation of microarray data
Clinical evaluation of microarray data David Amor 19 th June 2011 Single base change Microarrays 3-4Mb What is a microarray? Up to 10 6 bits of Information!! Highly multiplexed FISH hybridisations. Microarray
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature13394 Genome sequencing identifies major causes of severe intellectual disability Table of Contents Participants...4 Patient recruitment... 4 Patient selection... 4 Cohort representativeness...
More informationPERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST
INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED
More informationToday s Topics. Cracking the Genetic Code. The Process of Genetic Transmission. The Process of Genetic Transmission. Genes
Today s Topics Mechanisms of Heredity Biology of Heredity Genetic Disorders Research Methods in Behavioral Genetics Gene x Environment Interactions The Process of Genetic Transmission Genes: segments of
More informationGenetics and Genomics: Applications to Developmental Disability
Tuesday, 12:30 2:00, B1 Objective: Genetics and Genomics: Applications to Developmental Disability Helga Toriello 616-234-2712 toriello@msu.edu Identify advances in clinical assessment and management of
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationProblem 3: Simulated Rheumatoid Arthritis Data
Problem 3: Simulated Rheumatoid Arthritis Data Michael B Miller Michael Li Gregg Lind Soon-Young Jang The plan
More informationChapter 7: Pedigree Analysis B I O L O G Y
Name Date Period Chapter 7: Pedigree Analysis B I O L O G Y Introduction: A pedigree is a diagram of family relationships that uses symbols to represent people and lines to represent genetic relationships.
More informationNo mutations were identified.
Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123
More informationPhenotype Report. Num. Positions Not Called (Missing data) Num. Variants Assessed
Report Date: August 19, 2015 Software Annotation Version: 8 Report Name: NA12144 NW European Genome : NA12144_S1 Sequencing Provider: Illumina Sequencing Type: Exome : Retinitis Pigmentosa Description:
More informationRNA sequencing of cancer reveals novel splicing alterations
RNA sequencing of cancer reveals novel splicing alterations Jeyanthy Eswaran, Anelia Horvath, Sucheta Godbole, Sirigiri Divijendra Reddy, Prakriti Mudvari, Kazufumi Ohshiro, Dinesh Cyanam, Sujit Nair,
More informationThe Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician
The Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician Part VII Recent Advances in the Genetics of Autism Spectrum Disorders Abha R. Gupta, MD, PhD Jointly
More informationChapter 1 : Genetics 101
Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic
More informationp.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
More informationCHAPTER IV RESULTS Microcephaly General description
47 CHAPTER IV RESULTS 4.1. Microcephaly 4.1.1. General description This study found that from a previous study of 527 individuals with MR, 48 (23 female and 25 male) unrelated individuals were identified
More informationSupplemental Data. Integrating omics and alternative splicing i reveals insights i into grape response to high temperature
Supplemental Data Integrating omics and alternative splicing i reveals insights i into grape response to high temperature Jianfu Jiang 1, Xinna Liu 1, Guotian Liu, Chonghuih Liu*, Shaohuah Li*, and Lijun
More informationGenetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance
Genetics Review Alleles These two different versions of gene A create a condition known as heterozygous. Only the dominant allele (A) will be expressed. When both chromosomes have identical copies of the
More informationCancer Genomics. Nic Waddell. Winter School in Mathematical and Computational Biology. July th
Cancer Genomics Nic Waddell Winter School in Mathematical and Computational Biology 6th July 2015 Time Line of Key Events in Cancer Genomics Michael R. Stratton Science 2011;331:1553-1558 The Cancer Genome
More informationSupplementary Information. Data Identifies FAN1 at 15q13.3 as a Susceptibility. Gene for Schizophrenia and Autism
Supplementary Information A Scan-Statistic Based Analysis of Exome Sequencing Data Identifies FAN1 at 15q13.3 as a Susceptibility Gene for Schizophrenia and Autism Iuliana Ionita-Laza 1,, Bin Xu 2, Vlad
More informationVARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN
VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN Email: apatwardhan@personalis.com MICHAEL CLARK Email: michael.clark@personalis.com ALEX MORGAN Email:
More informationIntroduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016
Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases
More informationChromosome Abnormalities
Chromosome Abnormalities Chromosomal abnormalities vs. molecular mutations Simply a matter of size Chromosomal abnormalities are big errors Two types of abnormalities 1. Constitutional problem present
More informationMOLECULAR DIAGNOSIS for X-LINKED INTELLECTUAL DISABILITY
MOLECULAR DIAGNOSIS for X-LINKED INTELLECTUAL DISABILITY Intellectual disability (ID) or mental retardation is characterized by significant limitations in cognitive abilities and social/behavioral adaptive
More informationNovember 9, Johns Hopkins School of Medicine, Baltimore, MD,
Fast detection of de-novo copy number variants from case-parent SNP arrays identifies a deletion on chromosome 7p14.1 associated with non-syndromic isolated cleft lip/palate Samuel G. Younkin 1, Robert
More informationGenetics Practice Questions
Name: ate: 1. If Jessica has light eyes (bb) and both of her parents have dark eyes (b) which statement is true?. Jessica inherited both genes from her father.. Jessica inherited both genes from her mother..
More informationConcurrent Practical Session ACMG Classification
Variant Effect Prediction Training Course 6-8 November 2017 Prague, Czech Republic Concurrent Practical Session ACMG Classification Andreas Laner / Anna Benet-Pagès 1 Content 1. Background... 3 2. Aim
More informationRebecca Muhle, M.D. Ph.D. Yale Child Study Center Yale University The Autism Center Hospital for Special Care
Genetic Work-Up of Autism Spectrum Disorder in a Clinical Setting Rebecca Muhle, M.D. Ph.D. Yale Child Study Center Yale University The Autism Center Hospital for Special Care Disclosures statement I have
More informationHuman Genetic Disorders
Human Genetic Disorders HOMOLOGOUS CHROMOSOMES Human somatic cells have 23 pairs of homologous chromosomes 23 are inherited from the mother and 23 from the father HOMOLOGOUS CHROMOSOMES Autosomes o Are
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationGenome. Institute. GenomeVIP: A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud. R. Jay Mashl.
GenomeVIP: the Genome Institute at Washington University A Genomics Analysis Pipeline for Cloud Computing with Germline and Somatic Calling on Amazon s Cloud R. Jay Mashl October 20, 2014 Turnkey Variant
More informationCloning and types of reproduction
Friday 9 th January 2015 Cloning and types of reproduction B1.7.2 All cells (excepts sperm/egg) contain chromosomes Sperm fertilises an egg Embryo/baby ( chromosomes) + ( chromosomes) ( chromosomes) All
More informationPage 1. Name:
Name: 4734-1 - Page 1 Warts result when certain viruses cause skin cells to reproduce at a high rate. This rapid reproduction of skin cells is due to the viruses stimulating cellular digestion mitotic
More informationISPG Residency Education Taskforce
ISPG Residency Education Taskforce What does genetics have to do with psychiatry? - psychiatric illnesses run in families - the major psychiatric disorders have a high heritability - specific genes may
More informationInsights into the origin of DNA methylation differences between monozygotic twins discordant for schizophrenia
Melka et al. Journal of Molecular Psychiatry (2015) 3:7 DOI 10.1186/s40303-015-0013-5 JMP RESEARCH ARTICLE Open Access Insights into the origin of DNA methylation differences between monozygotic twins
More informationRNA-mediated paternal heredity of diet-induced obesity and metabolic disorders
RNA-mediated paternal heredity of diet-induced obesity and metabolic disorders Valérie Grandjean 1,2,3 $, Sandra Fourré 4, Diana Andrea Fernandes De Abreu 5, Marie-Alix Derieppe 1,2,3, Jean-Jacques Remy
More informationGenetic Variation Junior Science
2018 Version Genetic Variation Junior Science http://img.publishthis.com/images/bookmarkimages/2015/05/d/5/c/d5cf017fb4f7e46e1c21b874472ea7d1_bookmarkimage_620x480_xlarge_original_1.jpg Sexual Reproduction
More informationSupplementary results
doi:1.138/nature946 Supplementary results Effects of rearrangements on protein coding genes Genomic instability drives cancer development through effects on genes, such as copy number changes, internal
More informationIntroduction to linkage and family based designs to study the genetic epidemiology of complex traits. Harold Snieder
Introduction to linkage and family based designs to study the genetic epidemiology of complex traits Harold Snieder Overview of presentation Designs: population vs. family based Mendelian vs. complex diseases/traits
More informationVictor Guryev. European Research Institute for the Biology of Ageing
Victor Guryev European Research Institute for the Biology of Ageing September 29, 2014 Genomic resequencing in Medical diagnostics course Erasmus MC, Rotterdam /a /g Low coverage whole genome and deep
More informationSupplementary Figure 1 Maturation arrest in bone marrow smears from a JAGN1-deficient patient (P4).
Supplementary Figure 1 Maturation arrest in bone marrow smears from a JAGN1-deficient patient (P4). JAGN1-deficient patients in this study showed (sometimes intermittently, as in this figure) signs of
More informationThe study of hereditary traits
Hereditary traits The study of hereditary traits Traits determined by phenotypic expression of one or several genes, ± interaction with environment factors; The weight of hereditary factors in phenotype
More informationSupplemental Data. De Novo Truncating Mutations in WASF1. Cause Intellectual Disability with Seizures
The American Journal of Human Genetics, Volume 13 Supplemental Data De Novo Truncating Mutations in WASF1 Cause Intellectual Disability with Seizures Yoko Ito, Keren J. Carss, Sofia T. Duarte, Taila Hartley,
More informationLab Activity 36. Principles of Heredity. Portland Community College BI 233
Lab Activity 36 Principles of Heredity Portland Community College BI 233 Terminology of Chromosomes Homologous chromosomes: A pair, of which you get one from mom, and one from dad. Example: the pair of
More informationS U M M E R R E S E A R C H I N T E R N S H I P P R O G R A M
2 0 11 S U M M E R R E S E A R C H I N T E R N S H I P P R O G R A M P O S T E R P R E S E N TAT I O N A B S T R A C T B O O K 2011 Summer Research Internship Program This program was started to provide
More information22q11.2 DELETION SYNDROME. Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona)
22q11.2 DELETION SYNDROME Anna Mª Cueto González Clinical Geneticist Programa de Medicina Molecular y Genética Hospital Vall d Hebrón (Barcelona) Genomic disorders GENOMICS DISORDERS refers to those diseases
More informationGenetics and Diversity Punnett Squares
Genetics and Diversity Punnett Squares 1 OUTCOME QUESTION(S): S1-1-12: How are the features of the parents inherited to create unique offspring? Vocabulary & Concepts Allele Dominant Recessive Genotype
More informationSupplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationTOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist
TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY Giuseppe Narzisi, PhD Bioinformatics Scientist July 29, 2014 Micro-Assembly Approach to detect INDELs 2 Outline 1 Detecting INDELs:
More informationThe 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients
The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients Dr Richard Scott, Clinical Lead for Rare Disease Dr Nirupa Murugaesu, Clinical Lead for Cancer Four
More informationExome sequencing supports a de novo mutational paradigm for schizophrenia
Supplementary Information Exome sequencing supports a de novo mutational paradigm for schizophrenia Bin Xu 1,2, J. Louw Roos 3, Phillip Dexheimer 4, Braden Boone 4, Brooks Plummer 4, Shawn Levy 4, Joseph
More informationCongenital Heart Disease How much of it is genetic?
Congenital Heart Disease How much of it is genetic? Stephen Robertson Curekids Professor of Paediatric Genetics Dunedin School of Medicine University of Otago Congenital Heart Disease The most common survivable
More informationPerformance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
More informationFigure S1. Analysis of endo-sirna targets in different microarray datasets. The
Supplemental Figures: Figure S1. Analysis of endo-sirna targets in different microarray datasets. The percentage of each array dataset that were predicted endo-sirna targets according to the Ambros dataset
More informationPedigree Analysis. Genetic disorders. Dominant inheritance. Recessive inheritance. Autosomal vs. sex-linked traits. X-linked recessive inheritance
Genetic disorders 4.2 Errors During Meiosis 5.3 Following Patterns of Human nheritance Pedigree Analysis 2005 Lee Bardwell Autosomal vs. sex-linked traits Autosomal traits are caused by genes on autosomes
More informationBelow, we included the point-to-point response to the comments of both reviewers.
To the Editor and Reviewers: We would like to thank the editor and reviewers for careful reading, and constructive suggestions for our manuscript. According to comments from both reviewers, we have comprehensively
More informationUnit B2, B2.7. Cell division and inheritance. Stage 1. Ovary. Cell Q. Cell P. Cell R. Cell S. 7 Embryo A B C
Cell division and inheritance 1. A woman gives birth to triplets. Two of the triplets are boys and the third is a girl. The triplets developed from two egg cells released from the ovary at the same time.
More informationSupplemental Data. Genome-wide Association of Copy-Number Variation. Reveals an Association between Short Stature
The American Journal of Human Genetics, Volume 89 Supplemental Data Genome-wide Association of Copy-Number Variation Reveals an Association between Short Stature and the Presence of Low-Frequency Genomic
More informationSupplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
More informationSCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab
SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More information