Silencing Oncogene E6/E7 in HeLa Sphere Forming Cells Inhibits Their Growth. and Decreases Self-renewal Gene TGF-β Expression

Transcription

1 Silencing Oncogene E6/E7 in HeLa Sphere Forming Cells Inhibits Their Growth and Decreases Self-renewal Gene TGF-β Expression Wenyi Gu 1*, Eliza Yeo 2, Fabio Petrocca 3, Nigel McMillan 2, and Chengzhong Yu 1* 1 "Australian"Institute"for"Bioengineering"and"Nanotechnology; 2 Diamantina Institute for Cancer, Immunology and Metabolic Medicine, University of Queensland, Brisbane, Australia. 3. Harvard Medical School, Harvard University, Boston, MA USA. *Corresponding author: Address:"Australian"Institute"for"Bioengineering"and"Nanotechnology,"The"corner"of"Cooper"Rd."St"Lucia" Campus,"The"University"of"Queensland,"Brisbane"QLD"4102,"Australia" Tel:"61K7K "(WG);"61K7K336"63283"(MY) Fax: w.gu@uq.edu.au (WG); c.yu@uq.eud.au (MY). Running title: silencing oncogenes in HeLa spherical cells Abbreviations: CSCs: cancer stem cells; HPV: Human Papillomaviruses; shrna: short-hairpin RNA; SFCs: sphere forming cells; TGF-β: Beta transformation growth factor.

2 Abstract:) Cancer stem cells (CSCs) are believed responsible for the tumor initiation and the resistance to current cancer therapies such as chemo- and radio- therapy, which also lead to tumor recurrences and metastasis. By using a 3-D sphere culture method that favors the growth of self-renewal cells, we have successfully isolated sphere forming cells (SFCs) from cervical cancer HeLa and SiHa cells. It is found that HeLa SFCs have CSCs-like nature. The HeLa SFCs are resistant to chemotherapeutic drugs such as cisplatin, doxorubicin, and epitoside. Moreover, HeLa SFCs can grow tumors after injection of 10,000 cells to NOD/SCID mice, whereas growing such tumors in the same time frame needs 1 x 10 6 parental HeLa cells. In addition, in vitro and in the presence of fetal calf serum, HeLa SFCs can form more and bigger colonies than their parental cells; and the differentiated SFCs become sensitive to cisplatin and doxorubicin. The HeLa SFCs show an expression pattern of CD44 high /CD24 low at cell surface that resembles the biomarker of breast CSCs as reported. We further demonstrate that HeLa- SFCs express different levels of E6/E7 genes compared to their parental HeLa cells, and the RNAi mediated gene silence of E6/E7 profoundly inhibits their cell growth and sphere formation. We have measured the self-renewal genes TGF-β and LIF expressions in HeLa SFCs and found that only TGF-β has been down-regulated after E6/E7 gene silencing, suggesting a possible new approach for the targeted cancer therapy of CSCs. Key words: HeLa cells, Cervical cancer, Sphere forming cells, Cancer stem cells, Self-renewal, TGF-β, HPV E6/E7, RNA interference, Lentiviral shrna.

3 Introduction:) The concept of cancer stem cells (CSCs) describes that tumors contain a small proportion (1-20%) of self renewal and pluri-potency cancer cells that are responsible for tumor initiation and maintenance [1]. The expression of multiple drug resistant gene (MDR1) [2] and ABC (ATP binding cassette) transporter [3, 4] can also protect CSCs from cytotoxic drugs. Therefore, CSCs offer an attractive target for developing more effective cancer therapies or an additional treatment to improve the current cancer therapies. However, as these cells are multi-drug resistant and also resistant to most current therapies, new approaches for the treatment of CSCs are required. RNA interference (RNAi) technique has been widely used as a tool for gene functional studies and also shows a great potential for developing therapies against viral infection, genetic disorders, and cancers [5-9]. There are several RNAi therapies already in clinical applications while many more in clinical trials (Ref?). For RNAi-based cancer therapy, oncogenes are obviously ideal targets as they are the driving force of cancer cell growth ([10] [11, 12]). Although it is still not clear if oncogene expression in CSCs would be different from that in differentiated cancer cells, it is assured that these genes are still essential in the growth of CSCs. Therefore, targeting oncogenes of CSCs for cell-population targeted therapy may offer new approaches to more effective cancer therapies. There are numerous studies on RNAi based cancer therapy targeting oncogenes in various types of cancers; for examples, targeting E6 and E7 for cervical cancer [13-16] and targeting Her-2 [17], c-myc [18], and hdm-2 [19] for breast cancer. However, there is no report on RNAi based oncogene silence for CSCs. Human cervical carcinoma is the second most common cancer in woman worldwide and highly (99%) associated with the infection of high risk types of human papillomaviruses (HPV). Viral early gene E6 and E7 from high risk HPV types are responsible for the transformation of the epithelial cells and their continuous expression is essential for ongoing cervical cancer cell survival as they function as oncogenes [20] [21]. Therefore, oncogenes E6 and E7 are ideal targets for RNAi therapy. In recent

4 years, there are a number of publications showing the potential use of RNAi as a treatment for cervical cancer [14-16, 22-26]. More recently, we demonstrated that RNAi triggered by shrna targeting at the proper site of E7 mrna could even induce immunity to E7 in immune competent mice [27]. All the data indicate that RNAi based therapy can be developed as a promising treatment for cervical cancer. However, until now no treatment for cervical cancer has yet been developed for clinical use or even for clinical trial. Besides the challenge in the development of a safe in vivo delivery system, the effectiveness of RNAi itself as a mono-therapy to treat cervical cancer patients, especially at late clinic and metastasis stages, is unknown. In addition, whether CSCs are sensitive to RNAi treatment has not been investigated. This is a challenging question and will provide potentially strategic solution in cancer therapy. For example, if RNAi-based therapy will kill not only differentiated cancer cells but also CSCs, it will be promising to use the RNAi-based therapy as a sole treatment, or to couple it as an additional therapy with chemotherapy or radiotherapy. In this study, we used cervical cancer as a model to investigate the efficiency of RNAi therapy towards cervical CSCs. Using a sphere culture method which has been used to effectively isolate or enrich selfrenewal CSCs from mammary tissues [28], primary tumors or cancer cell lines [29, 30]; [31]; [32], sphere forming cells (SFCs) were isolated from cervical cancer cell lines. It was characterized that the HeLa SFCs showed CSCs-like nature. Our data indicated that the HeLa SFCs were more tumourigenic than the parental HeLa cells, expressed a biomarker of CD44 high /CD24 low, and were multi-drug resistant. We further demonstrated that these cells were sensitive to E6/E7 silence evidenced by the profound inhibition of their cell growth and sphere formation. We also showed that this effect was probably through the decease of the self-renewal ability modulated by TGF-β. This study shows a possible new approach for RNAi cancer therapy targeting CSCs.

5 Materials)and)Methods:) Cervical cancer cell lines and sphere culture: Cervical cancer cell lines HeLa, CaSki, SiHa, and C33A were maintained in complete Dulbecco s Modified Eagles Medium (DMEM, Invitrogen, Australia) as described [15]. The sphere culture medium was prepared as previously described [28]. For the first passage of sphere culture, 2 x 10 4 cancer cells were seeded into a T75 flask with 20 ml of sphere culture medium. Cells were cultured in suspension condition (gentle shake twice a day) for 4 days at 37ºC. Additional 10 ml of sphere culture medium was added to the culture on day 4 and the culture continued for another 4-5 days. The spheres were harvested by centrifugation at 300x g for 5 minutes and sphere numbers were diluted and counted. For the second or following passage sphere culture, the spheres were treated with 1:1 diluted trypsin (2.5% Trypsin-EDTA, Invitrogen, Australia) for 5 minutes at 37 o C and washed with sphere culture medium. Spherical cells were separated by repeating pipette and pass through a cell strainer (40 µm, BD, Australia). The separated cells were then used for continuous culture or other assays. Drug treatment, cell staining, and fluorescence microscopy Chemotherapeutic drugs cisplantin (CIS), doxyrubincin (DOX), and epitoside (EPI) were purchased from Sigma-Aldrich (Australia). The working concentrations of these drugs in HeLa cells were: CIS (1-2 µg/ml); DOX ( µg/ml); and EPI (0.5 µg/ml) at which they could kill >80% HeLa cells in hours. Estrogenic hormone 17-bata estradiol (E2) was also purchased from Sigma. The working concentration was 5 µg/ml in both HeLa cell treatment and sphere culture. For FACS analysis, the cells harvested or dispersed from culture were stained with antibodies (to CD44 conjugated with FITC and CD24 conjugated with RPE, Invitrogen) and were washed with 1%FCS/PBS then fixed with 2% PFA/PBS for FACS analysis using FACS Calibur or FACS Canto (BD). Or the fixed cells were span

6 on the slide by Cytospin 4 (Thermo Shandon) for fluorescent microscopy examination. Before the examination the cells on the slide were mounted with Fluoroshield TM with DAPI mount medium (Sigma-Aldrich, Australia). Animal experiment: HeLa or HeLa-SFC cells were trypsinized, washed, and re-suspended in PBS at different cell concentrations. Female NOD/SICD mice of 6-8 weeks were used and were subcutaneously injected (3 mice/group) with 50 µl cell suspensions to the neck scruff. The tumors were monitored and dissected at 22 days post-injection for count and measuring sizes. The animal experiment was approved by the University of Queensland animal ethics committee. Colony forming assay: HeLa cells and HeLa-SFC were harvested as above and counted. One hundred cells were seeded in each well of 12-well plates with 1 ml complete DMEM, each group had 3 repeats. The cells were cultured for 7 days and then fixed with 1ml 95% ethanol for 30 mins at room temperature and stained with 0.5 ml 0.1% crystal violet for 5 mins. The colony was counted for each well. Transduction of HeLa cells with lentivirus-shrna (LV-shRNA): The procedure of transduction of HeLa cells with LV-shRNA were as previously described [15]. LVshRNA 18E6-1 was effective shrna at silencing E6/E7 genes [15] while LV-shRNA 16E7-2 was an ineffective shrna [27] and was used as shrna control in this study.

7 Real-time RT-PCR: Total RNA extraction from transduced HeLa and HeLa-SFC was as instructed by the manufacturer using TRIzol reagent (Invitrogen, Australia). Reverse transcription reactions were performed with oligo-dt primer using the High Capacity cdna RT Kit (Applied Biosystems). Real-time PCR was carried out with SYBR green master mixture (Promega) using a Rotor-Gene RG-3000 (Corbett Research, Australia) with the program pre-heating 95 o C 10min; then 40 cycles of 94 o C 15 sec; 58 o C 30 sec; and 72 o C 45 sec. The primers were: HPV 18E7: F 5 -AAAATGAAATTCCGGTTGA, R 5 - GGCTGGTAAATGTTGATGAT; HPV 18E6: F 5 -CTGTGCACGGAACTGAACAC, R 5 -TGC AGCATGGGGTATACTGT; TGF-β-1: F 5 -CAACAATTCCTGGCGATACC, R 5 -GAACCCG TTGATGTCCACTT; TGF-β-2: F 5 -GAGTGCCTGAACAACGGATT, R 5 -TGCAGCAGGGACA GTGTAAG; TGF-β-3: F 5 -GCAACTTGGAGGAGAACTGC, R 5 -CTGTGGGTTGTGTCTGC ACT; LIF: F 5 -CCCTGTCGCTCTCTAAGCAC, R 5 -ATCCTGGACAAGGGTGAGTG; E- cardiherin: F 5 -CGACCCAACCCAAGAATCTA, R 5 -AGGCTGTGCCTTCCTACAGA; H-Ras: F 5 -GTGGTCATTGATGGGGAGAC, R 5 -ACGTCATCCGAGTCCTTCAC; and K-Ras: F 5 -TGT CAAGCTCAGCACAATCTG, R 5 -GGTAGGGAGGCAAGATGACA. The internal control was 18s rdna (F: 5 -CCATCGAACGTCTGCCCTA; R: 5 -TCACCCGTGGTCACCATG) and it was also used to normalize other gene expressions. Micro-RNA (mirna) detection: mirnas were measured using q-pcr as previously described [29]. RNA extraction and reverse transcription reactions with Taqman microrna reverse transcription"were carried out following the instructions of the manufacturer, Applied Biosystems. The mirna assay kits and Taqman 2X

8 universal PCR master mix"were all purchased from AB. RNU6B was assayed each time as the internal control and was used to normalize the relative expression of each mirna. Data analysis Data collected from each (experimental and control) group were expressed as mean ± SD. The unpaired t-test (in Prism program) was used to analyze the differences and discriminate the significant differences (two-tails, P<0.05) between experimental and control groups. Results:) " 1. Sphere culture of cervical cancer cell lines We screened four different cervical cancer cell lines, HeLa (HPV 18+), SiHa (HPV 16+), CasKi (HPV 16+), and C33A (HPV negative) for their sphere formation abilities using sphere culture method. Sphere formation was found in HeLa and SiHa cell lines but not in CasKi and C33A. For HeLa cells purchased from ATCC, at their early passages they could form 15-20% spheres; after continuous culture for 3-4 months in the laboratory their sphere formation ability reduced to 6%. We chose HeLa cell line for the following studies. HeLa spheres were compacted cell clusters (Fig 1, A-C) but the cells in the sphere (sphere forming cells, SFC, Fig.1D) can be separated by trpsinization and repeating pipette for further sphere culture. Morphological examination of the cell surface by scanning electronic microscopy showed that there were lots protrudes on these SFC while parental HeLa cell surfaces were much smooth (suppl. Fig 1). Previous studies showed that breast CSCs from mammo spheres exhibited a surface marker of high

9 CD44 and low CD24 [29, 33], we thus examined CD44 and CD24 expression of HeLa-SFC. The result showed that HeLa-SFC were also CD44 positive and CD24 lower while parental HeLa cells were CD44 negative and CD24 strong positive (Fig 1E), the same pattern as breast CSCs. In the physical condition, cervical cell growth is influenced by female hormones (eg. estrogen). To examine if estrogen would affect HeLa sphere growth or formation, we treated HeLa cells with E2 and then cultured the cells in sphere cultural medium with or without E2. The results showed that estrogen treatment increased HeLa sphere formation and the presence of E2 also seems to promote sphere formation (Fig 2A). 2. Tumorigenicity and drug-resistance of HeLa SFC To examine if HeLa-SFC are more tumourigenic, we subcutaneously injected the cells to NOD/SCID mice at different dosages, where parental HeLa cells were also injected as control. In HeLa-SFC group, 1 x 10 4 cells could form tumors in 3 weeks whereas 1 x 10 6 parental cells were needed to grow tumors in the same time frame, suggesting the HeLa-SFC are more ( x) tumourigenic than their parental HeLa cells (Table 1) and the sphere culture has enriched tumor initiating cells or CSCs. To test if HeLa-SFC are multi-drug resistant, the cells were cultured in the presence of 3 clinically used chemotherapeutic drugs at the working concentrations that kill most HeLa cells. However, the presence of these drugs seemed not affect SFC sphere formation and growth (Table 2), suggesting HeLa-SFC are multi-drug resistant. HeLa-SFC were then cultured in complete DMEM medium containing fetal calf serum, these cells quickly grew into HeLa cell morphology (Fig 2B) and became sensitive to the same drug treatments (Fig 2C). This result suggests that after differentiation these cells exhibit some features of differentiated HeLa cells. Moreover, when they were cultured in complete DMEM medium, HeLa- SFC could form more and bigger colonies than HeLa cells (Fig 2D, E). In addition, these cells expressed lower level of let-7a and higher level of mir-293, suggesting a stem cell-like mirna profile (Suppl. Fig 3). Taken together, above data indicate that HeLa-SPC resemble some features of CSCs.

10 3. Silencing E6/E7 profoundly affects cell growth and sphere formation of HeLa-SFC: Although studies have shown that silencing E6/E7 oncogenes in cervical cancer cells can significantly inhibit cancer cell growth and induce apoptosis or senescence [13]; [14]; [15], whether cervical CSCs would be sensitive to oncogene silencing is unknown. As HeLa-SFC exhint some charactors of CSCs, we would like to investigate how E6/E7 gene silence would s affect theri growth and sphere formation. To achive this, we firstly examined the E6 and E7 expression in HeLa-SFC. As expected, HeLa-SFC were positive for both E6 and E7. However, to our surprise, HeLa-SFC express 6.9-fold more E6 than HeLa cells whereas there was no significant difference on E7 expression (Fig 3A). This result reveals that tumurigenic cancer cells may have a different oncogene expression profile as differnetiated cancer cells. This result also endorse us investgate if HeLa-SFC are sentivie to E6/E7 gene silence. Using a published lentiviral-shrna 18E6-1 [15] we showed that silencing E6/E7 in HeLa-SFC could significantly inhibit their sphere formation and cell growth (Fig 3B). Sphere formation represents the self-renewal ability of the cells, this data suggest that E6/E7 may have a profound impact on SFC growth, which promotes further investigations on the possibility of developing this as CSCs targeted cancer therapy and further investigation on the mechanism of how this happened at the molecular level. To further conform this, we measured egfp expression in the SFC by both fluorescent microscopy and FACS. Figure 3C shows that majority of SFC were GFP positive, confirming that the SFC were transduced by lentiviral vector. To confirm the gene silent effect, we also measure E6/E7 expression levels in transduced HeLa-SFC, the results proved that transduced HeLa-SFC had lower E6 and E7 levels (Fig 4A). It was observed that the lentiviral vector itself had non-specific effect on sphere growth and formation (Table 3). However, compared with non-specific control 16E7-2, the 18E6-1 gene silencing effect was more dramatic and the inhibitory effect was more dramatic on SFC growth (the

11 number of SFC) rather than sphere formation (sphere numbers). This result suggests that silencing E6/E7 in HeLa SFCs have more profound effect on the cell growth than direct killing of the cells. 4. Silencing E6/E7 down-regulates self-renewal gene expression in HeLa-SFC TGF-β and LIF (leukemia inhibitor factor) were well-known self-renewal genes for stem cells. TGF-β was also shown to increase self-renewal ability of CSCs [34, 35]. To understand how E6/E7 silencing would affect HeLa-SFC growth and sphere formation, we examined self-renewal genes expressions in LV-shRNA transduced HeLa-SFC cells. The real-time PCR results showed that three TGF-β isoforms all showed a decreased mrna level of gene expression (Fig 4B). In contrast, LIF gene did not decrease, suggesting that after E6/E7 silence the self-renewing ability of SFC was decreased by particularly targeting TGF-β gene but not all self-renewal genes, which may lead to smaller spheres (Fig 4C). To further investigate if the decreased TGF-β levels would also affect closely related oncogene expression we measured human Ras gene levels in the transduced in cells. However, no remarkable changes were seen in both H-Ras and K-Ras expression (Suppl. Fig 4), suggesting that in this particular case, TGF-β may not directly regulate Ras expressions. To investigate if knocking down of E6/E7 would also affect the adhere molecules of HeLa-SFC we measured E-cadherein mrna levels in the cells, which was shown to be important in EMT and closely related to cancer cell invasion [36]. The results indicated that there is no notable difference between the experimental and control groups (Fig 4D). However, we noticed that the levels for both groups were too low thus might have not reflected the difference (Fig 4D).

12 Discussion:)) More and more evidence support the concept that CSCs are responsible for tumor recurrence and metastasis. Therefore, targeting CSCs may offer an advanced and effective cancer therapy. However, since CSCs are multi-drug resistant and also resistant to other conventional therapies, alternative approaches toward stopping their growth are essential. RNAi-based therapies have shown a great potential in treating diseases like viral infections, genetic disorders and cancers. In this study, we investigated whether silencing oncogenes in cervical cancer stem-like cells would significantly affect their growth and self-renewal. Our results indicated that at least in this cancer model, silencing oncogenes E6/E7 had significant effect on their growth and sphere formation. We also showed that the inhibition effect was probably through the down-regulation of the self-renewal gene TGF-β. To our knowledge, this is the first report showing that silencing oncogenes of cancer stem-like cells can significantly affects their growth and sphere formation via the self-renewal pathway. Further investigation could include whether oncogene silence would affect HeLa-SFC tumor formation and metastasis in animal models to further assess its clinical potential. The implication of this study is not only to cervical cancer but maybe also to other cancers. We previously showed that silence of E6/E7 with a LV-shRNA could effectively inhibit HeLa cells growth both in vitro and in vivo and significantly decrease the number of lung metastatic tumor nodules in a mouse model [15]. From the current results it is assumed that the LV-shRNA had targeted CSCs in the previous study, especially in the lung metastasis model, it inhibited tumor formation from CSCs. While the final result of tumor inhibition was good the total inhibition of tumor growth needs 4 x does of lentiviral shrna, which is hardly achieved by other delivery systems and the side effect was also severe [15]. To improve the effectiveness of this kind therapy, it is postulated that a combinational therapy with chemotherapy followed by RNAi therapy targeting CSCs would result in a better outcome.

13 TGF-β is a protein family that involves different cellular aspects such as cell survival, proliferation, differentiation and adhesion [37, 38]. TGF-β was reported to be an important self-renewal factor for embryonic stem cells [39] and to promote CSCs self-renewal [34] and increase the self-renewal ability of glioma-initiating cells [35]. In the current study, we observed that after silence of E6/E7 all three isoforms of TGF-β significantly decreased in these transduced HeLa cells whereas another self-renewal gene LIF did not change. This suggests that silence of E6/E7 may have a specific effect on TGF-β expression. As TGF-β isoforms are believed to play a slight different roles in different cancers [40], this results suggest that silencing E6/E7 might have activated a very general mechanism that downregulate 3 isoforms of TGF-β expression. But how this happened is still not clear. One possible link between them is that E6 and E7 are involved in promoting cancer cell growth through PI3K/Akt pathway [41, 42] and reducing apoptosis through p53 pathway [20, 43]. TGF-β also promotes CSCs growth and one of its downstream targets is PI3K/Akt [44]. This link could indirectly affect TGF-β expression after E6/E7 levels decreased and needs further investigations. A previous study showed that TGF-β regulate self-renewal of giloma-initiating cells (or CSCs) through LIF [35]. In the current study, we measured LIF expression level but did not observed any decrease of LIF, suggesting that alternative pathway may be involved in our case in the HeLa-SFC. In this study, we enriched cancer stem-like cells from cervical cancer cell lines using the sphere culture method. A few recent publications also demonstrated that cells isolated from different cancers using this method are multi-drug resistant, more tumourigenic, and more metastatic [29, 45, 46], indicating the potential usefulness of this method in CSCs enrichment or isolation. Moreover, because this method does not involve cell sorting procedure, it may have some advantages over the side population (SP) and surface mark sorting methods on limiting extra stimulation to the cells. In addition, as this method is selective for self-renewal ability, a definitive character of stem cells [47], it will have better chance to isolate CSCs.

14 Since CSCs were enriched from not only primary tumors but also cancer cell lines [30]; [31]; [32] as did in the current study, it is believed that at least some cancer cell lines contain self-renewal progenitor cancer cells or CSCs. In HeLa cells, the early passage cells from ATCC seem have higher sphere formation ability and the ability decreases as the passage number much increases. This reflects the fact that tumors or freshly established cell lines may contain more progenitor cancer cells or CSCs. From this point of view, isolation of CSCs from primary tumors may have advantages. However, comparing with direct isolation from tumors, cancer cell lines also have some other advantages as it may be not affected by the tumor grade (development stage), histo-pathological types, location (centre or periphery), and treatment status (Chemotherapy/radiotherapy /other therapy). In addition, it can avoid possible contaminations of other stem cells. Another advantage of isolating CSCs from cancer cell lines, as shown in the current study, is that the increase of enrichment efficiency of CSCs can be easily achieved by treating the cell lines with chemotherapeutic drugs. It has been reported that drug treatment could enrich CSCs both in vitro and in vivo [29, 46]. In this study, we showed that different drugs have different abilities to achieve enrichment (Suppl. Fig 2A). The underline mechanism is not clear but it seems to be related to increased CD44 expression. In this study, we show that drug-resistant cells are also expressing higher level of CD44 (Suppl. Fig 2B). Apart from the drug treatment, in cervical cancer, hormone treatment could also increase sphere formation rate, suggesting estrogen may play an important role in promoting cancer cell self-renewing and sphere formation. It is known that E2 has a biological function to promote carcinogenesis in ovarian cancer [48], cervical cancer [49] and even breast cancer [50]. If estrogen plays such a promotion role in CSC growth and sphere formation (self-renewal) as shown in the current study, it will at least partially explain why estrogen can promote tumor progression. For cervical cancer HeLa cells, a previous study showed that estrogen treatment of HeLa cells could promote the cell growth and proliferation and the treatment effect was shown to be through the oncogenes E6/E7 as HPV negative cancer cells did show the same effect [51]. This could be one of the reasons why

15 estrogen treatment will increase sphere formation and sphere growth of HeLa and also indicate that oncogenes E6/E7 are very important in CSC self-renewal and growth. Taken together all above results it suggests that CSCs can be enriched by chemo drugs and hormones and these factors are considered to all play important roles in CSC growth. From this result it is interesting to know if estrogen could increase the sphere formation ability of cell lines that are HPV negative but have estrogen receptors. To summarize, our study shows a new approach to target CSCs and it is effective. In cervical cancer model, at least, targeting oncogenes has also affected the self-renewal gene expressions of TGF-β. These pathways could be considered as new approach for advanced cancer therapy. CSC growth and sphere formation are influenced by drug treatment, and also estrogen influence. Further investigations in this direction may lead to better understanding of CSCs and better treatment targeting CSCs. Acknowledgements: The authors would like to acknowledge the financial supports of NHMRC (Peter Doherty Fellowship and Travelling Award to WG). We would also like to thank Prof. Judy Lieberman at Harvard Medical School for her support and technique help.

16 Table titles and notes: Table 1. Xeno-transplant tumor formation in NOD/SCID mice at 22 days after injection Groups 1 x 10 3 cells 1 x 10 4 cells 1 x 10 5 cells 1 x 10 6 cells HeLa SFC 0/3 2/3 3/3 ND HeLa 0/3 0/3 1/3 3/3 Table 2. HeLa sphere formation rates in the presence of the chemotherapeutic drugs Passage No. HeLa +CIS +EPT +ADR P1 20%""""""""""""""""""""""""""""19%"""""""""""""""""""""""""""""21%""""""""""""""""""""""""""""18.5%" P5 17.5%"""""""""""""""""""""""18.5%"""""""""""""""""""""""""""19%""""""""""""""""""""""""""""17.5%" Notes: The initial cell numbers plated into the culture were 2 x Sphere counting numbers were divided by the initial cell number for the sphere formation percentage. First (P1) and fifth (P5) generations of SFC were both tested.

17 Table 3. Silence of E6/E7 affect sphere formation and cell growth (ratio) Cell lines Total spheres Total SFC (x 10 4 ) Sphere % SFC/SP ratio HeLa 3650"±"95.7"""""""""""""75.5"±"1.96""""""""""""""""18.25"±"0.47"""""""""""207"±"5.74""" HeLa-16E "±"135.4"""""""""""58.9"±"1.57""""""""""""""""10.05"±"0.67*"""""""""295.3"±"14.58" HeLa-18E "±110.9*""""""""""16.9"±"1.27***""""""""""7.375"±"0.55*""""""""""115"±"7.79***"" Notes, The experiment was repeated 3-4 times and the data were mean ± SE. The initial cell numbers plated into the culture was 2 x *: P<0.05; ***: P<0.001.

18 References: 1.# Visvader,#J.E.#and#G.J.#Lindeman,#Cancer'stem'cells'in'solid'tumours:'accumulating'evidence'and' unresolved'questions.#nat#rev#cancer,#2008.#8(10):#p.#755a68.# 2.# Nakai,#E.,#et#al.,#Enhanced'MDR1'expression'and'chemoresistance'of'cancer'stem'cells'derived'from' glioblastoma.#cancer#invest,#2009.#27(9):#p.#901a8.# 3.# Lou,#H.#and#M.#Dean,#Targeted'therapy'for'cancer'stem'cells:'the'patched'pathway'and'ABC' transporters.#oncogene,#2007.#26(9):#p.#1357a60.# 4.# Kondo,#T.,#Stem'cellElike'cancer'cells'in'cancer'cell'lines.#Cancer#Biomark,#2007.#3(4A5):#p.#245A50.# 5.# Harper,#S.Q.,#et#al.,#RNA'interference'improves'motor'and'neuropathological'abnormalities'in'a' Huntington's'disease'mouse'model.#Proc#Natl#Acad#Sci#U#S#A,#2005.#102(16):#p.#5820A5.# 6.# Xia,#H.,#et#al.,#RNAi'suppresses'polyglutamineEinduced'neurodegeneration'in'a'model'of' spinocerebellar'ataxia.#nat#med,#2004.#10(8):#p.#816a20.# 7.# Qin,#X.F.,#et#al.,#Inhibiting'HIVE1'infection'in'human'T'cells'by'lentiviralEmediated'delivery'of'small' interfering'rna'against'ccr5.#proc#natl#acad#sci#u#s#a,#2003.#100(1):#p.#183a8.# 8.# Jacque,#J.M.,#K.#Triques,#and#M.#Stevenson,#Modulation'of'HIVE1'replication'by'RNA'interference.# Nature,#2002.#418(6896):#p.#435A8.# 9.# Schomber,#T.,#et#al.,#Gene'silencing'by'lentivirusEmediated'delivery'of'siRNA'in'human'CD34+'cells.# Blood,#2004.#103(12):#p.#4511A3.# 10.# Putral,#L.N.,#W.#Gu,#and#N.A.#McMillan,#RNA'interference'for'the'treatment'of'cancer.#Drug#News# Perspect,#2006.#19(6):#p.#317A24.# 11.# Borkhardt,#A.,#Blocking'oncogenes'in'malignant'cells'by'RNA'interferenceEEnew'hope'for'a'highly' specific'cancer'treatment?#cancer#cell,#2002.#2(3):#p.#167a8.# 12.# Sledz,#C.A.#and#B.R.#Williams,#RNA'interference'in'biology'and'disease.#Blood,#2005.#106(3):#p.#787A94.# 13.# Jiang,#M.#and#J.#Milner,#Selective'silencing'of'viral'gene'expression'in'HPVEpositive'human'cervical' carcinoma'cells'treated'with'sirna,'a'primer'of'rna'interference.#oncogene,#2002.#21(39):#p.#6041a8.# 14.# Putral,#L.N.,#et#al.,#RNA'interference'against'human'papillomavirus'oncogenes'in'cervical'cancer'cells' results'in'increased'sensitivity'to'cisplatin.#mol#pharmacol,#2005.#68(5):#p.#1311a9.# 15.# Gu,#W.,#et#al.,#Inhibition'of'cervical'cancer'cell'growth'in'vitro'and'in'vivo'with'lentiviralEvector' delivered'short'hairpin'rna'targeting'human'papillomavirus'e6'and'e7'oncogenes.#cancer#gene# Ther,#2006.#13(11):#p.#1023A32.# 16.# Yamato,#K.,#et#al.,#Induction'of'cell'death'in'human'papillomavirus'18Epositive'cervical'cancer'cells'by' E6'siRNA.#Cancer#Gene#Ther,#2006.#13(3):#p.#234A41.# 17.# Faltus,#T.,#et#al.,#Silencing'of'the'HER2/neu'gene'by'siRNA'inhibits'proliferation'and'induces'apoptosis' in'her2/neueoverexpressing'breast'cancer'cells.#neoplasia,#2004.#6(6):#p.#786a95.# 18.# Wang,#Y.H.,#et#al.,#Knockdown'of'cEMyc'expression'by'RNAi'inhibits'MCFE7'breast'tumor'cells'growth' in'vitro'and'in'vivo.#breast#cancer#res,#2005.#7(2):#p.#r220a8.# 19.# Liu,#T.G.,#et#al.,#Silencing'of'hdm2'oncogene'by'siRNA'inhibits'p53Edependent'human'breast'cancer.# Cancer#Gene#Ther,#2004.#11(11):#p.#748A56.# 20.# NarisawaASaito,#M.#and#T.#Kiyono,#Basic'mechanisms'of'highErisk'human'papillomavirusEinduced' carcinogenesis:'roles'of'e6'and'e7'proteins.#cancer#sci,#2007.# 21.# zur#hausen,#h.,#papillomaviruses'and'cancer:'from'basic'studies'to'clinical'application.#nat#rev# Cancer,#2002.#2(5):#p.#342A50.# 22.# Chang,#J.T.,#et#al.,#Highly'potent'and'specific'siRNAs'against'E6'or'E7'genes'of'HPV16E'or'HPV18E infected'cervical'cancers.#cancer#gene#ther,#2010.# 23.# Wu,#S.Y.,#et#al.,#Systemic'delivery'of'E6/7'siRNA'using'novel'lipidic'particles'and'its'application'with' cisplatin'in'cervical'cancer'mouse'models.#gene#ther,#2010.#

19 24.# Jonson,#A.L.,#et#al.,#Gene'silencing'with'siRNA'targeting'E6/E7'as'a'therapeutic'intervention'in'a' mouse'model'of'cervical'cancer.#gynecol#oncol,#2008.#111(2):#p.#356a64.# 25.# Sima,#N.,#et#al.,#RNA'interference'against'HPV16'E7'oncogene'leads'to'viral'E6'and'E7'suppression'in' cervical'cancer'cells'and'apoptosis'via'upregulation'of'rb'and'p53.#apoptosis,#2008.#13(2):#p.#273a81.# 26.# Tang,#S.,#et#al.,#ShortEterm'induction'and'longEterm'suppression'of'HPV16'oncogene'silencing'by'RNA' interference'in'cervical'cancer'cells.#oncogene,#2006.#25(14):#p.#2094a104.# 27.# Gu,#W.,#et#al.,#Both'treated'and'untreated'tumors'are'eliminated'by'short'hairpin'RNAEbased' induction'of'targetespecific'immune'responses.#proc#natl#acad#sci#u#s#a,#2009.#106(20):#p.#8314a9.# 28.# Dontu,#G.,#et#al.,#In'vitro'propagation'and'transcriptional'profiling'of'human'mammary' stem/progenitor'cells.#genes#dev,#2003.#17(10):#p.#1253a70.# 29.# Yu,#F.,#et#al.,#letE7'regulates'self'renewal'and'tumorigenicity'of'breast'cancer'cells.#Cell,#2007.#131(6):# p.#1109a23.# 30.# Yeung,#T.M.,#et#al.,#Cancer'stem'cells'from'colorectal'cancerEderived'cell'lines.#Proc#Natl#Acad#Sci#U#S# A,#2010.#107(8):#p.#3722A7.# 31.# CharafeAJauffret,#E.,#et#al.,#Breast'cancer'cell'lines'contain'functional'cancer'stem'cells'with' metastatic'capacity'and'a'distinct'molecular'signature.#cancer#res,#2009.#69(4):#p.#1302a13.# 32.# Li,#F.,#Every'single'cell'clones'from'cancer'cell'lines'growing'tumors'in'vivo'may'not'invalidate'the' cancer'stem'cell'concept.#mol#cells,#2009.#27(4):#p.#491a2.# 33.# AlAHajj,#M.,#et#al.,#Prospective'identification'of'tumorigenic'breast'cancer'cells.#Proc#Natl#Acad#Sci#U#S# A,#2003.#100(7):#p.#3983A8.# 34.# Singh,#A.#and#J.#Settleman,#EMT,'cancer'stem'cells'and'drug'resistance:'an'emerging'axis'of'evil'in'the' war'on'cancer.#oncogene,#2010.#29(34):#p.#4741a51.# 35.# Penuelas,#S.,#et#al.,#TGFEbeta'increases'gliomaEinitiating'cell'selfErenewal'through'the'induction'of'LIF' in'human'glioblastoma.#cancer#cell,#2009.#15(4):#p.#315a27.# 36.# Tsanou,#E.,#et#al.,#The'EEcadherin'adhesion'molecule'and'colorectal'cancer.'A'global'literature' approach.#anticancer#res,#2008.#28(6a):#p.#3815a26.# 37.# Kang,#J.S.,#C.#Liu,#and#R.#Derynck,#New'regulatory'mechanisms'of'TGFEbeta'receptor'function.#Trends# Cell#Biol,#2009.#19(8):#p.#385A94.# 38.# Heldin,#C.H.,#M.#Landstrom,#and#A.#Moustakas,#Mechanism'of'TGFEbeta'signaling'to'growth'arrest,' apoptosis,'and'epithelialemesenchymal'transition.#curr#opin#cell#biol,#2009.#21(2):#p.#166a76.# 39.# Watabe,#T.#and#K.#Miyazono,#Roles'of'TGFEbeta'family'signaling'in'stem'cell'renewal'and' differentiation.#cell#res,#2009.#19(1):#p.#103a15.# 40.# Bellone,#G.,#et#al.,#Differential'expression'of'transforming'growth'factorsEbeta1,'Ebeta2'and'Ebeta3'in' human'colon'carcinoma.#eur#j#cancer,#2001.#37(2):#p.#224a33.# 41.# Charette,#S.T.#and#D.J.#McCance,#The'E7'protein'from'human'papillomavirus'type'16'enhances' keratinocyte'migration'in'an'aktedependent'manner.#oncogene,#2007.#26(52):#p.#7386a90.# 42.# Menges,#C.W.,#et#al.,#Human'papillomavirus'type'16'E7'upEregulates'AKT'activity'through'the' retinoblastoma'protein.#cancer#res,#2006.#66(11):#p.#5555a9.# 43.# Scheffner,#M.#and#N.J.#Whitaker,#Human'papillomavirusEinduced'carcinogenesis'and'the'ubiquitinE proteasome'system.#semin#cancer#biol,#2003.#13(1):#p.#59a67.# 44.# Assinder,#S.J.,#et#al.,#The'TGFEbeta,'PI3K/Akt'and'PTEN'pathways:'established'and'proposed' biochemical'integration'in'prostate'cancer.#biochem#j,#2009.#417(2):#p.#411a21.# 45.# Levina,#V.,#et#al.,#DrugEselected'human'lung'cancer'stem'cells:'cytokine'network,'tumorigenic'and' metastatic'properties.#plos#one,#2008.#3(8):#p.#e3077.# 46.# Bertolini,#G.,#et#al.,#Highly'tumorigenic'lung'cancer'CD133+'cells'display'stemElike'features'and'are' spared'by'cisplatin'treatment.#proc#natl#acad#sci#u#s#a,#2009.#106(38):#p.#16281a6.# 47.# Dean,#M.,#T.#Fojo,#and#S.#Bates,#Tumour'stem'cells'and'drug'resistance.#Nat#Rev#Cancer,#2005.#5(4):#p.# 275A84.# 48.# Spillman,#M.A.,#et#al.,#TissueESpecific'Pathways'for'Estrogen'Regulation'of'Ovarian'Cancer'Growth' and'metastasis.#cancer#res,#2010.#

20 49.# Shai,#A.,#H.C.#Pitot,#and#P.F.#Lambert,#p53'Loss'synergizes'with'estrogen'and'papillomaviral' oncogenes'to'induce'cervical'and'breast'cancers.#cancer#res,#2008.#68(8):#p.#2622a31.# 50.# Platet,#N.,#et#al.,#Estrogens'and'their'receptors'in'breast'cancer'progression:'a'dual'role'in'cancer' proliferation'and'invasion.#crit#rev#oncol#hematol,#2004.#51(1):#p.#55a67.# 51.# Kim,#C.J.,#et#al.,#Regulation'of'cell'growth'and'HPV'genes'by'exogenous'estrogen'in'cervical'cancer' cells.#int#j#gynecol#cancer,#2000.#10(2):#p.#157a164.# #

21 Figure titles and figure legends: Figure 1. Morphology of HeLa sphere and sphere formation cells. HeLa cells are adhesive in normal culture (1A). HeLa cells cultured in sphere culture medium can form some spheres at day 4 whereas other HeLa cells survive as adhesive cells (1B). At day 8, the spheres grew bigger (1C) and at day 10 inside the sphere contain hundreds of SFC (1D). The SFC were CD44 positive and expressed low level of CD24 whereas parental HeLa cells were CD44 negative and expressed high level CD24 analyzed by FACS (1E). The fluorescent images showed the CD44 staining of sorted cells with antibody conjugated with FITC. Figure 2. E2 effect on sphere formation, colony formation and differentiation abilities of HeLa- SFC. HeLa cells treated E2 (E2-HeLa) showed an increased abilities to form spheres whereas the presence of E2 in the sphere culture medium (+ E2) also increased sphere formation of HeLa cells (A). When HeLa-SFC were cultured in complete DMEM medium containing fetal calf serum they could quickly grow into the morphology of the parental HeLa cells (B vs Fig 1A) and these cells became sensitive to the chemotherapeutic drug CIS they used to resist (B). The crystal violet stained only the living and adhesive cells in the wells while the dead cells were washed off before the staining (C). when HeLa-SFC were set for colony forming assay in above complete DMEM medium, they grew faster as bigger colonies (D) and form more colonies in colony forming assay (E) than the parental HeLa cells. ***: P< Figure 3. HPV E6/E7 expression profile of HeLa-SFC and E6/E7 gene silencing effect on their sphere formation. HPV E6 and E7 expression level in HeLa and in HeLa-SFC were measured using real-time PCR and the data are representative for at least two independent assays (A). When HeLa cells transduced with LV-shRNA 18E6-1 and 16E7-2 and were cultured in the sphere culture medium, the sphere formation of LV-18E6-1 (18E6-1-SP) were obviously inhibited in both sphere size and numbers

22 (B and C), comparing with control LV-shRNA 16E7-2 (16E7-2-SP). The reduction of sphere number was also shown in a dose dependent way (D, 1x dose vs 4x dose). E shows the SFCs were GFP positive as the lentiviral vector carrying an egfp gene under the control of CMV promoter. *: P<0.05; **: P<0.01; ***: P< Figure 4. HPV E6/E7 gene and self-renewal gene expressions in transduced HeLa-SFC. The transduced HeLa-SFCs were measured for E6 and E7 gene expressions using real-time PCR. Compared with 16E7-2 transduced SFC, 18E6-1 transduced SFC had significantly (*: P<0.05; **: P<0.01) lower levels of E6 and E7 expression (A). These cells were also used to measure self-renewal gene TGF-β expression. All three isoforms (TGF-β-1, -2, and -3) of TGF-β were all significantly (**: P<0.01) decreased after E6/E7 silence (B). However, LIF was not changed (C) in the same cells. Adhere gene expression of E-cadherin was similarly measured in these cells (D).

23 Figure. 1. A B C D E. CD44 CD24 HeLa HeLa-SFC

24 Figure.2 E2 treatment effect 60 ** A. Sphere formation % ** *** 0 HeLa HeLa + E2 E2-HeLa E2-HeLa + E2 B C D E HeLa-SFC HeLa Colony No *** 0 HeLa HeLa-SFC

25 Figure. 3 A. Realtive expression B HeLa-E6 * HeLa-SFC-E6 HeLa-E7 P=0.397 HeLa-SFC-E7 C Sphere formation % * 18E6-1-Sphere 16E7-2-Sphere 0 HeLa-16E7-2 HeLa-18E6-1 D E 1500 *** No.s of Spheres P=0.075 ** 0 HeLa Control(1x) 18E6-1(1x) Control(2x) 18E6-1(2x) Control(4x) 18E6-1(4x)

26 Figure 4. B. A. Realtive expression E7-2-SFC * 18E6-1-SFC 16E7-2-SFC ** 18E6-1-SFC E6 E7 TGF-beta -1 TGF-beta-2 TGF-beta Relative Expression ** Relative Expression ** Relative Expression ** E7-2-sfc 18E6-1-sfc E7-2-sfc 18E6-1-sfc E7-2-sfc 18E6-1-sfc C D Relative Expression LIF Relative Expression E-cadherin P= HeLa-sfc 16E7-2-sfc 18E6-1-sfc 0 HeLa-sfc 16E7-2-sfc 18E6-1-sfc

27 Supplementary data: Suppl. 1: Cell surface images of Scanning Electronic Microscopy (SEM) of HeLa and HeLa-SFC. HeLa cells and HeLa-SFC were separated as single cells and fixed with 4% PFA/PBS for half an hour at 4 o C. The cells were pelletted and resuspended in a very small volume of fixing solution. The SEM specimens were prepared by depositing a small amount of cell solution onto a standard SEM holder with double sided carbon tape pre-attached. The specimens are then left in the fume hood for over 1 hour to let the liquid to dry. The fixed and dried cells are then coated with a thin (several nanometers) layer of platinum for electrical conductivity by using a Baltek plasma coater. The SEM images are obtained by a JEOL6300 SEM operating at 5 kv. The cell fixing treatment is effective as most of the cells viewed by the SEM have spherical shapes in the highly vacuumed SEM chamber. The cells are stable under the high intensity electron beam. Comparing with HeLa-SFC, HeLa cell surface was much smoother. Suppl. 2: The sphere formation of drug resistant HeLa cells: To establish drug-resistant cells, HeLa cells were treated the 3 drugs at working concentrations. Most cells were killed but surviving cells were cultured as drug-resistant cell lines after retesting of drug resistance in the presence of the drug at working concentrations. Or HeLa cells were cultured for 2-3 months in the presence of a low drug dose (1/10 of the working concentration). These cells were then

28 tested for drug-resistance by culturing them in the presence of working concentration drugs before establishing as a drug resistant cell line. The drugresistant cells were then used for sphere culture. As the data indicated all resistant cells have increased sphere Sphere formation % Suppl. Fig 2A forming abilities, with DOX-HeLa increased to the most to about 96% (Suppl. Fig 2A). CD44 expression of the 0 HeLa CIS-HeLa EPI-HeLa DOX-HeLa drug-resistant cells was also increased compared with HeLa cells (suppl. Fig 2B). Suppl. Fig 2B. Suppl. 3: Some mirna expression of HeLa-SFC: Previously, a study showed that breast CSC expressed a lower level of let-7a mirna than their paternal cells [30]. To test this in HeLa-SFC, we measured let-7a levels in HeLa cells and HeLa-SFC. The result proved that HeLa-SFC indeed expressed a lower level of let-7a than the parental cells. In addition, we also detected mir-293 and mir-182 levels in HeLa-SFC which were shown increased in

29 stem cells or related to tumor metastasis [35]. In both cases, they increased in HeLa-SFC compared with parental HeLa cells (Suppl. Fig 3). Suppl. Fig Relative Expression HeLa Let-7a mir-182 mir-293 Suppl. 4: Human Ras genes expression in LV-18E6-1 transduced HeLa-SFC cells: Human RAS and TGF-β family have a close relationship and interact to each other (reviewed by Grusch et al [39]). We measured H-Ras and K- Ras expression after E6/E7 silence to examine if the decrease of TGF-β would also down-regulate Ras gene levels. However, as the result showed there was no remarkable change of both Ras expressions observed (Suppl. Fig 4), suggesting that in this particular case, TGF-β may not directly Relative Expression HeLa-sp-Hras Suppl. Fig 4. RAS gene expression 16E7-sp-Hras 18E6-sp-Hras HeLa-sp-Kras 16E7-sp-Kras 18E6-sp-Kras regulate Ras expressions. These data were analyzed with 2-3 biological repeats.