Transient Ribosomal Attenuation Coordinates Protein Synthesis and Co-translational Folding

Size: px
Start display at page:

Download "Transient Ribosomal Attenuation Coordinates Protein Synthesis and Co-translational Folding"

Transcription

1 SUPPLEMENTARY INFORMATION: Transient Ribosomal Attenuation Coordinates Protein Synthesis and Co-translational Folding Gong Zhang 1,2, Magdalena Hubalewska 1 & Zoya Ignatova 1,2 1 Department of Cellular Biochemistry, Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, Martinsried, Germany 2 Department of Biochemistry, Institute of Biochemistry and Biology, University of Potsdam, Karl-Liebknecht-Str 24-25, Potsdam-Golm, Germany Address correspondence to Zoya Ignatova, ignatova@uni-potsdam.de

2 Supplementary Figure 1 Putative slow-translating regions are more frequent in Tat-secreted proteins of Bacillus subtilis. The open-reading frames of the secreted proteins from B. subtilis proteome were extracted based on the predictions of the SignalP 3.0 server ( and separated into two groups: exported via the Tat (Tat) or Sec (Sec) pathway.

3 Supplementary Figure 2 Determination of translation competency, translation yields, and the conditions for proteinase K digestion. (a) The discrete intermediates of SufI translation in vitro are products of transient translational attenuation as short ribosome-bound fragments were translationally competent (left autoradiogram) and puromycin-sensitive (right autoradiogram). The RNCs of in vitro translated SufI were isolated by sucrose cushion (lane 1, left panel) and added to a fresh batch of synchronized E. coli cell-free translation mixture containing all non-radioactive amino acids and incubated for 2 h at 30 C (lane 2, left panel). The transiently stalled translational intermediates were able to continue translation to a full-length (FL) product. In addition, transiently staled intermediates were stably tethered to the ribosomes as suggested by their sensitivity to puromycin. To RNCs isolated by sucrose cushion (SC) (lane 2, right panel) of in vitro translated SufI (lane 1, right panel) puromycin to a final concentration 2 mm was added and further incubated for 4 h (lane 4, right panel). After a subsequent second isolation of the RNCs (lane 5, right panel) all transient intermediates were released from the ribosomes. To prove the spontaneous release of the nascent chains from the ribosomes during the incubation time, isolated RNCs were incubated under same conditions without puromycin and no substantial intensity changes in the autoradiogram pattern were detected (lane 3, right panel).

4 Mw, molecular weight marker. (b) Optimization of the proteinase K digestion. RNCs isolated by sucrose cushion from the SufI in vitro translation system were subjected to digestion with 10 ng/µl proteinase K on ice for different times. Note that the optimal time for limited proteolysis of SufI was five minutes. (c) Transcription was unaffected by the silent mutations. The concentration of each transcript was determined using quantitative reverse transcription (for details see Supplementary Methods). Lanes: 1 - DNA fragment markers in base pairs (bp); 2 - wild-type SufI; 3 -SufI-Δ ; 4 -SufI-Δ ; 5 - SufI-3R

5 Supplementary Figure 3 Penicillin amidase (PA) is translated via many transient intermediates. Synchronized pulse-translation (left autoradiogram) of S 35 -labeled full-length (FL) PA or PA chains truncated down-stream of the kda (marked with ) and kda (marked with Δ) yielded many transiently arrested fragments, whose sizes matched the predicted minima in the translation rate profile (underlined and highlighted with corresponding symbols). The predicted slow-translating clusters delineate single structural domains in PA (pdb access code 1PNK); the corresponding transiently stalled intermediates were largely protease K resistant (+PK, right autoradiogram) suggesting that they have already acquired higher order structure while still tethered to the ribosomes. PA and the truncated variants were translated from the pivex 2.3d plasmid under the control of thet7 promoter.

6 Supplementary Figure 4 Bacterial Hsp70/40 (DnaK/DnaJ) chaperones do not bind to the nascent chains of wild-type SufI. SufI was translated in the coupled transcription-translation E. coli cell-free system, and the RNC-complexes were isolated by sucrose cushion (SC). For comparison, a control reaction with empty vector without the SufI-insert and the isolated RNCs-fraction was loaded. All samples were resolved on 15% SDS-PAGE and subsequently blotted with monoclonal anti-dnak (1:2000 dilution; Stressgen) and polyclonal anti-dnaj (1:5000 dilution; Stressgen) antibodies.

7 Supplementary Figure 5 SufI unfolds upon chemical denaturation in a domain-wise manner. (a) SufI unfolds via well defined biphasic transition between 3.5 and 5 M urea, implying the presence of a stable unfolding intermediate(s) with retained degree of native Trp-fluorescence. The standard deviations were determined from three independent experiments. (b) Unfolding intermediate(s) are enriched at the same urea concentrations as suggested from the dependence of the amplitude of the kinetic traces on the urea concentrations. The SufI unfolding curves at various urea concentrations (plotted at the X-axis) showed a double-exponential behavior, dominated by an initial fast unfolding phase with amplitude plotted on the Y-axis. (c) Native SufI is relatively resistant to treatment with proteinase K up to 1M urea. In the course of unfolding, proteinase K released fragments of various lengths, some of which matched the size a single domain or various combinations of them. The domain architecture based on the primary amino acid sequence is schematically presented and the same color code is used to mark the proteolytically stable bands. Mw, molecular weight marker.

8 Supplementary Figure 6 Elimination of only one slow-translating codon is not sufficient to completely abolish the co-translational folding of full-length SufI. Leu244 (Δ ) or Leu252 (Δ ) were silently mutated to a CUG codon that is read by a highly abundant trna and the in vitro translated full-length (FL) protein was significantly proteinase-resistant. SC denotes RNCs isolated by sucrose cushion and PK limited digestion by proteinase K.

9 Supplementary Table 1 Mass-spectrometry analysis of the RNCs from the in vitro translation mixture translating SufI or empty vector. Protein name a SufI Empty vector Mascot score rpsa 30S ribosomal subunit protein S rpsb 30S ribosomal subunit protein S rpll 50S ribosomal subunit protein L7/L rple 50S ribosomal subunit protein L rpsm 30S ribosomal subunit protein S rpli 50S ribosomal subunit protein L rplf 50S ribosomal subunit protein L rpse 30S ribosomal subunit protein S rpsc 30S ribosomal subunit protein S rpsd 30S ribosomal subunit protein S rplo 50S ribosomal subunit protein L rpsg 30S ribosomal subunit protein S rplv 50S ribosomal subunit protein L rplk 50S ribosomal subunit protein L rpld 50S ribosomal subunit protein L tig Trigger factor, protein folding chaperone dnak Hsp70 molecular chaperone, heat-inducible Suf I a Both reactions did not differ in the content of the constitutive ribosomal components; representative examples of some ribosomal proteins are shaded.

10 SUPPLEMENTARY METHODS Quantitative determination of mrna. Translation reactions of wild-type SufI, SufI-Δ 25-28, SufI-Δ 33-40, and SufI-3R 25-28, containing 2.5 ng plasmid DNA were transcribed for 15 min at 30 C in a 25 µl reaction mixture of the in vitro translation kit (without addition of amino acid mix). The samples were diluted 50-fold and treated with 0.75 U DNAse at 37 C for one hour to digest the plasmid DNA and various dilutions of the samples were subjected to quantitative RT-PCR with SufI specific primers. No fragment was amplified when primers outside of the SufI coding region were used. In vitro unfolding experiments. C-terminally His 6 -tagged SufI was expressed in E. coli BL21(DE3) cells from the pet28b plasmid. The expression was induced at OD 600 =2 by adding 0.8 mm IPTG for 3 h at 37 C. Cells were lysed and SufI was affinity purified from the soluble fraction using a Ni-NTA column as described by the manufacturer (Qiagen). Protein concentration was determined spectrophotometrically using the theoretical ε 280 value of M -1 cm µm pure SufI dissolved in 10 mm Tris.HCl, ph 8.0 containing increasing concentrations of urea was incubated for 3 h at room temperature. Equilibrium urea-unfolding was monitored by the intrinsic Trp fluorescence (excitation 280 nm; 5 nm bandwidth) and emission spectra between 300 and 400 nm or time-resolved emission changes at 350 nm were recorded on a Fluorolog (Horiba/Jobin Ivon) fluorometer equipped with a thermoelectric cell holder. Concentrated solution of pure SufI was rapidly diluted to a final concentration of 1.4 µm into 10 mm Tris.HCl, ph 8.0 containing various concentrations of urea and the unfolding kinetics were recorded at 37 C at 350 nm (5 nm bandwidth; excitation 280 nm; 5 nm bandwidth). The unfolding rate constants and the amplitudes were obtained by exponential curve fitting using the software package SigmaPlot. The exact final urea concentrations were calculated from the refractive index. In addition, the unfolding of SufI was monitored by partial proteinase K digestion. 4 µm purified SufI was incubated in 10 mm Tris.HCl, ph 8.0 containing increasing urea concentrations from 0 to 4 M at 25 C for 3 h and subsequently subjected to partial proteolytic digestion with 10 ng/µl proteinase K for 5 min on ice. The proteolytic fragments were resolved on 15 % SDS-PAGE and visualized by Coomassie staining.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Design of isolated protein and RNC constructs, and homogeneity of purified RNCs. (a) Schematic depicting the design and nomenclature used for all the isolated proteins and RNCs used

More information

Theoretical ribosomal protein mass distribution of Pseudomonas aeruginosa PAO1

Theoretical ribosomal protein mass distribution of Pseudomonas aeruginosa PAO1 Theoretical ribosomal protein mass distribution of Pseudomonas aeruginosa PAO1 Abstract Wenfa Ng Unaffiliated researcher, Singapore, Email: ngwenfa771@hotmail.com Ribosomes are the protein synthesis factories

More information

Overview of the Expressway Cell-Free Expression Systems. Expressway Mini Cell-Free Expression System

Overview of the Expressway Cell-Free Expression Systems. Expressway Mini Cell-Free Expression System Overview of the Expressway Cell-Free Expression Systems The Expressway Cell-Free Expression Systems use an efficient coupled transcription and translation reaction to produce up to milligram quantities

More information

Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB

Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Structural Characterization of Prion-like Conformational Changes of the Neuronal Isoform of Aplysia CPEB Bindu L. Raveendra, 1,5 Ansgar B. Siemer, 2,6 Sathyanarayanan V. Puthanveettil, 1,3,7 Wayne A. Hendrickson,

More information

N α -Acetylation of yeast ribosomal proteins and its effect on protein synthesis

N α -Acetylation of yeast ribosomal proteins and its effect on protein synthesis JOURNAL OF PROTEOMICS 74 (2011) 431 441 available at www.sciencedirect.com www.elsevier.com/locate/jprot N α -Acetylation of yeast ribosomal proteins and its effect on protein synthesis Masahiro Kamita

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/308/ra4/dc1 Supplementary Materials for Antipsychotics Activate mtorc1-dependent Translation to Enhance Neuronal Morphological Complexity Heather Bowling, Guoan

More information

Nature Methods: doi: /nmeth Supplementary Figure 1

Nature Methods: doi: /nmeth Supplementary Figure 1 Supplementary Figure 1 Subtiligase-catalyzed ligations with ubiquitin thioesters and 10-mer biotinylated peptides. (a) General scheme for ligations between ubiquitin thioesters and 10-mer, biotinylated

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Aminoglycoside activity observed on single pre-translocation ribosome complexes

Aminoglycoside activity observed on single pre-translocation ribosome complexes correction notice Nat. Chem. Biol. 6, 54 62 (2010) Aminoglycoside activity observed on single pre-translocation ribosome complexes Michael B Feldman, Daniel S Terry, Roger B Altman & Scott C Blanchard

More information

In vitro integration of ribosomal RNA synthesis, ribosome assembly, and translation

In vitro integration of ribosomal RNA synthesis, ribosome assembly, and translation In vitro integration of ribosomal RNA synthesis, ribosome assembly, and translation Michael C. Jewett 1,2, Brian R. Fritz 2, Laura E. Timmerman 2, and George M. Church 1 1 Department of Genetics, Harvard

More information

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR

Supplemental Materials and Methods Plasmids and viruses Quantitative Reverse Transcription PCR Generation of molecular standard for quantitative PCR Supplemental Materials and Methods Plasmids and viruses To generate pseudotyped viruses, the previously described recombinant plasmids pnl4-3-δnef-gfp or pnl4-3-δ6-drgfp and a vector expressing HIV-1 X4

More information

CHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000)

CHAPTER 4 RESULTS. showed that all three replicates had similar growth trends (Figure 4.1) (p<0.05; p=0.0000) CHAPTER 4 RESULTS 4.1 Growth Characterization of C. vulgaris 4.1.1 Optical Density Growth study of Chlorella vulgaris based on optical density at 620 nm (OD 620 ) showed that all three replicates had similar

More information

Double charge of 33kD peak A1 A2 B1 B2 M2+ M/z. ABRF Proteomics Research Group - Qualitative Proteomics Study Identifier Number 14146

Double charge of 33kD peak A1 A2 B1 B2 M2+ M/z. ABRF Proteomics Research Group - Qualitative Proteomics Study Identifier Number 14146 Abstract The 2008 ABRF Proteomics Research Group Study offers participants the chance to participate in an anonymous study to identify qualitative differences between two protein preparations. We used

More information

Problem-solving Test: The Mechanism of Protein Synthesis

Problem-solving Test: The Mechanism of Protein Synthesis Q 2009 by The International Union of Biochemistry and Molecular Biology BIOCHEMISTRY AND MOLECULAR BIOLOGY EDUCATION Vol. 37, No. 1, pp. 58 62, 2009 Problem-based Learning Problem-solving Test: The Mechanism

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG

EGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to

More information

Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding

Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding Dynamic enzyme docking to the ribosome coordinates N-terminal processing with polypeptide folding Arzu Sandikci, Felix Gloge, Michael Martinez, Matthias P. Mayer, Rebecca Wade, Bernd Bukau and Günter Kramer

More information

Lane: 1. Spectra BR protein ladder 2. PFD 3. TERM 4. 3-way connector 5. 2-way connector

Lane: 1. Spectra BR protein ladder 2. PFD 3. TERM 4. 3-way connector 5. 2-way connector kda 1 2 3 4 5 26 14 1 7 Lane: 1. Spectra BR protein ladder 2. PFD 3. TERM 4. 3-way connector 5. 2-way connector 5 4 35 25 15 1 Supplementary Figure 1. SDS-PAGE of acterially expressed and purified proteins.

More information

Genetic information flows from mrna to protein through the process of translation

Genetic information flows from mrna to protein through the process of translation Genetic information flows from mrn to protein through the process of translation TYPES OF RN (RIBONUCLEIC CID) RN s job - protein synthesis (assembly of amino acids into proteins) Three main types: 1.

More information

Allergen of Japanese Cedar Pollen, Cryj2, in Escherichia coli

Allergen of Japanese Cedar Pollen, Cryj2, in Escherichia coli Chaperone Coexpression Plasmids: Differential and Synergistic Roles of DnaK-DnaJ-GrpE and GroELGroES in Assisting Folding of an Allergen of Japanese Cedar Pollen, Cryj2, in Escherichia coli K. Nishihara

More information

Chemical Biology, Option II Mechanism Based Proteomic Tagging Case History CH1

Chemical Biology, Option II Mechanism Based Proteomic Tagging Case History CH1 Proteome Wide Screening of Serine Protease Activity Proc Natl Acad Sci 1999, 97, 14694; Proteomics 2001, 1, 1067; Proc Natl Acad Sci 2002, 99, 10335; Biochemistry 2001, 40, 4005; J. Am. Chem. Soc., 2005,

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Supplementary Figure 1. Translation of naturally occurring CC[C/U]-[C/U] sequences in E. coli. a. The frequency of occurrence of CC[C/U]-[C/U] in E. coli K12 protein coding genes.

More information

SensoLyte 490 HIV-1 Protease Assay Kit *Fluorimetric*

SensoLyte 490 HIV-1 Protease Assay Kit *Fluorimetric* SensoLyte 490 HIV-1 Protease Assay Kit *Fluorimetric* Catalog # 71127 Unit Size Kit Size 1 kit 500 assays (96-well) or 1250 assays (384-well) This kit is optimized to detect the activity of human immunodeficiency

More information

SensoLyte 520 HIV-1 Protease Assay Kit *Fluorimetric*

SensoLyte 520 HIV-1 Protease Assay Kit *Fluorimetric* SensoLyte 520 HIV-1 Protease Assay Kit *Fluorimetric* Catalog # 71147 Kit Size 100 assays (96-well) or 500 assays (384-well) Convenient Format: Complete kit including all the assay components. Optimized

More information

Life Sciences 1A Midterm Exam 2. November 13, 2006

Life Sciences 1A Midterm Exam 2. November 13, 2006 Name: TF: Section Time Life Sciences 1A Midterm Exam 2 November 13, 2006 Please write legibly in the space provided below each question. You may not use calculators on this exam. We prefer that you use

More information

SUPPLEMENTAL DATA RESULTS

SUPPLEMENTAL DATA RESULTS SUPPLEMENTAL DATA RESULTS Ded1-mediated ribosomal scanning is less leaky than scanning promoted by eifs 4A/4B/4F. The efficiency of leaky scanning in the presence of Ded1 or of eifs 4A/4B/4F was investigated

More information

Expression constructs

Expression constructs Gene expressed in bebe3 ZmBEa Expression constructs 35S ZmBEa Pnos:Hygromycin r 35S Pnos:Hygromycin r 35S ctp YFP Pnos:Hygromycin r B -1 Chl YFP- Merge Supplemental Figure S1: Constructs Used for the Expression

More information

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints

Supplementary Figure 1. Using DNA barcode-labeled MHC multimers to generate TCR fingerprints Supplementary Figure 1 Using DNA barcode-labeled MHC multimers to generate TCR fingerprints (a) Schematic overview of the workflow behind a TCR fingerprint. Each peptide position of the original peptide

More information

Supplemental Data. Deinlein et al. Plant Cell. (2012) /tpc

Supplemental Data. Deinlein et al. Plant Cell. (2012) /tpc µm Zn 2+ 15 µm Zn 2+ Growth (% of control) empty vector NS1 NS2 NS3 NS4 S. pombe zhfδ Supplemental Figure 1. Functional characterization of. halleri NS genes in Zn 2+ hypersensitive S. pombe Δzhf mutant

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. (a) Uncropped version of Fig. 2a. RM indicates that the translation was done in the absence of rough mcirosomes. (b) LepB construct containing the GGPG-L6RL6-

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

Improve Protein Analysis with the New, Mass Spectrometry- Compatible ProteasMAX Surfactant

Improve Protein Analysis with the New, Mass Spectrometry- Compatible ProteasMAX Surfactant Improve Protein Analysis with the New, Mass Spectrometry- Compatible Surfactant ABSTRACT Incomplete solubilization and digestion and poor peptide recovery are frequent limitations in protein sample preparation

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3076 Supplementary Figure 1 btrcp targets Cep68 for degradation during mitosis. a) Cep68 immunofluorescence in interphase and metaphase. U-2OS cells were transfected with control sirna

More information

Manja Henze, Dorothee Merker and Lothar Elling. 1. Characteristics of the Recombinant β-glycosidase from Pyrococcus

Manja Henze, Dorothee Merker and Lothar Elling. 1. Characteristics of the Recombinant β-glycosidase from Pyrococcus S1 of S17 Supplementary Materials: Microwave-Assisted Synthesis of Glycoconjugates by Transgalactosylation with Recombinant Thermostable β-glycosidase from Pyrococcus Manja Henze, Dorothee Merker and Lothar

More information

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

More information

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.

More information

Problem Set 5, 7.06, Spring of 13

Problem Set 5, 7.06, Spring of 13 Problem Set 5, 7.06, Spring 2003 1 of 13 1. In order to please your demanding thesis advisor, you've completed an extensive fractionation and biochemical purification of proteins localized to the mitochondria,

More information

Crystallization-grade After D After V3 cocktail. Time (s) Time (s) Time (s) Time (s) Time (s) Time (s)

Crystallization-grade After D After V3 cocktail. Time (s) Time (s) Time (s) Time (s) Time (s) Time (s) Ligand Type Name 6 Crystallization-grade After 447-52D After V3 cocktail Receptor CD4 Resonance Units 5 1 5 1 5 1 Broadly neutralizing antibodies 2G12 VRC26.9 Resonance Units Resonance Units 3 1 15 1 5

More information

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection.

For in vitro Veterinary Diagnostics only. Kylt Rotavirus A. Real-Time RT-PCR Detection. For in vitro Veterinary Diagnostics only. Kylt Rotavirus A Real-Time RT-PCR Detection www.kylt.eu DIRECTION FOR USE Kylt Rotavirus A Real-Time RT-PCR Detection A. General Kylt Rotavirus A products are

More information

Bio 111 Study Guide Chapter 17 From Gene to Protein

Bio 111 Study Guide Chapter 17 From Gene to Protein Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and

More information

Chapter 31. Completing the Protein Life Cycle: Folding, Processing and Degradation. Biochemistry by Reginald Garrett and Charles Grisham

Chapter 31. Completing the Protein Life Cycle: Folding, Processing and Degradation. Biochemistry by Reginald Garrett and Charles Grisham Chapter 31 Completing the Protein Life Cycle: Folding, Processing and Degradation Biochemistry by Reginald Garrett and Charles Grisham Essential Question How are newly synthesized polypeptide chains transformed

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/10/471/eaah5085/dc1 Supplementary Materials for Phosphorylation of the exocyst protein Exo84 by TBK1 promotes insulin-stimulated GLUT4 trafficking Maeran Uhm,

More information

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6. Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,

More information

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81. IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag

More information

Structural vs. nonstructural proteins

Structural vs. nonstructural proteins Why would you want to study proteins associated with viruses or virus infection? Receptors Mechanism of uncoating How is gene expression carried out, exclusively by viral enzymes? Gene expression phases?

More information

Chapter 3. Expression of α5-megfp in Mouse Cortical Neurons. on the β subunit. Signal sequences in the M3-M4 loop of β nachrs bind protein factors to

Chapter 3. Expression of α5-megfp in Mouse Cortical Neurons. on the β subunit. Signal sequences in the M3-M4 loop of β nachrs bind protein factors to 22 Chapter 3 Expression of α5-megfp in Mouse Cortical Neurons Subcellular localization of the neuronal nachr subtypes α4β2 and α4β4 depends on the β subunit. Signal sequences in the M3-M4 loop of β nachrs

More information

This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth 2 points.

This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth 2 points. MBB 407/511 Molecular Biology and Biochemistry First Examination - October 1, 2002 Name Social Security Number This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is

More information

reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express

reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express Supplementary Figure 1. VapC-mt4 cleaves trna Ala2 in E. coli. Histograms representing the fold change in reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were

Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze

More information

7.012 Quiz 3 Answers

7.012 Quiz 3 Answers MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel Friday 11/12/04 7.012 Quiz 3 Answers A > 85 B 72-84

More information

Section 6. Junaid Malek, M.D.

Section 6. Junaid Malek, M.D. Section 6 Junaid Malek, M.D. The Golgi and gp160 gp160 transported from ER to the Golgi in coated vesicles These coated vesicles fuse to the cis portion of the Golgi and deposit their cargo in the cisternae

More information

of Serum Oxidation V max ) and

of Serum Oxidation V max ) and SUPPLEMENTAL DATA Paradoxical Effects of Serum Amyloid A on the Lipoprotein Oxidation Suggest a New Antioxidant t Function for SAA Shobini Jayaraman, Christian Haupt, and Olga Gursky Figure S1. Lipid peroxidation

More information

CHAPTER 4. Tryptophan fluorescence quenching by brominated lipids

CHAPTER 4. Tryptophan fluorescence quenching by brominated lipids CHAPTER 4 Tryptophan fluorescence quenching by brominated lipids 102 4.1 INTRODUCTION The structure and dynamics of biological macromolecules have been widely studied with fluorescence quenching. The accessibility

More information

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay

Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation

Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation Construction of a hepatocellular carcinoma cell line that stably expresses stathmin with a Ser25 phosphorylation site mutation J. Du 1, Z.H. Tao 2, J. Li 2, Y.K. Liu 3 and L. Gan 2 1 Department of Chemistry,

More information

Mechanisms of alternative splicing regulation

Mechanisms of alternative splicing regulation Mechanisms of alternative splicing regulation The number of mechanisms that are known to be involved in splicing regulation approximates the number of splicing decisions that have been analyzed in detail.

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Stelter et al., http://www.jcb.org/cgi/content/full/jcb.201105042/dc1 S1 Figure S1. Dyn2 recruitment to edid-labeled FG domain Nups.

More information

Supplementary Material and Methods

Supplementary Material and Methods Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided

More information

SUPPLEMENTARY INFORMATION. An orthogonal ribosome-trnas pair by the engineering of

SUPPLEMENTARY INFORMATION. An orthogonal ribosome-trnas pair by the engineering of SUPPLEMENTARY INFORMATION An orthogonal ribosome-trnas pair by the engineering of peptidyl transferase center Naohiro Terasaka 1 *, Gosuke Hayashi 1 *, Takayuki Katoh 1, and Hiroaki Suga 1,2 1 Department

More information

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/3/2/e1602038/dc1 Supplementary Materials for Mitochondrial metabolic regulation by GRP78 Manoj Prasad, Kevin J. Pawlak, William E. Burak, Elizabeth E. Perry, Brendan

More information

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion

Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated

More information

L-Carnosine-Derived Fmoc-Tripeptides Forming ph- Sensitive and Proteolytically Stable Supramolecular

L-Carnosine-Derived Fmoc-Tripeptides Forming ph- Sensitive and Proteolytically Stable Supramolecular Supporting Information: L-Carnosine-Derived Fmoc-Tripeptides Forming ph- Sensitive and Proteolytically Stable Supramolecular Hydrogels Rita Das Mahapatra, a Joykrishna Dey* a, and Richard G. Weiss b a

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice. Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.

More information

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells.

Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure S1. Expression of Cirbp mrna in mouse tissues and NIH3T3 cells. A) Cirbp mrna expression levels in various mouse tissues collected around the clock

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice

More information

Universal sample preparation method for proteome analysis

Universal sample preparation method for proteome analysis nature methods Universal sample preparation method for proteome analysis Jacek R Wi niewski, Alexandre Zougman, Nagarjuna Nagaraj & Matthias Mann Supplementary figures and text: Supplementary Figure 1

More information

Luminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells

Luminescent platforms for monitoring changes in the solubility of amylin and huntingtin in living cells Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2016 Contents Supporting Information Luminescent platforms for monitoring changes in the

More information

Systematic analysis of protein-detergent complexes applying dynamic light scattering to optimize solutions for crystallization trials

Systematic analysis of protein-detergent complexes applying dynamic light scattering to optimize solutions for crystallization trials Supporting information 1 2 3 Volume 71 (2015) Supporting information for article: 4 5 6 7 8 Systematic analysis of protein-detergent complexes applying dynamic light scattering to optimize solutions for

More information

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E.

B. SDS-PAGE. Western blot MW (kda) Supplementary Information. Supplementary Figure 1. MW (kda) Glutelin. Prolamin. 3 E.coli. 3 E. Supplementary Information Supplementary Figure 1. A. MW (kda) B. SDS-PAGE Western blot MW (kda) 50 40 100 75 50 37 30 Glutelin 25 20 15 20 Prolamin 10 ARP1 1 2 3 E.coli MucoRice ARP1 (RNAi +) 4 5 ARP1

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION In the format provided by the authors and unedited. SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.2919 Direct observation of the influence of cardiolipin and antibiotics on lipid II binding to MurJ Jani

More information

Supplementary Figures. Supplementary Figure 1. Treatment schematic of SIV infection and ARV and PP therapies.

Supplementary Figures. Supplementary Figure 1. Treatment schematic of SIV infection and ARV and PP therapies. Supplementary Figures Supplementary Figure 1. Treatment schematic of SIV infection and ARV and PP therapies. Supplementary Figure 2. SIV replication and CD4 + T cell count. (A) Log SIVmac239 copies/ml

More information

Proteins. Amino acids, structure and function. The Nobel Prize in Chemistry 2012 Robert J. Lefkowitz Brian K. Kobilka

Proteins. Amino acids, structure and function. The Nobel Prize in Chemistry 2012 Robert J. Lefkowitz Brian K. Kobilka Proteins Amino acids, structure and function The Nobel Prize in Chemistry 2012 Robert J. Lefkowitz Brian K. Kobilka O O HO N N HN OH Ser65-Tyr66-Gly67 The Nobel prize in chemistry 2008 Osamu Shimomura,

More information

Cholesterol determination using protein-templated fluorescent gold nanocluster probes

Cholesterol determination using protein-templated fluorescent gold nanocluster probes Electronic Supplementary Information for Cholesterol determination using protein-templated fluorescent gold nanocluster probes Xi Chen and Gary A. Baker* Department of Chemistry, University of Missouri-Columbia,

More information

DNA codes for RNA, which guides protein synthesis.

DNA codes for RNA, which guides protein synthesis. Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription

More information

Lipoprotein Lipase Activity Assay Kit (Fluorometric)

Lipoprotein Lipase Activity Assay Kit (Fluorometric) Lipoprotein Lipase Activity Assay Kit (Fluorometric) Catalog Number KA4538 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General

More information

PROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.

PROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms. PROTEIN SYNTHESIS It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.» GENES = a sequence of nucleotides in DNA that performs

More information

Development of a Human Cell-Free Expression System to Generate Stable-Isotope-Labeled Protein Standards for Quantitative Mass Spectrometry

Development of a Human Cell-Free Expression System to Generate Stable-Isotope-Labeled Protein Standards for Quantitative Mass Spectrometry Development of a Human Cell-Free Expression System to Generate Stable-Isotope-Labeled Protein Standards for Quantitative Mass Spectrometry Ryan D. omgarden 1, Derek aerenwald 2, Eric Hommema 1, Scott Peterman

More information

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server.

a b G75 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a b G75 2 2 G60 Sw-2 Sw-1 Supplementary Figure 1. Structure predictions by I-TASSER Server. a. Overlay of top 10 models generated by I-TASSER illustrates the potential effect of 7 amino acid insertion

More information

igem2013 Microbiology BMB SDU

igem2013 Microbiology BMB SDU igem2013 Microbiology BMB SDU Project type: Creation of Biobrick with Prenyltransferase Project title: Biobrick_Prenyltransferase Sub project: Creation date: 13.08.09 Written by: SIS Performed by: PRA,

More information

Supplementary information

Supplementary information Supplementary information Supplementary Figure 1: Components of Arabidopsis tricarboxylic acid (TCA) cycle. Schematic summary of the TCA cycle and the enzymes related to the reactions. The large text and

More information

Mouse Cathepsin B ELISA Kit

Mouse Cathepsin B ELISA Kit GenWay Biotech, Inc. 6777 Nancy Ridge Drive San Diego, CA 92121 Phone: 858.458.0866 Fax: 858.458.0833 Email: techline@genwaybio.com http://www.genwaybio.com Mouse Cathepsin B ELISA Kit Catalog No. GWB-ZZD154

More information

-51mV 30s 3mV. n=14 n=4 p=0.4. Depolarization (mv) 3

-51mV 30s 3mV. n=14 n=4 p=0.4. Depolarization (mv) 3 Supplementary Figure 1 a optoβ 2 -AR b ChR2-51mV 30s 3mV -50mV 30s 3mV c 4 n=14 n=4 p=0.4 Depolarization (mv) 3 2 1 0 Both optogenetic actuators, optoβ 2 AR and ChR2, were effective in stimulating astrocytes

More information

Use of a camp BRET Sensor to Characterize a Novel Regulation of camp by the Sphingosine-1-phosphate/G 13 Pathway

Use of a camp BRET Sensor to Characterize a Novel Regulation of camp by the Sphingosine-1-phosphate/G 13 Pathway Use of a camp BRET Sensor to Characterize a Novel Regulation of camp by the Sphingosine-1-phosphate/G 13 Pathway SUPPLEMENTAL DATA Characterization of the CAMYEL sensor and calculation of intracellular

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

Dynamic Partitioning of a GPI-Anchored Protein in Glycosphingolipid-Rich Microdomains Imaged by Single-Quantum Dot Tracking

Dynamic Partitioning of a GPI-Anchored Protein in Glycosphingolipid-Rich Microdomains Imaged by Single-Quantum Dot Tracking Additional data for Dynamic Partitioning of a GPI-Anchored Protein in Glycosphingolipid-Rich Microdomains Imaged by Single-Quantum Dot Tracking Fabien Pinaud 1,3, Xavier Michalet 1,3, Gopal Iyer 1, Emmanuel

More information

Central Dogma. Central Dogma. Translation (mrna -> protein)

Central Dogma. Central Dogma. Translation (mrna -> protein) Central Dogma Central Dogma Translation (mrna -> protein) mrna code for amino acids 1. Codons as Triplet code 2. Redundancy 3. Open reading frames 4. Start and stop codons 5. Mistakes in translation 6.

More information

Supplemental Figure 1

Supplemental Figure 1 1 Supplemental Figure 1 Effects of DATE shortening on HGF promoter activity. The HGF promoter region (-1037 to +56) containing wild-type (30As) or truncated DATE (26As, 27As, 28A, 29As) from breast cancer

More information

Nature Methods: doi: /nmeth Supplementary Figure 1. Salipro lipid particles.

Nature Methods: doi: /nmeth Supplementary Figure 1. Salipro lipid particles. Supplementary Figure 1 Salipro lipid particles. (a) Gel filtration analysis of Saposin A after incubation with the indicated detergent solubilised lipid solutions. The generation of Saposin A-lipid complexes

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

Supporting Information. Lysine Propionylation to Boost Proteome Sequence. Coverage and Enable a Silent SILAC Strategy for

Supporting Information. Lysine Propionylation to Boost Proteome Sequence. Coverage and Enable a Silent SILAC Strategy for Supporting Information Lysine Propionylation to Boost Proteome Sequence Coverage and Enable a Silent SILAC Strategy for Relative Protein Quantification Christoph U. Schräder 1, Shaun Moore 1,2, Aaron A.

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

Nature Immunology: doi: /ni.3631

Nature Immunology: doi: /ni.3631 Supplementary Figure 1 SPT analyses of Zap70 at the T cell plasma membrane. (a) Total internal reflection fluorescent (TIRF) excitation at 64-68 degrees limits single molecule detection to 100-150 nm above

More information

Study of different types of ubiquitination

Study of different types of ubiquitination Study of different types of ubiquitination Rudi Beyaert (rudi.beyaert@irc.vib-ugent.be) VIB UGent Center for Inflammation Research Ghent, Belgium VIB Training Novel Proteomics Tools: Identifying PTMs October

More information

Accurate prediction of cellular co-translational folding indicates proteins can switch from post- to co-translational folding

Accurate prediction of cellular co-translational folding indicates proteins can switch from post- to co-translational folding Received 26 Jan 25 Accepted Dec 25 Published 8 Feb 26 DOI: 38/ncomms34 OPEN Accurate prediction of cellular co-translational folding indicates proteins can switch from post- to co-translational folding

More information