Chemically Modified Synthetic microrna-205 Inhibits the Growth of Melanoma Cells In Vitro and In Vivo

Transcription

1 originl rticle The Americn Society of Gene & Cell Therpy Chemiclly Modified Synthetic microrna-25 Inhibits the Growth of Melnom Cells In Vitro nd In Vivo Shunsuke Noguchi 1, Juny Iwski 1,2, Minmi Kumzki 1,2, Tkshi Mori 3,4, Kohji Mruo 3,4, Hiroki Ski 4,5, Nmi Ymd 6, Kzuyuki Shimd 7, Tomoki Noe 7, Yukio Kitde 2 nd Yukihiro Ako 1,4 1 United Grdute School of Drug Discovery nd Medicl Informtion Sciences, Gifu University, Gifu, Jpn; 2 Grdute School of Engineering, Gifu University, Gifu, Jpn; 3 Deprtment of Veterinry Clinicl Oncology, Fculty of Applied Biologicl Sciences, Gifu University, Gifu, Jpn; 4 Comprtive Cncer Center, Gifu University, Gifu, Jpn; 5 Deprtment of Veterinry Pthology, Fculty of Applied Biologicl Sciences, Gifu University, Gifu, Jpn; 6 United Grdute School of Veterinry Medicl Sciences, Gifu University, Gifu, Jpn; 7 Grdute School of Medicine, Ngoy University, Ngoy, Jpn microrna (mir)-25 is downregulted nd cts s tumor suppressor in humn melnom cells. Previously, for clinicl ppliction, we dded romtic benzenepyridine (BP-type) nlogs to the 3 -overhng region of the RNA-strnd nd chnged the sequences of the pssenger strnd in the mir-143 duplex. Here, we demonstrted the ntitumor effect in vitro nd in vivo of mir-25 tht ws lso chemiclly modified by BP nd hd ltered pssenger sequence. In in vitro experiments, trnsfection with the synthetic mir-25 () significntly inhibited the growth of humn melnom cells. Exogenous suppressed the protein expression levels of E2F1 nd VEGF, which re vlidted trgets of mir-25-5p, nd BCL2, trnscribed molecule of E2F1, s did, used s mir-25 mimic hving the wild-type sequence. On the bsis of the results of luciferse ctivity ssy, directly trgeted E2F1, s did. However, ws much more resistnt to RNse thn in fetl bovine serum nd to RNse in mice xenogrfted with humn melnom tissues. In ddition, the intrtumorl injection of exhibited significnt ntitumor effect compred with the cse of control mirna or in humn melnom cell-xenogrfted mice. These findings indicte tht is possible promising therpeutic modlity for melnom. Received 22 December 212; ccepted 2 Mrch 213; dvnce online publiction 3 April 213. doi:1.138/mt INTRODUCTION Mlignnt melnom is one of the most common skin cncers in humns. 1 The incidence of this cncer continues to rise more rpidly thn tht of ll other mlignncies, except for lung cncer. 2 Mlignnt melnom is spontneous, highly ggressive neoplsm tht cn redily metstsize to other orgns. In recent studies on it, both MAPK nd PI3K/AKT signling pthwys hve been mtter of focus, the signling of which re known to be constitutively ctivted through multiple mechnisms. 3 BRAF inhibitors, MEK inhibitors, nd ipilimumb (n nti-ctla-4 monoclonl ntibody) re promising new therpies for humn mlignnt melnom. 4 However, sfer nd more effective therpies re to be desired. micrornas (mirna; mir) hve emerged recently s lrge group of short (18 25 nucleotides), noncoding, smll RNA molecules tht negtively regulte gene expression. 5 7 Over 1,3 mirnas re predicted to exist in humns (mirbse; mirbse.org/). Nevertheless, the ltest study indictes tht these previous estimtes of conserved mirnas might be inflted. 8 Although the specific biologicl functions of most mirnas remin lrgely unknown, these molecules re believed to constitute lrge gene regultory network tht cn modulte the expression of up to 3% of totl cellulr proteins. There is incresing experimentl evidence supporting the role of mirnas in the regultion of wide rnge of physiologicl or pthophysiologicl responses, including development, 9 cellulr poptosis, 1 differentition, 11 cell prolifertion, 12 nd cncer Severl studies by us nd other groups hve shown tht mir- 25 is downregulted nd cts s n ntioncomir by trgeting E2F1, ZEB2, nd ERBB3 in humn nd cnine melnoms It hs been suggested tht the downregultion of mir-25 in humn melnom is ssocited with the loss of chromosome 1q32, on which mir-25 is locted. 22 Also, Liu et l. reported tht mir-25 regultes the migrtion of melnom cells nd tht the expression level of mir-25 is ssocited with melnom progression. 21 Thus, mir-25 is one of the most importnt ntioncomirs in the cse of cnine nd humn melnoms. Accordingly, we consider the ppliction of mir-25 for melnom tretment to be resonble nd promising. However, for clinicl ppliction, the problem of degrdtion by RNA nuclese must be solved, nd more efficient modifiction of mirnas nd their drug delivery system must be devised. For replcement therpy using ntioncomirs, retrovirl expression vectors re minly evluted. 23 On the other hnd, we recently showed tht mirna with chemicl modifiction t its 3 -overhng portion cquires resistnce to RNse nd tht when its pssenger sequence is ltered the mirna exhibits greter Correspondence: Shunsuke Noguchi, 1-1 Yngido, Gifu , Jpn. E-mil: snoguchi@gifu-u.c.jp vol. 21 no. 6, june 213

2 The Americn Society of Gene & Cell Therpy Synthetic microrna-25 Suppresses Melnom Growth tumor-suppressive effect thn unltered wild-type mirna becuse of incresed ffinity for Argonute 2 (Ago2) protein In this study, we showed tht the ddition of n romtic benzene-pyridine (BP) nlog to the 3 -overhng region of the double-strnded mir-25 nd ltertion of the pssenger sequence (mir-25bps) resulted in resistnce to RNse in vitro nd long-term stbility in vivo compred with those properties of purchsed from Applied Biosystems (Foster City, CA). Furthermore, one of the synthetic mir-25bps showed significnt tumor-suppressive effect on mice xenogrfted with humn melnom cells in vivo. Here, we discussed the tumor- suppressive mechnism of the synthetic mir-25bp nd differences between nd the synthetic mir-25bp. These findings suggest tht the synthetic mir-25bp my hve potentil therpeutic effectiveness ginst melnom. RESULTS Synthetic showed the gretest growth-suppressive effect on melnom cells mong eight different synthetic mir-25bps We synthesized eight different types of mir-25bps hving different structures of the double strnd for the experiment on cell vibility (Figure 1). The structure of BP is shown in Supplementry Figure S1. rol mirna 5 - -BP Mismtched portion mir-25/bp-mm1,2,3,4,5,6 (mir-25bp/s1) uc u c g g 5 - cuuc uccc g ucug -BP 3 -BP ggu ggug c u gc uu g u u mir-25/bp-mm1,2,3 () uc u 5 - cuuc uccccgggucug -BP 3 -BP ggu gguggccucgc uu g mir-25/bp-mm1,2 (mir-25bp/s5) uc 5 - cuucuuccccgggucug- BP 3 -BP ggugguggccucgc uu Wild-type mir-25 (mir-25/s1) uc u c g g 5 - cuuc uccc g ucug 3 - ggu ggug c u gc uu g u u mir-25/bp-mm1,2,3,5 (mir-25bp/s2) uc u g 5 - cuuc uccccg gucug -BP 3 -BP ggu gguggc ucgc uu g u mir-25/bp-mm1,2,3 + 1 (mir-25bp/s4) ucc u 5 - uuc uccccgggucug -BP 3 -BP gu gguggccucgc uuc g mir-25/bp-mm (mir-25bp/s6) 5 - uccuucuuccccgggucug -BP 3 -BP gggugguggccucgc mir-25/bp-mm3,4,5,6 (mir-25bp/s7) u c g g 5 - uccuuc uccc g 3 -BP gggu ggug c u g u u ucug -BP gc mir-25/bp-mm3,4,5,6 (mir-25bp/s8) c g 5 - uccuucuuccc g g ucug -BP mir-25/-mm1,2,3 (mir-25/s3) uc u 5 - cuuc uccccgggucug 3 -BP ggguggug c u u u gc 3 - uu ggu gguggccucgc g Figure 1 Sequences of the vrints of mir-25 with or without BP used in this study. The sequence of is sme s tht of the wildtype mir-25 (mir-25/s1). Vible cell number (% of cont) S1 S2 S3 S4 S5 S6 S7 A258 S8 Vible cell number (% of cont) Mewo Figure 2 Number of vible A258 nd Mewo cells trnsfected with control mirna,, or ech synthetic mir-25bp (1 nmol/l). Cell counts were performed t 96 (A258) or 12 (Mewo) hours fter the trnsfection. P <.5, P <.1. P vlues were determined for differences between the cells trnsfected with control mirna nd those trnsfected with or ech mir-25bp tested. Mens + SD indicted by error brs re shown. Moleculr Therpy vol. 21 no. 6 june

3 Synthetic microrna-25 Suppresses Melnom Growth The Americn Society of Gene & Cell Therpy A258 Mewo b E2F1 VEGF BCL2 PARP-1 β-ctin Proform -Cleved form Apoptotic cell number (%) Tretment (concentrtion; 1 mmol/l) Figure 3 The effects of trnsfections with or on the protein expression levels of trget genes of mir-25 nd the relted genes. () Protein expression levels of vlidted mir-25 trget genes, E2F1 nd VEGF, downstrem of E2F1, BCL2, nd PARP-1 in A258 nd Mewo cells. The numericl vlues under the pnels indicte the densitometric vlue (/β-ctin). Extrction of protein ws performed t 96 (A258) or 12 (Mewo) hours fter the trnsfection. (b) Number of poptotic cells, which were identified by frgmenttion or ggregtion of nuclei under Hoechst33342 stining, in A258 cells trnsfected with ech mirna. P <.5. P vlues were determined for differences between the cells trnsfected with ech mirna. Hoechst33342 stining ws performed t 96 hours fter the trnsfection. Mens + SD indicted by error brs re shown. First, we exmined the growth-suppressive effect of these synthetic mir-25bps on melnom cells to determine which type ws the most effective. Among them, mir-25bp/s2, mir- 25BP/S3, mir-25bp/s5, mir-25bp/s6, mir-25bp/s7, nd mir-25bp/s8 significntly suppressed the growth of A258 cells; lthough hd the gretest effect of ll mir-25s tested (Figure 2). showed the gretest growth suppression mong the synthetic mir-25bps. The growth-suppressive ctivity of ws lmost the sme in Mewo cells s in A258 cells (Figure 2). suppressed the expression levels of E2F1, VEGF, nd BCL2 in melnom cells nd induced poptosis in A258 cells s did As E2F1 nd VEGF were erlier verified to be trgets of mir-25-5p in melnom nd brest cncer cells, 22,27 we vlidted tht mir- 25BP/S3 suppressed the expression levels of these genes in melnom. Expectedly, trnsfection with suppressed the protein expression levels of E2F1 nd VEGF; lthough the effect of ws less potent thn tht of (Figure 3). In ddition, the expression level of ntipoptotic BCL2, which is molecule trnscribed downstrem of E2F1, ws lso decresed by the tretment with or. It ws reported previously tht mir-25 induces poptosis. 22 Our dt lso reveled tht the trnsfection with or led to PARP-1 clevge in A258 cells, not but in Mewo cells. The number of poptotic cells judged by Hoechst33342 stining ws significntly incresed by the tretment with nd tended to increse in the cse of (Figure 3b). directly trgeted E2F1 s did To vlidte whether trgeted the sme gene s PremiR-25 did, we performed luciferse ctivity ssy for E2F1. Expectedly, compred with tht of the control, the luciferse ctivity of the wild-type pmir-e2f1 ws significntly inhibited fter the introduction of or into A258 Position of E2F1 3 UTR 5 hs-mir-25 Mut-E2F1 3 UTR -1 (Mut-1) Mut-E2F1 3 UTR -2 (Mut-2) Luciferse ctivity (% of cont) Wild 3 Mut-1 Mut-2 Figure 4 Luciferse ctivities fter cotrnsfection with control mirna,, or nd ech of the sensor vectors with the wild or mutted 3 -UTR of E2F1. The upper pnel shows the regions of the 3 -UTR of humn E2F1 mrna complementry to mture mir-25. The red box indictes the predicted binding sites for mir-25. P <.1. P vlues were determined for differences between the brcketed smples. Dt re expressed s the mens + SD indicted by the error brs. cells (Figure 4). Muttions of the E2F1 3 -UTR-binding site (Mut-1 nd Mut-2) mrkedly bolished the bility of mir-25bp/ S3 to regulte luciferse expression nd tended to lessen tht of to do so. These results demonstrte tht both PremiR-25 nd directly trgeted E2F1. Silencing E2F1 inhibited the cell growth nd induced poptosis in A258 cells E2F1 is one of the key molecules involved in cell prolifertion nd plys centrl role in melnom progression. 28,29 Therefore, vol. 21 no. 6 june 213

4 The Americn Society of Gene & Cell Therpy Synthetic microrna-25 Suppresses Melnom Growth b c vible cell number (% of cont) sir-e2f1 Tretment (concentrtion; 1 nmol/l, 72 hours) E2F1 BCL2 PARP-1 β-ctin sir-e2f1 -Proform -Cleved form Apoptotic cell number (%) sir-e2f1 Tretment (concentrtion; 1 nmol/l) Figure 5 The effect of E2F1 knockdown in A258 cells. () Comprison of the number of vible cells between A258 cells trnsfected with control mirna nd those treted with sir-e2f1. (b) Protein expression levels of E2F1 nd the predicted signling molecule downstrem of E2F1, BCL2, nd PARP-1 in A258 cells trnsfected with control mirna or sir-e2f1. (c) Number of poptotic cells, which were identified by frgmenttion or ggregtion of nuclei by Hoechst33342 stining, mong A258 cells trnsfected with control mirna or sir-e2f1. The ssy ws performed t 96 hours fter the trnsfection. P <.1. Mens + SD indicted by error brs re given. we confirmed tht E2F1 contributes to the growth of A258 cells by using sirna. As result, silencing E2F1 significntly inhibited the growth, consistent with suppression of the E2F1 expression level (Figure 5,b). In ddition, the expression level of BCL2 ws decresed; nd poptosis, which ws indicted by PARP-1 clevge nd Hoechst33342 stining, ws lso induced by silencing E2F1 (Figure 5b,c). ws much more stble thn PremiR-25 in fetl bovine serum nd in vivo We showed erlier tht the ddition of n romtic compound to the 3 -overhng region of the RNA-strnd enhnces its resistnce ginst nuclese ttck. 24,26 Therefore, we vlidted tht ws lso more resistnt to RNse compred with. Consistent with our previous studies, the ddition of BP to the 3 -overhng region of mir-25 (mir-25bp/s1 nd ) significntly improved the resistnce ginst RNA nucleses fter 1 minutes compred with the resistnce shown by mir-25/s1, mir-25/s3, nd, which were unmodified by BP (Figure 6). Importntly, the percentge of mir-25bp/ S3 remining ws mrkedly higher thn tht of mir-25bp/s1. In ddition, we evluted the stbility of nd in vivo. As shown in Figure 6b, the bsolute expression level of mir-25 t 24, 48, nd 96 hours fter the tumor hd been injected with ws significntly higher compred with tht for the tumor injected with ; lthough the expression level of mir-25 t 96 hours fter the tumor injected with ws mrkedly higher (>1,-fold) thn tht for the tumor injected with control mirna (the bsolute expression level of mir-25; 5.7 ± 1.2 ttomol versus.18 ±.55 zeptomol). Bsed on these findings, we determined tht the frequency of injection should be two times per week nd therefore used this schedule in the following ntitumor experiment using mouse model. Tumor-suppressive effect of chemiclly modified synthetic mir-25bp () in vivo To exmine the ntitumor effect of mir-25 in vivo, we dministered, or control mirna by intrtumorl injection into nude mice bering A258 tumors. As result, t the second dministrtion, significnt growth-suppressive effect ws observed in the group injected with compred b Remining rte of mir-25s ( minutes vlue s 1%) Absolute mir-25 expression level (pmol) (Hours) 2 3 (Minutes) Figure 6 Decy of the vrious vrints of mir-25 in () fetl bovine serum or (b) in mice xenogrfted tumor tissues, evluted by performing rel-time reverse trnscriptse PCR using the TqMn mirna ssy. () The % of mir-25 remining is expressed for ech smple indicted in the figure. (b) The bsolute expression level of mir-25 bsed on the stndrd curve method is expressed. Significnt difference between the cells trnsfected with -5p nd those with, those with mir-25/s3 nd those with, nd those with mir-25bp/s1 nd those with mir-25/s1.,, P <.1. Mens + SD indicted by error brs re given. with the growth in the control mirna-injected group (Figure 7). Furthermore, t the third dministrtion, showed significnt growth-suppressive effect compred with. In ddition, the tumor weight t the end of the experiment ws lso significntly lower in the group injected with thn in tht treted with the control mirna (Figure 7b). Importntly, PremiR-25 did not exhibit growth suppression of either tumor volume mir-25/s1 mir-25bp/s1 mir-25/s3 Moleculr Therpy vol. 21 no. 6 june

5 Synthetic microrna-25 Suppresses Melnom Growth The Americn Society of Gene & Cell Therpy Tumor volume (cm 3 ) dys T dys S b Tumor weight (g) P =.1856 d E2F1 mir-25 BCL2 c-myc Cyclin E/A etc. VEGF Cell survivl Cell prolifertion c E2F VEGF BCL2 β-ctin Reltive expression level of E2F Reltive expression level of VEGF Reltive expression level of BCL Figure 7 Tumor-suppressive effects of mir-25/s3 in mice bering xenogrfted A258 cells. () Time course of tumor size in mice injected with control mirna, or. P vlues were determined for differences between the tumors injected with control mirna nd those injected with mir-25/s3, between the tumors injected with nd those injected with or between the tumors injected control mirna nd those injected with.,, P <.5. (b) Comprison of weight of tumors removed from mice t the dy of scrifice, with mirnas injected into the tumors indicted on the bsciss. Significnt difference between brcketed smples (P <.5). Mens + SD indicted by error brs re given. (c) Expression levels of E2F1, VEGF, nd BCL2 in the tumors injected with ech mirna re shown in the upper pnel. The grphs in the lower pnel show the reltive expression level of E2F1, VEGF, or BCL2 normlized to β-ctin. Mens ± SD indicted by error brs re given. (d) A flow digrm on the mir-25 on its trget genes nd the relted pthwys. S, scrifice; T, trnsplnttion; tringles, intrtumorl injection. or weight, lthough the tumor volume of the group injected with ws significntly smller thn tht of control mirna group t the second dministrtion. In ddition, the expression levels of E2F1 nd BCL2 showed tendency to decrese in the nd groups compred with their levels in the control group; lthough the effect ws not significnt (Figure 7c). However, if one of the smples (No. 1) ws excluded, the expression level of E2F1 in the groups of nd ws significntly lower thn tht in the control (control versus, P =.48; control versus, P =.27). We lso pthologiclly exmined the tumor-suppressive effects on the tumor tissues. However, unfortuntely, no significnt findings such s poptosis, necrosis or suppression of invsion by dministrtion were observed compred with these findings for the other groups (Supplementry Figure S2). No dverse effects on the locl skin or strom round the tumor tissues were detected. DISCUSSION We focused on the ntitumor effects of mir-25 in melnom, becuse the previous studies by us nd others reveled tht mir- 25 is downregulted in these tumors nd functions s n ntioncomir. 2,22,3 In this study, we successfully showed tht synthetic mir-25,, which ws chemiclly modified by dding BP to the 3 portion of the double strnds nd ltering the pssenger sequence, exhibited significnt tumor-suppressive effects on humn melnom cells both in vitro nd in vivo. In the in vitro experiments, however, the ntitumor effect of ws less potent thn tht of, which is commercilly vilble mir-25 mimic from Applied Biosystems. The ddition of BP to wild-type mir-25 unfortuntely resulted in loss of function of mir-25; becuse mir-25bp/s1, which ws chemiclly modified by BP but not ltered in its pssenger sequence, could not exert the growth-suppressive effect in the melnom vol. 21 no. 6 june 213

6 The Americn Society of Gene & Cell Therpy Synthetic microrna-25 Suppresses Melnom Growth cells tested. Also, the suppressive effect of mir-25/s3, which ws unmodified by BP, on the E2F1 expression level ws greter thn tht of, lthough the growth-suppressive effect of mir-25/s3 ws lmost equivlent to tht of (Supplementry Figure S3). These results suggest tht BP modifiction reduced the function of mir-25 nd tht the pssenger sequence must be ltered to rescue the function of the synthetic mir-25 chemiclly modified by BP. However, we could not find ny reltionship between the ctivity nd structures of the double strnds by chnging the pssenger sequence. Furthermore, the melting temperture of ech synthetic mir-25bp lso did not show ny reltionship with the degree of the growth-suppressive effect (dt not shown). The ntitumor mechnisms of were similr to those of, becuse both mirnas trgeted E2F1. These findings indicte tht the guide strnd of functioned like tht of. It is reported tht mir-25 overexpression in melnom cells induces cellulr senescence nd poptosis with cspse-3 ctivtion nd cytochrome c relese. 22 Consistent with tht previous report, we lso observed poptosis in A258 cells, but not in Mewo cells, by tretment with or. The poptosis induction ws ssocited with E2F1 downregultion s the sirna experiment indicted. However, in this study, obvious cellulr senescence, which ws exmined by senescence ssocited-β-glctosidse stining, nd cspse-9 ctivtion were not observed in A258 nd Mewo cells (dt not shown). Accordingly, the mechnisms of tumor-suppressive effect including poptosis nd/or senescence induction depend on the type of melnom cell lines exmined. On the other hnd, exhibited greter tumorsuppressive effect thn in vivo, in spite of the smller ntitumor effects of in vitro. This difference could be relted to resistnce to RNse. ws obviously more stble thn both in vitro nd in vivo. The results shown in Figure 6 indicte tht BP modifiction ttenuted the degrdtion of RNA by exonuclese nd tht the chnge in double-strnded structure by ltertion of the pssenger sequence prevented the degrdtion by endonuclese. In the in vivo experiment, t the time of the second dministrtion, both nd showed significnt tumor-suppressive effect compred with control mirna. However, fter the second dministrtion, did not exhibit tumor-suppressive effect ny more. RNse is bundnt in tumor tissue including tumor cells nd strom, nd the mount of RNse my increse s tumor tissue grows. We consider tht this incresing mount of RNse would hve fforded esy degrdtion of the. No differences in the degree of ntitumor effects such s poptosis, necrosis or the suppression of vsculriztion nd invsion following ech mirna dministrtion were pthologiclly observed in the treted tumor tissues (Supplementry Figure S2). In ddition, innte immune responses such s invsion by nturl killer cells or lymphocytes by the tretment with exogenous mirna were not observed. Also, the induction of interferons nd interferon-stimulted genes such s OAS1 ws not observed in the cells trnsfected with or (Supplementry Figure S2b). The expression level of E2F1, mir-25 trget gene, ws significntly decresed by the dministrtion of or if the No.1 smple in Figure 7c, which ws injected with control mirna, ws excluded from the experiment. These findings indicte tht lso functioned like mir-25 in vivo. The E2F1 expression level of the smple from No. 1 ws exceptionlly low. The region used for protein extrction in the No.1 tumor tissue might hve included much strom or necrotic region compred with tht used for other smples in the control group. In conclusion, mir-25 functioned s n ntioncogenic mirna by trgeting E2F1 in humn melnom cells (Figure 7d), consistent with n erlier study. 22 Furthermore, the synthetic mir- 25BP/S3 tht ws generted by chemicl modifiction by dding BP to the 3 region of the double strnds nd ltertion of the pssenger sequence cted like wild-type mir-25 nd showed tumor-suppressive effect on mice xenogrfted with humn melnom cells, which effect probbly reflected resistnce to RNse. This study suggests tht cn be new therpeutic modlity for the tretment of melnom by locl injection. In further study bsed on the present results, we will consider the clinicl ppliction of for cnine orl melnom, in which mir-25 is downregulted nd mir-25 cts s n ntioncomir, s it does in humn melnom. 2 MATERIALS AND METHODS Cell culture nd cell vibility. Humn mlignnt melnom cell lines A258 nd Mewo were purchsed from Helth Science Reserch Resources Bnk (Osk, Jpn), nd the cells were mintined ccording to the mnufcturer s protocol. The number of vible cells ws determined by performing the trypn blue dye exclusion test. Cell trnsfection with mirna or sirna. A258 or Mewo cells were seeded into six-well pltes t the concentrtion of cells per well the dy before trnsfection. We used (Applied Biosystems), which hs the sme sequences s wild-type mir-25 (mir-25/s1) nd is generlly vilble s representtive mir-25 mimic. or synthetic mir-25s (Hokkido System Sciences, Spporo, Jpn) with n romtic BP nlog dded to their 3 -overhng region (mir-25bp; Supplementry Figure S1) nd with the pssenger sequence of the mismtched portion between pssenger nd guide strnds chnged to mtched ones (mir-25bp/s) ws used for the trnsfection of the cells. Trnsfection ws chieved by using ctionic liposomes, Lipofectmine RNAiMAX (Invitrogen, Crlsbd, CA) t concentrtion of 1 nmol/l, ccording to the mnufcturer s Lipofection protocol. The sequences of the synthetic mir-25bps used in this study were shown in Figure 1. All combintions to mtch ech of the six mismtched portions re considered to be 72 combintions. To generte typicl synthetic mir-25bps, we chose eight different types; becuse there were too mny for us to generte ll types. In detil, we generted mir-25bp with non-ltered sequences, one with ll mismtched portions mtched, nd ones mtched minly mismtched portions t the 3 or 5 region of the guide strnd. Short interfering RNA (sirna) for E2F1 (1 nmol/l) ws lso used for trnsfection of A258 cells. Its sequence ws 5 -UCGGCACCUGAGAAGCCUCUUGAAA-3 (sir-e2f1; Invitrogen). To determine precise BP modified control mirna, we exmined the effects of two types of control mirna on the cell growth nd E2F1 expression. As shown in Supplementry Figure S3, the effects of the control mirna designted s cont/19 mer, which ws used in our previous studies, 25,26 nd nother control mirna termed cont/22 mer showed no obvious difference on the growth of A258 cells. However, the trnsfection with cont/22 mer tended to decrese E2F1 expression level compred with cont/19 mer. Therefore, we decided to use cont/19 mer. Moleculr Therpy vol. 21 no. 6 june

7 Synthetic microrna-25 Suppresses Melnom Growth The Americn Society of Gene & Cell Therpy Both of the control mirnas were obtined from Hokkido System Sciences. The sequences of the non-specific double-strnded control mirnas used in this study re given in Figure 1. Western blotting. Totl protein ws extrcted from whole cells by the procedure described previously. 25 Protein contents were mesured with DC Protein Assy Kit (Bio-Rd, Hercules, CA). Ten microgrms of lyste protein for Western blotting ws seprted by SDS-PAGE using polycrylmide gels nd electroblotted onto PVDF membrne (PerkinElmer Life Sciences, Boston, MA). Detils of the method used fter blotting were described erlier. 25 The ntibodies used in this study were ntihumn E2F1 mouse monoclonl ntibody, ntihumn VEGF mouse monoclonl ntibody, ntihumn BCL2 mouse monoclonl ntibody, nd ntihumn PARP-1 mouse monoclonl ntibody (Snt Cruz, Snt Cruz, CA), ll of which were properly diluted with TBS-T contining 2% bovine serum lbumin nd.1% sodium zide. The loding control ws prepred by reincubting the sme membrne with ntihumn β-ctin ntibody (Sigm, St Louis, MO). Quntittive reverse trnscriptse PCR using rel-time PCR. Totl RNA ws isolted from cells by the phenol/gunidium thiocynte method with DNse I tretment. To determine the expression of mirnas, we used TqMn MicroRNA Assy (hs-mir-25; Applied Biosystems) to reverse trnscribe the mture mirna sequences to its cdna. The PCR procedure ws performed by rel-time PCR. Briefly, fter reverse trnscription of 25 ng of totl RNA, cdna ws generted. The PCR rection consisted of 4 cycles (95 C for 5 seconds, 6 C for 3 seconds) fter n initil denturtion step (95 C for 1 seconds). The threshold cycle (Ct) ws defined s the frctionl cycle number t which the fluorescence psses fixed threshold. The expression level of mir-25 in ech smple ws mesured in terms of Ct vlue. The reltive expression level of mir-25 ws clculted by the ΔΔCt method, nd the bsolute expression level of mir-25 ws clculted bsed on the stndrd curve of or. Hoechst33342 stining. For ssessment of the morphologicl chrcteristics of poptosis, A258 cells were collected t 96 hours fter the trnsfection. The cells were stined with Hoechst33342 (5 μg/ml) t 37 C for 1 hour, wshed once with phosphte-buffered sline, resuspended, pipetted dropwise onto glss slide, nd exmined by fluorescence microscopy using n Olympus microscope (Tokyo, Jpn) equipped with n epiillumintor nd pproprite filters. The cells with condensed nd/or frgmented nuclei stined with Hoechst33342 were ssessed to be poptotic, nd the number of poptotic cells mong 1, cells ws counted. Assy for luciferse ctivity. We constructed the sensor vector by joining the regions with possible binding site from the 3 -UTR of humn E2F1 to luciferse reporter pmir-control vector (Applied Biosystems) to exmine the trget sequence recognized by mir-25-5p. For mplifiction of E2F1 mrna, totl RNA ws reverse trnscribed with PrimeScript RT Regent Kit (TKR, Otsu, Jpn). The sequences of the primers used in this study were s follow: E2F1-sense- 1996, TGTGCAATCAGGTGTCTCTC; E2F1- ntisense- 235, TTCATCCAGAAGGCTGTGGA. Also, to generte the sensor vectors with 2 or 3 muttions in the binding site for mir-25-5p, we mutted seed regions from AUGAAGG to AUGCCGG (mt1) or AUUCCGG (mt2; PrimeSTAR Mutgenesis Bsl Kit; TKR). The sensor vectors with muttions were submitted to Life Science Reserch Center, Gifu University for DNA sequencing. The cells were seeded in 12-well pltes t concentrtion of /well the dy before the trnsfection. The sensor vector (concentrtion;.5 μg/well) nd 2 nmol/l, or non-specific control mirna (Dhrmcon, Tokyo, Jpn) ws used for the cotrnsfection of the cells by using ctionic liposomes Lipofectmine RNAiMAX. Forty-eight hours fter the cotrnsfection, luciferse ctivities were mesured by using Dul-Glo Luciferse Assy System (Promeg, Mdison, WI) ccording to the mnufcturer s protocol. Firefly luciferse ctivity ws normlized to Renill luciferse ctivity. Assy for stbility of mirna in vitro. To evlute the stbility of mirna in vitro, we dditionlly obtined mir-25/s1 nd mir-25/s3 (Figure 1), which were unmodified by BP, from Hokkido System Sciences. We incubted 2 pmol of, mir-25bp/s1, mir-25/s1, mir-25bp/ S3, or mir-25/s3 without Lipofectmine RNAiMAX in 1 μl of fetl bovine serum (Hyclone Lbortories, Logn, UT) t 37 C for, 2, 1, 2, or 3 minutes. Then, totl RNA ws isolted; nd rel-time reverse trnscriptse PCR using TqMn microrna ssy ws therefter performed to quntify the expression level of mir-25, which ws clculted by the ΔΔCt method. In vivo tumor model nd dministrtion of the mir-25/liposome complexes. BALB/cSlc-nu/nu (nude) mice were obtined from Jpn SLC (Hmmtsu, Jpn). A258 cells were concentrted to per 1 μl nd injected s.c. into the bck of ech mouse. The tumor volume ws clculted by the formul:.5236 L 1 (L 2 ) 2, where L 1 is the long xis nd L 2 is the short xis of the tumor. This formul ws described in previous report. 31 First, to decide the frequency of dministrtion of mirna, t 7 dys fter inocultion, or (.1 nmol) in 5 μl of Opti-MEM (Invitrogen) ws mixed with 2 μl of ctionic liposomes (Lipofectmine RNAiMAX); nd the mixture ws injected into the tumors t one time. At, 24, 48, 72, or 96 hours fter the injection, the mice were killed; nd the whole tissues of trnsplnted tumors were hrvested for totl RNA extrction nd subsequent evlution of their mir-25 expression level. For evlution of the ntitumor effect of mir-25s in vivo, mir-25bp/ S3,, or control mirna (.1 nmol per 1 dministrtion) in 5 μl of Opti-MEM ws mixed with 2 μl of Lipofectmine RNAiMAX; nd the mixture ws injected into the tumors twice per week. Ech group contined five mice. The evlution of the tumors ws performed fter killing the mice t 21 dys fter trnsplnttion of the tumor cells. The tissue sections from the tumors were used for pthologicl evlution, totl protein extrction, nd totl RNA extrction. Animl experimentl protocols were pproved by the Committee for Animl Reserch nd Welfre of Gifu University. Sttistics. Ech exmintion ws performed in triplicte. All clculted dt were compred by using Student s t-test except in the cse of the volume nd weight of the tumors xenogrfted into mice, which dt were compred by using Mnn Whitney U-test. A P vlue <.5 ws considered to be sttisticlly significnt. SUPPLEMENTARY MATERIAL Figure S1. The structure of BP. Figure S2. The tumor-suppressive effect of ws not relted to innte immune responses. Figure S3. Decision for which negtive control mirna to use in this study. ACKNOWLEDGMENTS This work ws supported by grnt-in-id for scientific reserch from the Ministry of Eduction, Science, Sports, nd Culture of Jpn. REFERENCES 1. Miller, AJ nd Mihm, MC Jr (26). Melnom. N Engl J Med 355: Pcheco, I, Buze, C nd Tron, V (211). Towrds new therpeutic pproches for mlignnt melnom. Expert Rev Mol Med 13: e Russo, AE, Torrisi, E, Bevelcqu, Y, Perrott, R, Libr, M, McCubrey, JA et l. (29). Melnom: moleculr pthogenesis nd emerging trget therpies (Review). Int J Oncol 34: Eggermont, AM nd Robert, C (211). New drugs in melnom: It s whole new world. Eur J Cncer 14: Sun, BS, Dong, QZ, Ye, QH, Sun, HJ, Ji, HL, Zhu, XQ et l. (28). Lentivirlmedited mirna ginst osteopontin suppresses tumor growth nd metstsis of humn heptocellulr crcinom. Heptology 48: Cnnell, IG, Kong, YW nd Bushell, M (28). How do micrornas regulte gene expression? Biochem Soc Trns 36(Pt 6): Brtel, DP (29). MicroRNAs: trget recognition nd regultory functions. Cell 136: vol. 21 no. 6 june 213

8 The Americn Society of Gene & Cell Therpy Synthetic microrna-25 Suppresses Melnom Growth 8. Ching, HR, Schoenfeld, LW, Ruby, JG, Auyeung, VC, Spies, N, Bek, D et l. (21). Mmmlin micrornas: experimentl evlution of novel nd previously nnotted genes. Genes Dev 24: Hrfe, BD (25). MicroRNAs in vertebrte development. Curr Opin Genet Dev 15: Lynm-Lennon, N, Mher, SG nd Reynolds, JV (29). The roles of microrna in cncer nd poptosis. Biol Rev Cmb Philos Soc 84: Zhng, J, Jim, DD, Jcobs, C, Fischer, R, Gottwein, E, Hung, G et l. (29). Ptterns of microrna expression chrcterize stges of humn B-cell differentition. Blood 113: Kddr, T, Rouult, JP, Chien, WW, Chebel, A, Gdoux, M, Slles, G et l. (29). Two new mir-16 trgets: cprin-1 nd HMGA1, proteins implicted in cell prolifertion. Biol Cell 11: Kunz, M (213). MicroRNAs in Melnom Biology. Adv Exp Med Biol 774: Felli, N, Felicetti, F, Lustri, AM, Errico, MC, Bottero, L, Cnnistrci, A et l. (213). mir-126&126 restored expressions ply tumor suppressor role by directly regulting ADAM9 nd MMP7 in melnom. PLoS ONE 8: e Dynoodt, P, Speeckert, R, De Wever, O, Chevolet, I, Brochez, L, Lmbert, J et l. (213). mir-145 overexpression suppresses the migrtion nd invsion of metsttic melnom cells. Int J Oncol 42: Cho, WC (212). Gret potentil of mirnas s predictive nd prognostic mrkers for cncer. Expert Rev Mol Dign 12: Cho, WC (212). MicroRNAs s therpeutic trgets nd their potentil pplictions in cncer therpy. Expert Opin Ther Trgets 16: Ctto, JW, Alcrz, A, Bjrtell, AS, De Vere White, R, Evns, CP, Fussel, S et l. (211). MicroRNA in prostte, bldder, nd kidney cncer: systemtic review. Eur Urol 59: Xu, Y, Brenn, T, Brown, ER, Doherty, V nd Melton, DW (212). Differentil expression of micrornas during melnom progression: mir-2c, mir-25 nd mir-211 re downregulted in melnom nd ct s tumour suppressors. Br J Cncer 16: Noguchi, S, Mori, T, Hoshino, Y, Ymd, N, Mruo, K nd Ako, Y (212). MicroRNAs s tumour suppressors in cnine nd humn melnom cells nd s prognostic fctor in cnine melnoms. Vet Comp Oncol (in press). 21. Liu, S, Tetzlff, MT, Liu, A, Liegl-Atzwnger, B, Guo, J nd Xu, X (212). Loss of microrna-25 expression is ssocited with melnom progression. Lb Invest 92: Dr, AA, Mjid, S, de Semir, D, Nosrti, M, Bezrookove, V nd Kshni-Sbet, M (211). mirna-25 suppresses melnom cell prolifertion nd induces senescence vi regultion of E2F1 protein. J Biol Chem 286: Cho, WC (21). MicroRNAs in cncer - from reserch to therpy. Biochim Biophys Act 185: Ueno, Y, Wtnbe, Y, Shibt, A, Yoshikw, K, Tkno, T, Kohr, M et l. (29). Synthesis of nuclese-resistnt sirnas possessing universl overhngs. Bioorg Med Chem 17: Noguchi, S, Mori, T, Hoshino, Y, Mruo, K, Ymd, N, Kitde, Y et l. (211). MicroRNA-143 functions s tumor suppressor in humn bldder cncer T24 cells. Cncer Lett 37: Ako, Y, Nkgw, Y, Hirt, I, Iio, A, Itoh, T, Kojim, K et l. (21). Role of ntioncomirs mir-143 nd -145 in humn colorectl tumors. Cncer Gene Ther 17: Wu, H, Zhu, S nd Mo, YY (29). Suppression of cell growth nd invsion by mir- 25 in brest cncer. Cell Res 19: Engelmnn, D nd Pützer, BM (212). The drk side of E2F1: in trnsit beyond poptosis. Cncer Res 72: All, V, Engelmnn, D, Niemetz, A, Phnke, J, Schmidt, A, Kunz, M et l. (21). E2F1 in melnom progression nd metstsis. J Ntl Cncer Inst 12: Gregory, PA, Bert, AG, Pterson, EL, Brry, SC, Tsykin, A, Frshid, G et l. (28). The mir-2 fmily nd mir-25 regulte epithelil to mesenchyml trnsition by trgeting ZEB1 nd SIP1. Nt Cell Biol 1: Tng, Y, Simoneu, AR, Lio, WX, Yi, G, Hope, C, Liu, F et l. (29). WIF1, Wnt pthwy inhibitor, regultes SKP2 nd c-myc expression leding to G1 rrest nd growth inhibition of humn invsive urinry bldder cncer cells. Mol Cncer Ther 8: Moleculr Therpy vol. 21 no. 6 june