Butyrate inhibits pro-proliferative mir-92a by diminishing c-myc-induced mir-17-92a cluster transcription in human colon cancer cells

Transcription

1 Hu et l. Moleculr Cncer (25) 4:8 DOI.86/s x RESEARCH Open Access inhiits pro-prolifertive mir-92 y diminishing -induced mir-7-92 cluster trnscription in humn colon cncer cells Shien Hu, Ln Liu 2, Eugene B. Chng 3, Jin-Ying Wng 2 nd Jen-Pierre Rufmn Astrct Bckground: Compromised colonic utyrte production resulting from low dietry fier or ltered gut microiot my promote colon neoplsi. Previous reports indicte these ctions re medited in prt y ltered levels of mirnas, including suppressed expression of the oncogenic mir-7-92 cluster. Here, we sought to identify the mechnisms underlying these effects of utyrte in colon cncer. Methods: mir-92 levels were mesured in rchived humn colon cncer nd djcent norml colon specimens y microrry nd quntittive RT-PCR (qpcr). The effects of utyrte nd other histone decetylse inhiitors (sueroylnilide hydroxmic cid (SAHA) nd vlproic cid) on primry (pri-mir7-92), precursor nd mture mir-92 were nlyzed in HCT-6 nd HT-29 humn colon cncer cells using qpcr. The effects of utyrte, SAHA nd vlproic cid on protein levels of, Drosh nd p57 were mesured in HCT-6 cells using immunolotting. Regultion of C3orf25 promoter ctivity y utyrte ws nlyzed y luciferse reporter ssy using modified pgl3 constructs contining wild-type or mutted inding site. Expression of ws modulted using sirna or denovirus vectors. p57 mrna nd protein were mesured efore nd fter trnsfection with mir-92-mimic molecules. Following utyrte tretment nd mir-92-mimic trnsfection, poptosis ws nlyzed y TUNEL stining nd cspse-3 immunolotting. Results: Microrry, confirmed y qpcr, reveled seven-fold increse in mir-92 levels in spordic humn colon cncer tissue compred to djcent norml colon. Treting humn colon cncer cells with utyrte reduced the levels of pri-mir7-92, precursor nd mture mir-92, s well s. SAHA nd vlproic cid hd similr effects. Muttion of the inding site diminished utyrte s inhiitory effects on C3orf25 promoter ctivity. Silencing expression reduced mir-92 levels. over-expression neutrlized utyrte-induced ttenution of pri-mir7-92. Exogenous mir-92 inhiited utyrte-induced p57 expression nd reversed the eneficil ctions of utyrte on colon cncer cell prolifertion nd poptosis. Conclusions: Our findings identify novel cellulr mechnism wherey utyrte inhiits mir-92 trnscription y reducing, thus ugmenting p57 levels. These ctions diminish colon cncer cell prolifertion nd stimulte poptosis. This newly descried regultion of oncogenic mirna iogenesis expnds our understnding of colon cncer cell iology nd identifies novel therpeutic trgets. Keywords:,,miR-92,HDACinhiitor,miRNA,p57,Coloncncer Correspondence: jrufmn@medicine.umrylnd.edu VA Mrylnd Helthcre System, Deprtment of Medicine, Division of Gstroenterology & Heptology, nd the Mrlene nd Stewrt Greeneum Cncer Center, University of Mrylnd School of Medicine, 22 South Greene Street, N3W62, Bltimore, MD 22, USA Full list of uthor informtion is ville t the end of the rticle 25 Hu et l. Open Access This rticle is distriuted under the terms of the Cretive Commons Attriution 4. Interntionl License ( which permits unrestricted use, distriution, nd reproduction in ny medium, provided you give pproprite credit to the originl uthor(s) nd the source, provide link to the Cretive Commons license, nd indicte if chnges were mde. The Cretive Commons Pulic Domin Dediction wiver ( pplies to the dt mde ville in this rticle, unless otherwise stted.

2 Hu et l. Moleculr Cncer (25) 4:8 Pge 2 of 5 Bckground Disruption of the unique lnce etween dietry residue, intestinl flor nd the host colonic mucos tht mintins intestinl homeostsis my trigger or promote diseses of the colon, including neoplsi. Short chin ftty cids (SCFAs) derived from dietry fier y microil neroic fermenttion ply n importnt role in this diet-microiome-host interction. Following the intke of dietry fier, the mjor SCFAs, utyrte, proprionte, nd cette re produced nd detected in oth colonic luminl fluid nd feces []. Epidemiologicl studies consistently identify low-fier diet, which reduces the iovilility of utyrte, s risk fctor for colon cncer [2, 3]. Recent clinicl studies lso reveled tht compred to controls, individuls with dvnced colon cncer hve diminished utyrteproducing cteri nd lower levels of SCFA [4, 5]. These findings suggest tht compromised production of utyrte in the colon s consequence of either low dietry fier or diminished utyrte-producing cteri promotes neoplsi. provides n importnt energy source for norml colon epithelil cells nd promotes their prolifertion [6]. By contrst, utyrte induces colon cncer cell poptosis nd differentition, nd inhiits prolifertion [7]. It is likely tht elucidting the mechnisms underlying these divergent ctions of utyrte will identify cndidte therpeutic trgets. Proposed mechnisms include utyrteinduced trnscriptionl regultion s histone decetylse (HDAC) inhiitor, nd inhiition of histone phosphoryltion nd DNA methyltion, ctions tht suppress the expression of severl oncogenes [8 ]. For exmple, y virtue of ctions tht ccelerte mrna degrdtion nd inhiit trnscript splicing, utyrte reduces expression of, key proto-oncogene [ 3]; utyrte tretment of humn colon cncer cell lines reduces mrna nd protein levels [4]. Two of the uthors (SH, EBC) previously reported novel mechnism involving modultion of cncerssocited mirna profiles tht medites utyrte s nti-cncer effects [5]. Among the mirnas whose expression ws suppressed y utyrte, memers of the mir-6 fmily, including mir-7, mir-2/, mir-93 nd mir-6/, regulte p2 trnsltion nd cncer cell prolifertion [5, 6]. Colon cncer mirna microrry dt indicted tht utyrte mplifies expression of other mirna fmilies nd clusters including the oncogenic mir-7-92 cluster, lso known s oncomir- ndc3orf25 [7, 8]. In ddition to the forementioned mir-7 nd mir-2, the mir-7-92 cluster encodes mir-8, mir-9/ nd mir-92. Trgets of these mirnas ply criticl roles in regulting pivotl cell processes including the cell cycle, prolifertion, nd poptosis [9 23]. Here, we hypothesized tht in colon cncer microederived utyrte suppresses oncogenic mir-92 vi regultion of. Using oth microrry nd qpcr, we detected incresed mir-92 levels in spordic humn colon cncer. tretment of oth HCT6 nd HT29 humn colon cncer cells reduced the levels of primry mir (pri-mir-7-92), precursor, nd mture mir-92; these effects were shred y other HDAC inhiitors (sueroylnilide hydroxmic cid (SAHA) nd vlproic cid). tretment lso decresed the levels of other mir cluster memers, including mir-7, mir-8, mir- 9/ nd mir-2. reduced expression nd -induced mir-7-92 promoter ctivity. Silencing protein expression reduced levels of mir-92. In contrst, overexpressing neutrlized utyrte s inhiitory effect on pri-mir Adding exogenous mir-92 reversed utyrte-induced p57 expression, growth inhiition, nd poptosis. Collectively, these findings uncovered novel mechnism wherey interply etween utyrte nd regultes oncogenic mirna iogenesis nd promotes colon cncer cell poptosis. Results tretment diminishes mir-92 over-expression in humn colon cncer cells The mir-7-92 cluster is over-expressed in vriety of cncers [7 9, 24, 25]. Previously, we showed tht expression of severl memers of the mir-7-92 cluster is gretly ugmented in humn spordic colon cncer [5]. As first step to understnding how expression of this cluster is regulted, we used mirna microrrys to nlyze mir-92 expression in colon cncer compred to djcent norml colon tissue from the sme individul. As shown in Fig., in ech of five pired smples we oserved incresed mir-92 expression in cncer compred to norml colon; men mir-92 expression ws seven-fold greter in the cncer smples. Using the sme tissue smples, we confirmed these findings with qpcr (Fig. ). Prior studies reveled tht treting colon cncer cells with physiologicl dose of utyrte decreses expression of severl mirna clusters [5, 26]. We nlyzed the effects of treting HCT6 nd HT29 humn colon cncer cells with the sme dose (2 mm) of utyrte on mir-92 expression using qpcr to mesure the undnce of primry (pri-mir-7-92 nd pri-mir-6-92), precursor (pre-mir-92), nd mture mir-92. Consistent with previous reports [2, 27], pri-mir6-92 ws not detected in humn colon cncer cells. As shown in Fig. c, 24-h tretment of HCT6 cells with 2 mm utyrte down-regulted the levels of ll pri-mir-7-92, premir-92, nd mture mir-92. In response to utyrte tretment, we oserved -fold decrese in the initil mirna trnscript, pri-mir7-92, nd the levels of premir-92 nd mture mir-92 were decresed y 67 %

3 Hu et l. Moleculr Cncer (25) 4:8 Pge 3 of 5 Microrry 2 qpcr 8 mir-92 (fold chnge) 6 4 mir92 (fold chnge) Norml Cncer Norml Cncer c RNA (fold chnge) d HCT6 cells Untreted HT29 cells Untreted.2 RNA (fold chnge) pri-mir7-92 pre-mir-92 mir-92 pri-mir7-92 pre-mir-92 mir-92 e.2 HCT6 cells Untreted RNA (fold chnge) mir-7 mir-8 mir-9 mir-9 mir-2 Fig. mir-92 is over-expressed in humn colon cncer nd its expression in humn colon cncer cells is inhiited y utyrte tretment. The undnce of mir-92 ws mesured in mirna microrrys using RNA extrcted from spordic humn colon cncer nd djcent norml tissue from the sme five people. Dt re shown s fold-chnge of smple to control reference pool signls. For purposes of direct comprison, smples from the sme individul were leled using the sme color. P <.5,n =5. Chnges in mir-92 expression were confirmed y qpcr using the sme tissue smples used for microrry. P <.5,n = 5. Humn colon cncer cells were treted with 2 mm utyrte for 24 h efore extrcting RNA. Untreted cells were used s control. The undnce of primry (pri-mir-7-92), precursor (pre-mir-92), nd mture mir-92 ws mesured using qpcr in c) HCT6ndd) HT29. Pri-miR-6-92 ws not detected in either cell line. e The undnce of mir-7, mir-8, mir-9, mir-9 nd mir-2 ws mesured in HCT6 cells. Brs represent mens ± SEM. P <.5,n =4 nd 52 %, respectively (Fig. c). Inhiition of pri-mir-7-92, pre-mir-92 nd mir-92 y utyrte ws confirmed in second humn colon cncer cell line, HT29 (Fig. d). All memers of the mir-7-92 cluster derived from primir-7-92 were lso mesured in HCT-6 cells fter utyrte tretment. As shown in Fig. e, consistent with previous reports [5, 26], mir-7, mir-8, mir-9/ nd mir-2, were decresed y 4 to 7 % fter utyrte tretment. These findings suggested to us tht the ntineoplstic ctions of utyrte might e medited in prt y the ility of utyrte to suppress oncogenic mirna expression, prticulrly the mir-7-92 cluster.

4 Hu et l. Moleculr Cncer (25) 4:8 Pge 4 of 5 Effects of utyrte tretment on mir-92 nd expression To revel the mechnism wherey utyrte regultes mir-92 expression, we exmined the effects of utyrte tretment over 24 h in HCT6 cells. Pri-miR-7-92, pre-mir-92, nd mture mir-92 were mesured y qpcr, 2, 4, 8, 6, nd 24 h fter utyrte tretment (Fig. 2). With utyrte tretment, mture mir-92 decresed grdully wheres pre-mir-92 nd pri-mir showed much steeper initil declines; pri-mir levels in prticulr dropped shrply within the first 2 h fter utyrte tretment. In HCT6 cells using the sme tretment conditions we mesured protein nd mrna levels of, mjor trnscription fctor which up-regultes mir-7-92 cluster expression [8, 9, 23, 28]. As shown in Fig. 2, sustntil protein ws detected in untreted HCT6 cells ut levels declined progressively over the course of 24 h of utyrte tretment; expression declined ~7 % compred to sl vlues within 2 h of strting utyrte tretment. Neither Drosh, the key enzyme processing pri-mirnas to pre-mirnas, nor β-ctin, control housekeeping protein, were ltered y utyrte tretment. Comprison of the time-courses for utyrte-induced ttenution of pri-mir-7-92 (Fig. 2) nd (Fig. 2) expression suggested to us tht the ctions of utyrte on mirna trnscription were most likely medited y ttenution of expression. c- Myc mrna levels were rpidly reduced within the first 2 h of utyrte tretment, which correlted with chnge in protein expression during the sme time (Fig. 2c). Interestingly, fter 8 h of utyrte tretment, we detected grdul increse in mrna ck to over 6 % of the sl level (Fig. 2c). tretment inhiits C3orf25 promoter ctivity A highly functionl nd conserved inding site (E3 ox, CATGTG-) is locted in the intronic C3orf25 promoter.5 k upstrem of the mir-7-92 coding sequence [9, 29]. We used luciferse reporter system to investigte the effect of utyrte tretment on -ssocited trnscriptionl regultion of the mir cluster [3]. HCT-6 cells were trnsiently trnsfected with modified pgl3 vectors contining the.5-k promoter segment of C3orf25 with either the wildtype inding site (WT), mutted site (Mut) or prtilly deleted site (Del, see schemtic in Fig. 3). Firefly luciferse expression ws used to ssess the ctivity of the trnscriptionl promoter. The prl-tk vector expressing Renill luciferse ws co-trnsfected to control for trnsfection efficiency. The WT construct showed sustntil trnscriptionl ctivity under sl conditions (Untreted), nd utyrte tretment significntly decresed luciferse ctivity y 4 % (Fig. 3). RNA (fold chnge) c RNA (fold chnge) mir-92 pre-mir-92 pri-mir (hours) (hours) mrna Drosh -ctin (hours) Fig. 2 Time course of chnges in expression of mir-92,, Drosh nd p57 following utyrte tretment. HCT6 humn colon cncer cells were treted with 2 mm utyrte for up to 24 h. Cells were hrvested for nlysis t, 2, 4, 8, 6, nd 24 h fter tretment. The undnce of pri-mir-7-92, pre-mir-92, nd mture mir-92 ws mesured using qpcr. Brs represent mens ± SEM. n =3. Protein levels of, Drosh nd β-ctin were nlyzed y immunolotting. The imge shown is representtive of three individul experiments. c The undnce of mrna ws mesured using qpcr. Brs represent mens ± SEM. n =3 Muttion or prtil deletion of the inding site ttenuted promoter ctivity under sl conditions. Moreover, the inhiitory effect of utyrte ws not detected in

5 Hu et l. Moleculr Cncer (25) 4:8 Pge 5 of 5 C3orf25 Reltive Luciferse Activity % pgl3 pgl3 pgl inding site (E3 ox) CATGTG CGAT TG GTG.5k mir-7-92 cluster ATG ATG ATG Luc Luc Luc WT Mut Del Untreted WT Mut Del Fig. 3 Requirement of the inding site for the utyrte s inhiitory effects on C3orf25 promoter ctivity. Schemtic of pgl3 luciferse reporter constructs contining the.5-k promoter region upstrem to the mir-7-92 cluster gene in C3orf25, which includes wildtype functionl inding site (CATGTG, WT). The pgl3 vectors contining mutted site (CGATTG, Mut) or prtilly deleted site ( GTG, Del) were generted s controls. Promoter ctivities of the three luciferse reporter constructs in response to utyrte tretment. Two hours fter utyrte tretment (2 mm), HCT6 humn colon cncer cells were trnsiently co-trnsfected with firefly luciferse pgl3 nd prl-tk Renill luciferse vectors. Twelve h fter trnsfection cells were hrvested for mesurement of luminescence. Cells without utyrte tretment (Untreted) were nlyzed s control. Reltive luciferse ctivity ws normlized to the wild-type construct (Untreted). Brs represent mens ± SEM. P <.5, n = 4 cells trnsfected with the mutted luciferse constructs (Fig.3).Thesereporterssyresultssuggestedtht the specific inding site ws required to medite the inhiitory effect of utyrte on C3orf25 promoter ctivity. Silencing nd over-expressing lters pri-mir-7-92 expression To nlyze further the regultory effects of nd utyrte on pri-mir-7-92 trnscription, we ltered protein levels in HCT6 cells using sirna knockdown nd denovirus infection. To knockdown, we trnsfected HCT6 cells with predesigned MISSION sirnas, n endorionuclese-derived pool comprising heterogeneous mixture of sirnas trgeting mrna. As shown in Fig. 4 nd, protein levels were sustntilly diminished fter sirna (si-cmyc) trnsfection wheres expression of the housekeeping protein β-ctin ws unchnged. knockdown significntly reduced expression of pri-mir-7-92 (Fig. 4c) nd mture mir-92 (Fig. 4d). Control sirna (si-cont) hd no effect. As shown in Fig. 4e, using reporter ssy with modified pgl3 constructs s descried in Fig. 3, we ssessed the effects of silencing in HCT-6 cells on pri-mir-7-92 promoter ctivity. Compred to sl (lipofectmine tretment only; Lipo), knockdown reduced luciferse ctivity of the wild-type (WT) promoter y more thn 55 %. In contrst, in cells expressing the mutted promoter (Mut) tht hd ttenuted trnscriptionl ctivity, silencing cused much smller chnge. Trnsfection with control sirna (si-cont) did not lter luciferse ctivity. These results show tht mintining high level expression is essentil for mir-7-92 trnscription nd tht silencing expression mimics the effects of utyrte tretment on mir-92 trnscription. Next, we over-expressed protein y infecting HCT6 cells with denovirus crrying the coding sequence driven y CMV promoter (Fig. 5 schemtic). After -denovirus infection, we confirmed incresed protein levels y immunolotting cell extrcts t 48 h, the optiml durtion of tretment (Fig. 5, right). c- Myc-denovirus-infected cells hd sustntilly higher primir-7-92 levels compred to untreted cells (UNTD) nd to control cells infected with null virus vehicles (Veh) (trid of rs on the left in Fig. 5d). -denovirus-infected cells were incuted with 2 mm utyrte for 24 h efore mesuring chnges in primir-7-92 levels (Fig. 5 schemtic). The immunolot in the right pnel of Fig. 5 shows tht utyrte tretment diminished protein levels in control cells (Cont nd Veh) ut due to its enhncement of CMV promoter ctivity utyrte tretment mplified levels in denovirus-infected cells. As shown y the middle trid of rs in Fig. 5d, pri-mir-7-92 levels were decresed in ll utyrte-treted cells. Nonetheless, in -denovirusinfected cells reduction of pri-mir-7-92 levels ws significntly ttenuted compred to control cells (Cont nd Veh); this finding suggested tht over-expression rescued cells from the utyrte-induced decrese in primir-7-92 expression.

6 Hu et l. Moleculr Cncer (25) 4:8 Pge 6 of 5.2 -ctin Protein (ritrry units) Lipo si- si-cont.2 Lipo si- si-cont c pri-mir-7-92 (fold chnge) d mir-92 (fold chnge) Lipo si- si-cont Lipo si- si-cont e Reltive luciferse ctivity % Lipo si- si-cont WT Fig. 4 Effect of silencing expression on mir-92 in HCT6 cells. HCT6 humn colon cncer cells were trnsfected with predesigned MISSION sirnas, n endorionuclese-derived pool comprising heterogeneous mixture of sirnas trgeting mrna (si-cmyc), or control sirna (si-cont) using Lipofectmine 2 for 24 h efore cell hrvest. Cells treted with Lipofectmine 2 lone (Lipo) served s control. Protein levels of nd β-ctin were nlyzed y immunolotting. The imge shown is representtive of four individul experiments. Reltive protein levels were mesured y densitometry. In HCT6 cells with control nd reduced levels of expression, qpcr ws used to mesure the undnce of c pri-mir-7-92 nd d mir-92. Brs represent mens ± SEM. P <.5,n =4.e Eight hours fter si-rna trnsfection, HCT-6 cells were trnsiently co-trnsfected with pgl3 luciferse vectors contining wild-type (WT) or mutted (Mut) promoter region of mir-7-92 cluster s descried in Fig. 3 nd prl-tk Renill luciferse vectors. Twenty four hours fter luciferse vector trnsfection, cells were hrvested for mesurement of luminescence. Reltive luciferse ctivity ws normlized to the wild-type control (Lipo). Brs represent mens ± SEM. P <.5,n =4 Mut

7 Hu et l. Moleculr Cncer (25) 4:8 Pge 7 of 5 CMV promoter 48 h coding sequence -ctin Adenovirus UNTD Veh Adenovirus 48 h 24 h UNTD Cont Veh -ctin c 56 h 48 h -ctin Adenovirus UNTD Cont Veh d Cont Veh pri-mir-7-92 (fold chnge) UNTD 24 h 56 h Fig. 5 -induced over-expression of pri-mir-7-92 ws ttenuted y utyrte tretment. HCT6 humn colon cncer cells were infected with denovirus crrying the coding sequence driven y CMV promoter to overexpress (cmyc) or null virus vehicle (Veh) for 48 h efore nlysis. Cells without virus infection were nlyzed s control (Cont). The effects of tretment with 2 mm utyrte ws ssessed using three experimentl designs: no utyrte tretment, 24-h tretment prior to cell hrvest, nd c) 56-h tretment strting 8 h prior to virus infection. Untreted cells (UNTD) were ssessed s control. Protein levels of nd β-ctin were nlyzed y immunolotting. Imges shown re representtive of three individul experiments. d The undnce of pri-mir-7-92 ws mesured using qpcr. Brs represent mens ± SEM. P <.5,n =3 Prllel experiments were performed to nlyze the effects of over-expressing fter 8 h of utyrte tretment (Fig. 5c schemtic), time point t which endogenous protein nd pri-mir-7-92 were depleted y utyrte tretment (Fig. 2). -denovirus infection roustly incresed expression (immunolot

8 Hu et l. Moleculr Cncer (25) 4:8 Pge 8 of 5 in Fig. 5c), n effect likely due to prolonged (56 h) tretment with utyrte tht enhnced CMV promoter ctivity. Also, pri-mir-7-92 levels were significntly greter in c- Myc-virus-infected compred to control cells (Cont nd Veh; right trid of rs in Fig. 5d) ut notly pri-mir-7-92 levels hd recovered to nerly the sme level s in untreted cells (UNTD in left trid of rs in Fig. 5d). From these experiments, we concluded tht restortion of expression in utyrte-treted cells rescues primir-7-92 from inhiition. Effects of other HDAC inhiitors, SAHA nd vlprote, on mir-92 nd expression As potent HDAC inhiitor, utyrte ffects rod rnge of gene expression y hypercetyltion of histones [9, 3]. In HCT-6 cells, we tested the effects of two other HDAC inhiitors, SAHA nd vlproic cid [32 34], on mir-92 nd expression in HCT-6 cells. As shown in Fig. 6, we oserved 5-fold decrese in pri-mir-7-92 expression following tretment with 5 μm SAHA or mm vlproic cid for 24 h. SAHA or vlproic cid tretment lso down-regulted the level of mture mir-92 level of y~3%(fig.6).compredtoslvlues,protein expression declined 75 % nd 35 % fter SAHA nd vlproic cid tretment, respectively (Fig. 6c nd d). The control housekeeping protein, β-ctin ws not ltered y these tretment. Trnsfection with exogenous mir-92 ttenutes utyrte-stimulted p57 protein induction Previous studies reveled mir-92 trget sequence in the 3 UTR of p57, tumor suppressor; mir-92 inding to this site inhiits p57 expression in vriety of cncers [6, 35, 36]. In Fig. 7, we show tht utyrte tretment induced progressive nd roust p57 expression. To elucidte the mechnism underlying mir-92 effects on p57 expression, we trnsfected mir-92-mimic molecules into HCT6 cells. As shown in Fig. 7, trnsfection with mir-92 mimetics rescued cells from the effects of utyrte tretment, mintining high levels of mir-92. induced seven-fold increse in p57 mrna levels, n effect unltered y mir-92 mimetics (Fig. 7c). In contrst, utyrte induction of p57 protein levels ws significntly ttenuted y trnsfection with.2.2 pri-mir7-92 (fold chnge) mir-92 (fold chnge) SAHA Vlproic cid SAHA Vlproic cid c d.2 -ctin Protein (ritrry units) SAHA Vlproic cid.2 SAHA Vlproic cid Fig. 6 HDAC inhiitors, SAHA nd vlproic cid, suppressed expression of pri-mir-7-92, mir-92 nd in colon cncer cells. HCT6 humn colon cncer cells were treted with.5 um SAHA or mm vlproic cid for 24 h efore hrvesting. The undnce of ) pri-mir-7-92 nd ) mir-92 ws mesured using qpcr. Brs represent mens ± SEM. n =4.c Protein levels of nd β-ctin were nlyzed y immunolotting. The imge shown is representtive of three individul experiments. d Reltive protein levels were mesured y densitometry. Brs represent mens ± SEM. n =3

9 Hu et l. Moleculr Cncer (25) 4:8 Pge 9 of 5 p57 -ctin (hours) mir-92 (fold chnge) c p57 mrna (fold chnge) UNTD Lipo mir-92 mir-c UNTD Lipo mir-92 mir-c d e.2 p57 -ctin p57 Protein (ritrry units) UNTD Lipo mir92 mir-c.2 UNTD Lipo mir-92 mir-c Fig. 7 Over-expression of mir-92 ttenutes utyrte-induced p57 expression y locking p57 trnsltion. HCT6 humn colon cncer cells were treted with 2 mm utyrte for up to 24 h. Cells were hrvested for nlysis t, 2, 4, 8, 6, nd 24 h fter tretment. Protein levels of p57nd β-ctin were nlyzed y immunolotting. The imge shown is representtive of three individul experiments. HCT6 cells were trnsfected with mir-92 mimetics or control mirna (mir-c) using Lipofectmine 2 then treted with 2 mm utyrte for 24 h prior to hrvest. Cells without utyrte tretment (UNTD) or treted with Lipofectmine 2 (Lipo) were nlyzed s controls. The undnce of mir-92 ws mesured using qpcr. c p57 mrna levels were mesured using qpcr. d Protein levels of p57 nd β-ctin were nlyzed y immunolotting. The imge shown is representtive of four individul experiments. e Normlized densitometric vlues of p57 protein levels. Brs represent mens ± SEM. P <.5,n =4 mir-92 mimetics (Figs. 7d nd e). These results suggest tht mir-92 inhiits p57 trnsltion, not trnscription. Anti-prolifertive ctions of utyrte re ttenuted y over-expressing mir-92 p57 plys criticl role in vrious cncer cell functions, including prolifertion nd poptosis [37]. Thus, mir-92dependent p57 induction my contriute to utyrte s nti-cncer effects. To exmine the role of mir-92 in mediting utyrte s nti-prolifertive nd pro-poptotic ctions, prior to utyrte exposure HCT6 cells were trnsfected with exogenous mir-92 or control mirna (mir-c), the sme tretment s Fig. 7-e. -induced clevge of cspse-3 ws ttenuted y exogenous mir- 92 ut not control mirna (Fig. 8 nd ). As shown in Fig. 8c, utyrte-induced reduction of HCT6 cell prolifertion ws significntly reversed y over-expressing mir- 92. Using second poptosis ssy, TUNEL stining

10 Hu et l. Moleculr Cncer (25) 4:8 Pge of 5 UNTD Lipo mir92 mir-c Cspse3 Cleved cspse3 -ctin Cleved Cspse-3 Protein (ritrry units) UNTD Lipo mir-92 mir-c c e Reltive Cell Count (% mximum) UNTD Lipo mir-92 mir-c d Stined Cells (% totl cells) UNTD Lipo mir-92 mir-c UNTD Lipo mir-92 mir-c Fig. 8 (See legend on next pge.)

11 Hu et l. Moleculr Cncer (25) 4:8 Pge of 5 (See figure on previous pge.) Fig. 8 Over-expression of mir-92 reverses utyrte-induced effects on colon cncer cell prolifertion nd poptosis. HCT6 humn colon cncer cells were trnsfected with mir-92 mimetics or control mirna (mir-c) using Lipofectmine 2 nd then treted with 2 mm utyrte for 24 h prior to hrvest. Cells without utyrte tretment (UNTD) or treted with Lipofectmine 2 (Lipo) were nlyzed s controls. Protein levels of totl cspse-3, cleved cspse-3 nd β-ctin were nlyzed y immunolotting. The imge shown is representtive of three individul experiments. Normlized densitometric vlues of cleved cspse-3 protein levels. c Reltive cell count fter mir-92 trnsfection nd utyrte tretment. Cells were trypsinized nd counted using hemocytometer. Vlues shown re reltive to the UNTD smple. d Percentge of positive cells in TUNEL stining. e The imges of TUNEL stining shown re representtive of three individul experiments. Positive cells stin rown. Results shown re mens ± SEM. P <.5, n =3 (Fig. 8d nd e), we confirmed tht trnsfection with mir- 92 reduced the proportion of utyrte-induced, TUNELpositive poptotic cells. Agin, utyrte-induced inhiition of colon cncer cell prolifertion ws ttenuted y dding mir-92 ut not control mirna (Fig. 8e). Collectively, these findings support key role for mir-92 in mediting the functionl effects of utyrte tretment on colon cncer cells. Discussion The present study identifies novel regultory mechnism wherey utyrte inhiits mir-92 iogenesis. As microe-derived y-product of fier fermenttion, utyrte plys criticl role in modulting host gene expression in the colon. Previously, we showed tht multiple memers of the mir-7-92 cluster were gretly suppressed y treting humn colon cncer cells with utyrte [5]. In this study, we focused on elucidting the mechnism wherey utyrte regultes iogenesis of the oncogenic mir-7-92 cluster. In HCT6 nd HT29 humn colon cncer cells, utyrte tretment reduced mir92 levels t ll processing stges, mongst which the initil pri-mir-7-92 trnscripts showed the most rpid nd lrgest declines fter utyrte tretment. All memers of the mir-7-92 cluster derived from primir-7-92 were decresed y utyrte in HCT 6 cells. These results suggested tht utyrte s effects on mir92 inhiition were likely medited y trnscriptionl regultion of pri-mir-7-92 nd less likely consequence of ltered mirna processing. The trnscriptionl ctivity of the mir-7-92 cluster origintes from the core promoter region directly upstrem of the mirna coding sequences. This site includes multiple trnscription fctor inding sites [9, 2, 29, 38]. Trnscription of the mir-7-92 cluster is strongly dependent on inding to conserved E-ox element (E3) in the core promoter region [8, 23]. In K562 myelogenous leukemi nd HeL cervicl cncer cells, silencing protein expression or deleting the E3 element significntly reduced trnscriptionl ctivity [3]. We found tht utyrte tretment gretly diminished protein levels in colon cncer cells, n ction tht resulted in suppression of C2orf25 promoter ctivity nd mirna trnscription. Silencing in HCT6 cells decresed C2orf25 promoter ctivity nd levels of oth pri-mir-7-92 nd mture mir92, thus mimicking the ctions of utyrte. Over-expressing resulted in up-regulted levels of pri-mir enhnces CMV promoter ctivity [39], therefore exogenous gene mintined roust expression even fter utyrte tretment. Pre-existing high levels of protein prtilly locked the suppression of pri-mir-7-92 y utyrte tretment. In rescue experiments, restoring utyrte-suppressed protein levels fully restored pri-mir-7-92 to seline levels. In concert, these findings re comptile with mechnism wherey utyrteinduced ttenution of expression regultes mirna levels. Humphrey et l. confirmed utyrte s ctions in reducing levels of memers of the mir-7-92 cluster in colon cncer cells [26]. In the sme study, lthough levels of mrna were prdoxiclly incresed fter utyrte tretment, protein levels were not mesured; the medited regultory mechnism ws not pursued. Reduced expression fter utyrte tretment is reported in severl colon cncer cell lines [, 4]. Vrious custive mechnisms were implicted, including suppression of mrna trnscription, ccelerted degrdtion of mrna, nd inhiited splicing of trnscripts [2]. In the present study, rpid decrese ws noted in protein nd mrna levels within the first 2 h of utyrte tretment. However, mrna re-ccumulted fter 8 h of utyrte tretment without restoring the level of c- Myc protein, this likely represents negtive trnscriptionl feedck in response to diminished protein. A mechnism of trnsltionl inhiition my underlie this mismtch of mrna nd protein, resulting in prdoxiclly elevted mrna levels fter utyrte tretment s oserved y Humphrey et l. [26]. As consequence of the network of post-trnscriptionl processing, including nucler processing y Drosh/ DGCR8, nucler export, cytoplsmic processing y dicer, nd RNA degrdtion of primry, precursor nd mture mirnas [4 43], the complexity of mirna iogenesis surpsses tht for clssicl mrna. Thus, lthough our findings implicte in mediting the effects of utyrte on pri-mir-7-92 trnscription, we cnnot exclude role for other regultory mechnisms, including -

12 Hu et l. Moleculr Cncer (25) 4:8 Pge 2 of 5 independent inhiition of pri-mirna trnscription or primirna degrdtion y utyrte. However, ecuse ll primry, precursor, nd mture mirnas decresed in grdient fshion with the lrgest chnges seen on pri-mir- 7-92, mechnisms regulting mirna processing in the nucleus nd cytosol re less likely to e ffected y utyrte. Moreover, expression of Drosh, mjor plyer in processing primry to precursor mirnas, ws unchnged y utyrte tretment (Fig. 2). Altered mirna expression cn influence cncer development when mirna trgets re tumor suppressors or oncogenes. In the colon, up-regulted mir-7-92 promotes neoplsi through vrious pthwys, e.g. mir-8 nd mir-9 directly repress TSP- nd CTGF, respectively, to promote ngiogenesis [24] nd mir-92 downregultes BCL2L expression therey reducing poptosis [44]. Previously, we reported tht utyrte decresed mir- 7 nd mir2 levels in HCT6 cells, therey llowing p2 expression to down-regulte cell prolifertion [5]. In the present study, we demonstrte prllel pthwy involving mir-92 nd p57 tht contriutes to utyrte s nti-cncer effects (Fig. 9). p57 modultes mny cellulr processes tht re dysregulted in cncer, including cell cycle control, differentition, poptosis, nd development [37]. Often, p57 is epigeneticlly silenced in cncer [45, 46], prtilly due to trnscriptionl regultion y histone deceyltion/methyltion nd trnsltionl regultion y mir- NAs such s mir-22/222, mir-25, mir-92 nd mir-92 (Fig. 9) [6, 35, 47 49]. In humn colon cncer cells, utyrte nd other HDAC inhiitors up-regulte p57 levels y enhncing mrna trnscription (Fig. 9) [5, 5]. Simultneously, utyrte decreses mir92 levels, therey permitting p57 mrna trnsltion (Fig.9).Bsed on microrry result from previous study [5], utyrte lso downregultes expression of mir-22/222 nd mir-25. For exmple, mir-25 levels decresed ~3 % fter utyrte tretment, confirmed y qpcr (dt not shown). Decresed expression of mirnas tht shre the sme trgeting sequence in the p57 3 UTR my synergisticlly regulte p57 expression. Conclusions The ctions of utyrte exemplify interctions etween diet, cteri, nd host epithelil cells tht re criticl to mintining gut homeostsis. Compromised utyrte production due to interruption of this lnce hs een implicted repetedly in colon neoplsi. Here, we identified novel mechnism wherey utyrte, HDAC inhiitor, regultes oncogenic mirna iogenesis vi to ttenute humn colon cncer cell prolifertion nd promote poptosis (Fig. 9). This mechnism wherey diet-microil interction regultes host gene expression expnds our understnding of colon neoplsi. It is nticipted tht further unrveling the mechnisms underlying utyrte s eneficil p57 mrna Trnscription p57 mrna pri-mir-7-92 mir-92 Trnsltion c- Myc pri-mir-7-92 mir-92 Trnsltion p57 protein Prolifertion Prolifertion Apoptosis p57 protein Apoptosis Fig. 9 decreses nd mir-92 levels nd increses p57 expression in colon cncer cells. In colon cncer cells, high levels of up-regulte mir-7-92 trnscription. Over-expressed mir-92 inhiits p57 mrna trnsltion, thus ttenuting the cellulr ctions of p57 protein. Tretment with utyrte up-regultes oth p57 trnscription nd p57 mrna trnsltion. The effect of utyrte on p57 mrna trnsltion is medited vi reduced protein expression, which decreses mir-7-92 cluster trnscription nd mir-92 levels. Collectively, the interctions etween utyrte,, mir-92 nd p57 medite utyrte s nti-prolifertive nd pro-poptotic effects, oth relevnt to colon neoplsi effects will identify new therpeutic strtegies to prevent nd tret colon cncer. Methods Humn tissues Tissue smples were otined from individuls with colon cncer t the University of Chicgo Medicl Center under protocol pproved y the Institutionl Review Bord. Prior to tissue collection, informed consent ws otined

13 Hu et l. Moleculr Cncer (25) 4:8 Pge 3 of 5 from ech suject. All clinicl investigtions using humn sujects were conducted ccording to the principles expressed in the Declrtion of Helsinki. At surgery, tissue ws otined from colon cncer nd djcent normlppering mucos (more thn 5 cm from the tumor order). These tissue smples were immeditely rinsed in ice-cold phosphte-uffered sline (PBS) efore cell lysis for RNA extrction. MicroRNA microrry Totl RNA ws extrcted from humn colon smples using the mirvn mirna Isoltion Kit (Amion, Life Technologies) ccording to the mnufcturer s protocol. Humn mirnas were nlyzed using mirvn mirna Biorrys v. 2 (Amion), which utilized the mirbse sequence dtse (version 8.). RNA smples were leled with the mirvn mirna leling kit nd hyridized to mirna iorrys per product instructions. The rrys were scnned using GenePix4B fluorescence scnner in the University of Chicgo Functionl Genomics Core Fcility. Five pirs of colon tissue smples were nlyzed. Cell culture Humn colon cncer cell lines, HCT6 (mle, CCL-247) nd HT29 (femle, HTB-38), were uthenticted nd cquired from Americn Type Culture Collection (ATCC). Cells were grown t 37 C in Modified McCoy s 5 Medium (Life Technologies) contining % fetl ovine serum, 5 U/ml penicillin nd 5 mg/ml streptomycin. Cells were rinsed, scrped nd pelleted in ice-cold PBS for protein nd RNA extrction. Sodium utyrte (B5887, Sigm-Aldrich) ws dded to culture medi t finl concentrtion of 2 mm. SAHA (SML6, Sigm-Aldrich) dissolved in DMSO ws dded to the culture medi t finl concentrtion of 5 μm. Cells treted with. % DMSO were nlyzed s control. Sodium vlprote (P4543, Sigm-Aldrich) ws dded to the culture medi t finl concentrtion of mm. Immunolotting Pelleted cells were homogenized in lysis uffer contining 2 mm Tris (ph 7.5), mm NCl, 5 mm MgCl 2,mM EDTA, % Triton X-, mm sodium fluoride, mm sodium vndte, mm phenylmethylsulfonyl fluoride, μg/ml pepsttin, nd μg/ml leupeptin. Totl protein ws quntified using the BCA protein ssy (Thermo Scientific). Protein smples (2 μg) soluilized in 2X Lemmli uffer were seprted y SDS-PAGE nd trnsferred to polyvinylidene difluoride (PVDF) memrnes. Memrnes were locked with 5 % wt/vol non-ft dry milk in Tween- Tris uffered sline (TTBS). Primry ntiodies, specific for, Drosh, p57, cspse-3, cleved cspse-3 nd β-ctin (Cell Signling), were dded nd incuted overnight t 4 C. Memrnes were incuted with horserdish peroxidse-conjugted species-pproprite secondry ntiodies (Cell Signling) for h t room temperture, nd developed using Western Lightning Plus ECL kit (Perkin Elmer). Imge quntifiction ws performed y scnning densitometry using NIH Imge J.54 softwre. Quntittive rel-time PCR (qpcr) for precursor nd mture mirnas Totl RNA ws extrcted from pelleted cells y Trizol (Life Technologies) ccording to the mnufcturer s instructions. Complementry DNA ws synthesized from totl RNA smples using the NCode Vilo mirna cdna Synthesis Kit (Life Technologies). Rel-time PCR ws performed with ABI StepOnePlus rel-time PCR system (Applied Biosystems) using Veriquest Syr Green qpcr Mster (Affymetrix) with mirna-specific primers nd universl qpcr primer ccording to the mnufcturer s protocol for the NCode VILO Kit. The two-step quntifiction cycling protocol (2 min t 5 C, min t 95 C nd then 4 cycles of95 Cfor5snd6 Cfor6s)wsused.PCRspecificity ws confirmed y melting curve nlysis. All mirnas were normlized to smll nucleolr RNA, RNU48 [52]. Primers used were mir TATTGCACTTGTCCCG GCCTGT -3 ; pre-mir CTTTCTACACAGGTTG GGATCG -3 ; nd RNU GATGACCCCAGGTAA CTCTGAG -3 ; mir CAAAGTGCTTACAGTGC AGGTAG -3 ; mir TAAGGTGCATCTAGTGCAG ATAG -3 ; mir TGTGCAAATCTATGCAAAAC TGA -3 ; mir TGTGCAAATCCATGCAAAAC TGA -3 ; mir TAAAGTGCTTATAGTGCAGGT AG -3. For quntifiction, the fold-chnge of mirna in experimentl reltive to control smples ws determined y the 2 -ΔΔCt method [53]. Quntittive rel-time PCR for pri-mirnas nd mrnas After totl RNA extrction, complementry DNA ws synthesized using SuperScript III (Life Technologies) nd rndom hexonucleotide primer. The sense nd ntisense PCR primers used for rel-time PCR for primry mirnas nd mrnas were p57: 5 - CCATCTAGCTTGCAGTCT CTTC -3 nd 5 - GACGGCTCAGGAACCATTT -3 ; GA PDH: 5 - CTCCTCACAGTTGCCATGTA -3 nd 5 - GTT GAGCACAGGGTACTTTATTG -3 ; : 5 - CATACA TCCTGTCCGTCCAAG -3 nd 5 - GAGTTCCGTAGCT GTTCAAGT -3 ; pri-mir-7-92: 5 - AGTGAAGGCACT TGTAGCATTA -3 nd 5 - GCACTAGATGCACCTTAG AACA -3 ; pri-mir-6-92: 5 - GAGAGGGGGAGTCC AAAATC -3 nd 5 - TGGTTTCAACCAAATCCTGA -3. All pri-mirnas nd mrnas were normlized to GAPDH. Cell trnsfection Lipofectmine 2 (Life Technologies) ws used to trnsfect luciferse plsmids, silencing RNA or mirna molecules. Pre-designed MISSION sirnas specific to

14 Hu et l. Moleculr Cncer (25) 4:8 Pge 4 of 5 humn (esirna, Sigm-Aldrich) were used to knock down expression. MISSION sirnas re endorionuclese-prepred sirna pools comprised of heterogeneous mixture of sirnas tht ll trget the sme mrna sequence. Cells were trnsfected with sir- NAs for 48 h prior to hrvest for protein or RNA extrction. To overexpress mir-92, n engineered mir-92 mimetic molecule (Amion s Pre-mir MiRNA Precursor Molecules) ws used to trnsfect HCT6 cells ccording to the mnufcturer s protocol. mir-c (Amion) ws used s control. Luciferse reporter ssy Modified pgl3 constructs with C3orf25 promoter segments upstrem of the firefly luciferse coding sequence (Fig. 3) were generous gift from Dr. Grünweller, Institute of Phrmceuticl Chemistry, Philipps University Mrurg, Germny [3]. A point muttion nd prtil deletion of the inding E3 element (Fig. 3) were introduced to the luciferse constructs using QuikChnge XL Site-Directed Mutgenesis Kit (#256, Agilent Technologies) ccording to the mnufcturer s protocol. Two h fter utyrte tretment, HCT-6 cells were trnsiently co-trnsfected with modified pgl3 constructs nd prl-tk plsmids (E224, Promeg) in : rtio using Lipofectmine 2. Twelve h fter trnsfection, cells were hrvested y shking in lysis uffer (Promeg). Firefly nd Renill luciferse ctivities in the lyste were determined with Dul- Luciferse Reporter ssy system (Promeg) ccording to the mnufcturer s instructions. As trnsfection efficiency control, firefly luciferse ctivity ws normlized to Renill luciferse ctivity. Recominnt virl infection Repliction-defective denovirus ws used to overexpress s descried previously [54]. Recominnt denovirl plsmids derived from the Adeno-X Expression System (Clontech) contining full length humn gene were trnsfected into HEK-293 cells for denovirl prticle pckging. padeno-x, the recominnt repliction-incompetent denovirus crrying no cdna insert, ws grown nd served s control denovirus (null virus vehicle). The potency of denovirus ws titrted s previously descried. For infection, virus prticles were dded to culture medi of HCT6 cells. expression ws ssessed 48 h fter infection. TUNEL stining Terminl deoxynucleotidyl trnsferse dutp nick end leling (TUNEL) stining for poptosis nlysis ws performed using the DedEnd colorimetric TUNEL system (Promeg) ccording to the mnufcturer s protocol. Briefly, fter 24-h utyrte tretment, HCT6 cells on glss slides were fixed nd permeilized. After equilirtion, cells were incuted in rtdt rection mix for 6 min t 37 C. Cells were locked in.3 % hydrogen peroxide nd then developed in DAB solution. All imges were cquired using the Nikon Eclipse 8i microscope system nd Imge-Pro Plus 5. softwre with stndrd imge processing. To clculte the percentge of stined cells, 2 cells were counted in five microscopic fields on every slide. Sttisticl nlysis Results re presented s mens ± SEM for the indicted numer of experiments. The results of multiple experiments were nlyzed y Student s t-test or ANOVA using the Bonferroni correction for multiple comprisons. Competing interests The uthors declre tht they hve no competing interests. Authors contriutions SH, LL, EBC, JYW nd JPR conceived the study design nd designed the experiments. SH nd LL conducted the luciferse ssy nd virl trnsfection. SH conducted the remining humn tissue nd cell-sed ssys. SH nd JPR prepred the mnuscript. All uthors red nd pproved the finl mnuscript. Acknowledgements The uthors thnk Dr. B. Mrc Bissonnette, Mrtin Boyer Lortories, Deprtment of Medicine, University of Chicgo School of Medicine, Chicgo, Illinois, USA, for providing humn colon tissue nd Dr. Arnold Grünweller, Institute of Phrmceuticl Chemistry, Philipps University Mrurg, Germny, for providing modified pgl3 constructs. This study ws supported y the Ntionl Institutes of Helth, Ntionl Institute of Dietes nd Digestive nd Kidney Diseses DK9346 (JPR), DK67872 (JPR), DK5789 (JYW), DK6972 (JYW), DK47722 (EBC), NIH NIDDK P3 Digestive Disese Reserch Core Center DK4286 (EBC), nd VA Merit wrds (JPR nd JYW). Author detils VA Mrylnd Helthcre System, Deprtment of Medicine, Division of Gstroenterology & Heptology, nd the Mrlene nd Stewrt Greeneum Cncer Center, University of Mrylnd School of Medicine, 22 South Greene Street, N3W62, Bltimore, MD 22, USA. 2 VA Mrylnd Helthcre System, Deprtment of Surgery, University of Mrylnd School of Medicine, Bltimore, MD, USA. 3 The Mrtin Boyer Lortories, Deprtment of Medicine, University of Chicgo School of Medicine, Chicgo, IL, USA. Received: 23 April 25 Accepted: 5 Octoer 25 References. Cummings JH, Pomre EW, Brnch WJ, Nylor CP, Mcfrlne GT. Short chin ftty cids in humn lrge intestine, portl, heptic nd venous lood. Gut. 987;28(): Chn AT, Giovnnucci EL. Primry prevention of colorectl cncer. Gstroenterology. 2;38(6): e. 3. Dhm CC, Keogh RH, Spencer EA, Greenwood DC, Key TJ, Fentimn IS, et l. Dietry fier nd colorectl cncer risk: nested cse control study using food diries. J Ntl Cncer Inst. 2;2(9): Chen HM, Yu YN, Wng JL, Lin YW, Kong X, Yng CQ, et l. Decresed dietry fier intke nd structurl ltertion of gut microiot in ptients with dvnced colorectl denom. Am J Clin Nutr. 23;97(5): Wng T, Ci G, Qiu Y, Fei N, Zhng M, Png X, et l. Structurl segregtion of gut microiot etween colorectl cncer ptients nd helthy volunteers. ISME J. 22;6(2): Belchev A, Irrzl T, Roertson SJ, Streutker C, Mughn H, Ruino S, et l. Gut microil metolism drives trnsformtion of MSH2-deficient colon epithelil cells. Cell. 24;58(2):

15 Hu et l. Moleculr Cncer (25) 4:8 Pge 5 of 5 7. Augenlicht LH, Mridson JM, Wilson A, Arngo D, Yng W, Heerdt BG, et l. Short chin ftty cids nd colon cncer. J Nutr. 22;32(2):384S 8S. 8. Comld M, Bilon E, de Hro O, Lr-Villosld F, Xus J, Zrzuelo A, et l. The effects of short-chin ftty cids on colon epithelil prolifertion nd survivl depend on the cellulr phenotype. J Cncer Res Clin Oncol. 26;32(8): Hinneusch BF, Meng S, Wu JT, Archer SY, Hodin RA. The effects of shortchin ftty cids on humn colon cncer cell phenotype re ssocited with histone hypercetyltion. J Nutr. 22;32(5):2 7.. Dly K, Shirzi-Beechey SP. Microrry nlysis of utyrte regulted genes in colonic epithelil cells. DNA Cell Biol. 26;25(): Mrini MR, Crpneto EM, Ulivi M, Allfrey VG, Boff LC. Correltion etween utyrte-induced histone hypercetyltion turn-over nd c-myc expression. J Steroid Biochem Mol Biol. 23;86(2): Krupitz G, Hrnt H, Dittrich E, Szekeres T, Huer H, Dittrich C. Sodium utyrte inhiits c-myc splicing nd interferes with signl trnsduction in ovrin crcinom cells. Crcinogenesis. 995;6(5): Tichonicky L, Kruh J, Defer N. Sodium utyrte inhiits c-myc nd stimultes c-fos expression in ll the steps of the cell-cycle in heptom tissue cultured cells. Biol Cell. 99;69(): Souleimni A, Asselin C. Regultion of c-myc expression y sodium utyrte in the colon crcinom cell line Cco-2. FEBS Lett. 993;326( 3): Hu S, Dong TS, Dll SR, Wu F, Bissonnette M, Kwon JH, et l. The microederived short chin ftty cid utyrte trgets mirna-dependent p2 gene expression in humn colon cncer. PLoS One. 2;6():e Kim YK, Yu J, Hn TS, Prk SY, Nmkoong B, Kim DH, et l. Functionl links etween clustered micrornas: suppression of cell-cycle inhiitors y microrna clusters in gstric cncer. Nucleic Acids Res. 29;37(5): Ot A, Tgw H, Krnn S, Tsuzuki S, Krps A, Kir S, et l. Identifiction nd chrcteriztion of novel gene, C3orf25, s trget for 3q3-q32 mplifiction in mlignnt lymphom. Cncer Res. 24;64(9): He L, Thomson JM, Hemnn MT, Hernndo-Monge E, Mu D, Goodson S, et l. A microrna polycistron s potentil humn oncogene. Nture. 25;435(743): Ji M, Ro E, Rmchndrreddy H, Shen Y, Jing C, Chen J, et l. The mir microrna cluster is regulted y multiple mechnisms in B-cell mlignncies. Am J Pthol. 2;79(4): Sylvestre Y, De Guire V, Querido E, Mukhopdhyy UK, Bourdeu V, Mjor F, et l. An E2F/miR-2 utoregultory feedck loop. J Biol Chem. 27;282(4): Ventur A, Young AG, Winslow MM, Lintult L, Meissner A, Erkelnd SJ, et l. Trgeted deletion revels essentil nd overlpping functions of the mir-7 through 92 fmily of mirna clusters. Cell. 28;32(5): OliveV,BennettMJ,WlkerJC,MC,JingI,Cordon-CrdoC,etl. mir-9 is key oncogenic component of mir Genes Dev. 29;23(24): O Donnell KA, Wentzel EA, Zeller KI, Dng CV, Mendell JT. -regulted micrornas modulte E2F expression. Nture. 25;435(743): Dews M, Homyouni A, Yu D, Murphy D, Sevignni C, Wentzel E, et l. Augmenttion of tumor ngiogenesis y Myc-ctivted microrna cluster. Nt Genet. 26;38(9): Lu J, Getz G, Misk EA, Alvrez-Svedr E, Lm J, Peck D, et l. MicroRNA expression profiles clssify humn cncers. Nture. 25;435(743): Humphreys KJ, Coic L, Le Leu RK, Vn der Hoek MB, Michel MZ. Histone decetylse inhiition in colorectl cncer cells revels competing roles for memers of the oncogenic mir-7-92 cluster. Mol Crcinog. 23;52(6): Zeiner GM, Normn KL, Thomson JM, Hmmond SM, Boothroyd JC. Toxoplsm gondii infection specificlly increses the levels of key host micrornas. PLoS One. 2;5():e Mu P, Hn YC, Betel D, Yo E, Squtrito M, Ogrodowski P, et l. Genetic dissection of the mir-7 ~ 92 cluster of micrornas in Myc-induced B-cell lymphoms. Genes Dev. 29;23(24): Pospisil V, Vrgov K, Kokvec J, Ryrov J, Svvulidi F, Jonsov A, et l. Epigenetic silencing of the oncogenic mir-7-92 cluster during PU.-directed mcrophge differentition. EMBO J. 2;3(2): Thoms M, Lnge-Grunweller K, Hrtmnn D, Golde L, Schlereth J, Streng D, et l. Anlysis of Trnscriptionl Regultion of the Humn mir-7-92 Cluster; Evidence for Involvement of Pim-. Int J Mol Sci. 23;4(6): Dvie JR. Inhiition of histone decetylse ctivity y utyrte. J Nutr. 23;33(7 Suppl):2485S 93S. 32. Richon VM, Sndhoff TW, Rifkind RA, Mrks PA. Histone decetylse inhiitor selectively induces p2waf expression nd gene-ssocited histone cetyltion. Proc Ntl Acd Sci U S A. 2;97(8): Shin S, Lee EM, Ch HJ, Be S, Jung JH, Lee SM, et l. MicroRNAs tht respond to histone decetylse inhiitor SAHA nd p53 in HCT6 humn colon crcinom cells. Int J Oncol. 29;35(6): Dejligjerg M, Gruslund M, Litmn T, Collins L, Qin X, Jeffers M, et l. Differentil effects of clss I isoform histone decetylse depletion nd enzymtic inhiition y elinostt or vlproic cid in HeL cells. Mol Cncer. 28;7: Sengupt S, Nie J, Wgner RJ, Yng C, Stewrt R, Thomson JA. MicroRNA 92 controls the G/S checkpoint gene p57 in humn emryonic stem cells. Stem Cells. 29;27(7): Mogilynsky E, Rigoutsos I. The mir-7/92 cluster: comprehensive updte on its genomics, genetics, functions nd incresingly importnt nd numerous roles in helth nd disese. Cell Deth Differ. 23;2(2): Kvngh E, Joseph B. The hllmrks of CDKNC (p57, KIP2) in cncer. Biochim Biophys Act. 2;86(): Woods K, Thomson JM, Hmmond SM. Direct regultion of n oncogenic micro-rna cluster y E2F trnscription fctors. J Biol Chem. 27;282(4): Choi KH, Bsm H, Singh J, Cheng PW. Activtion of CMV promotercontrolled glycosyltrnsferse nd et -glctosidse glycogenes y utyrte, tricosttin A, nd 5-z-2 -deoxycytidine. Glycoconj J. 25;22( 2): Krol J, Loedige I, Filipowicz W. The widespred regultion of microrna iogenesis, function nd decy. Nt Rev Genet. 2;(9): Brtel DP. MicroRNAs: genomics, iogenesis, mechnism, nd function. Cell. 24;6(2): Denli AM, Tops BB, Plsterk RH, Ketting RF, Hnnon GJ. Processing of primry micrornas y the Microprocessor complex. Nture. 24;432(74): Yi R, Qin Y, Mcr IG, Cullen BR. Exportin-5 medites the nucler export of pre-micrornas nd short hirpin RNAs. Genes Dev. 23;7(24): Tsuchid A, Ohno S, Wu W, Borjigin N, Fujit K, Aoki T, et l. mir-92 is key oncogenic component of the mir-7-92 cluster in colon cncer. Cncer Sci. 2;2(2): Nour S, Ymmoto H, Sekimoto M, Tkems I, Miyke Y, Ikeng M, et l. Expression of second clss of KIP protein p57kip2 in humn colorectl crcinom. Int J Oncol. 2;9(): Li JQ, Wu F, Usuki H, Kuo A, Mski T, Fujit J, et l. Loss of p57kip2 is ssocited with colorectl crcinogenesis. Int J Oncol. 23;23(6): Fornri FF, Grmntieri L, Ferrcin M, Veronese A, Sioni S, Clin GA, et l. MiR-22 controls CDKNC/p57 nd CDKNB/p27 expression in humn heptocellulr crcinom. Oncogene. 28;27(43): Liu X, Cheng Y, Zhng S, Lin Y, Yng J, Zhng C. A necessry role of mir- 22 nd mir-222 in vsculr smooth muscle cell prolifertion nd neointiml hyperplsi. Circ Res. 29;4(4): Sun K, Wng W, Zeng JJ, Wu CT, Lei ST, Li GX. MicroRNA-22 inhiits CDKNC/p57 expression in humn colorectl crcinom. Act Phrmcol Sin. 2;32(3): Shin JY, Kim HS, Prk J, Prk JB, Lee JY. Mechnism for inctivtion of the KIP fmily cyclin-dependent kinse inhiitor genes in gstric cncer cells. Cncer Res. 2;6(2): Cuccioll V, Borriello A, Criscuolo M, Sinisi AA, Benciveng D, Trmontno A, et l. Histone decetylse inhiitors upregulte p57kip2 level y enhncing its expression through Sp trnscription fctor. Crcinogenesis. 28;29(3): Dvoren PA, McNeill RE, Lowery AJ, Kerin MJ, Miller N. Identifiction of suitle endogenous control genes for microrna gene expression nlysis in humn rest cncer. BMC Mol Biol. 28;9: Schmittgen TD, Livk KJ. Anlyzing rel-time PCR dt y the comprtive C(T) method. Nt Protoc. 28;3(6): Liu L, Ro JN, Zou T, Xio L, Wng PY, Turner DJ, et l. Polymines regulte trnsltion through Chk2-dependent HuR phosphoryltion. Mol Biol Cell. 29;2(23):