Histone acetyl transferase GCN5 promotes human hepatocellular carcinoma progression by enhancing AIB1 expression

Transcription

1 Mjz et l. Cell Biosci () :7 DOI.8/s Cell & Bioscience RESEARCH Open Access Histone cetyl trnsferse GCN5 promotes humn heptocellulr crcinom progression by enhncing AIB expression Sidr Mjz, Zhngwei Tong, Kesong Peng, Wei Wng, Wenjing Ren, Ming Li, Kun Liu,3, Pingli Mo, Wengng Li nd Chundong Yu,, Abstrct Bckground: Generl control non-depressible 5 (GCN5) is crucil ctlytic component of trnscriptionl regultory complex tht plys importnt roles in cellulr functions from cell cycle regultion to DNA dmge repir. Although GCN5 hs recently been implicted in certin oncogenic roles, its role in liver cncer progression remins vgue. Results: In this study, we report tht GCN5 ws overexpressed in 7 (5.8 %) of 3 humn heptocellulr crcinom (HCC) specimens. Down-regultion of GCN5 inhibited HCC cell prolifertion nd xenogrft tumor formtion. GCN5 knockdown decresed the protein levels of the prolifertion mrker proliferting cell nucler ntigen (PCNA) nd mplified in brest cncer (AIB), but incresed the protein levels of cell cycle inhibitor p Cip/Wf in HepG cells. GCN5 regulted AIB expression, t lest in prt, by cooperting with EF to enhnce AIB trnscription. Consistently, GCN5 expression ws positively correlted with AIB expression in humn HCC specimens in two GEO profile dtsets. Conclusion: Since AIB plys promoting role in HCC progression, our results propose tht GCN5 promotes HCC progression t lest prtilly by regulting AIB expression. This study implictes tht GCN5 might be potentil moleculr trget for HCC dignosis nd tretment. Keywords: Amplified in brest cncer (AIB), Cell prolifertion, Generl control non-depressible 5 (GCN5), Heptocellulr crcinom (HCC), Histone cetyl trnsferse (HAT) Bckground Heptocellulr crcinom (HCC) is the fifth most prevlent cncer nd the second most common cuse of cncer-relted deth worldwide []. Despite significnt progression in dignosis of HCC, the tretment still lcks clinicl efficcy nd remins unstisfctory. Recurrence nd metstsis re the min resons for mortlity fter Correspondence: lwg8@3.com; cdyu@xmu.edu.cn Sidr Mjz nd Zhngwei Tong contributed eqully to this work Stte Key Lbortory of Cellulr Stress Biology, Innovtion Center for Cell Signling Network, School of Life Sciences, Ximen University, Ximen 3, Fujin, Chin Ximen City Key Lbortory of Biliry Trct Diseses, Chenggong Hospitl of Ximen University, Ximen, Chin Full list of uthor informtion is vilble t the end of the rticle the clinicl therpy [], nd the 5-yer survivl rte is limited to mere 3 % [3]. Thus, dissection of the underlying mechnism of HCC progression nd identifiction of potentil moleculr trgets of HCC re crucil. Generl control non-depressible 5 (GCN5), is the first identified trnscription-relted histone cetyl trnsferse (HAT), nd vitl ctlytic component of trnscriptionl regultory complex. GCN5 plys n importnt role in cellulr functions, from cell cycle regultion to DNA dmge repir [ ]. Besides norml cellulr functions, GCN5 hs lso been implicted in certin oncogenic roles. c-myc is often over-expressed in humn cncers nd is ssocited with ggressive tumorigenesis nd poor prognosis [7]. GCN5 increses the stbility of c-myc protein by cetylting its K33 residue [8, 9]. GCN5 cetyltes The Author(s). This rticle is distributed under the terms of the Cretive Commons Attribution. Interntionl License ( which permits unrestricted use, distribution, nd reproduction in ny medium, provided you give pproprite credit to the originl uthor(s) nd the source, provide link to the Cretive Commons license, nd indicte if chnges were mde. The Cretive Commons Public Domin Dediction wiver ( publicdomin/zero/./) pplies to the dt mde vilble in this rticle, unless otherwise stted.

2 Mjz et l. Cell Biosci () :7 Pge of nd stbilizes the trnslocted EA-PBX oncoprotein in cute lymphoblstic leukemi (ALL) to berrntly ctivte HOX, contributing to the filure of cell differentition [, ]. Moreover, GCN5 directly intercts with pygopus homolog (pygo), component of Wnt/β-ctenin pthwy to enhnce the growth of brest cncer stem like cells []. It hs been reported tht GCN5 intercts with EF nd cetyltes H3K9 on its promoter region to fcilitte the expression of Cyclin E nd Cyclin D to promote lung cncer cell prolifertion nd tumor growth [3]. In brest cncer cells, GCN5 modultes microtubule cetyltion medited by HBXIP (heptitis B X-intercting protein) oncoprotein nd enhnces cell migrtion []. Recently, histone cetyltrnsferse inhibitors re shown to block neuroblstom cell growth by suppressing GCN5 expression [5], which highlights the impcts of GCN5 inhibitors s potentil drugs to tret cncer. Tken together, these reports indicte very fundmentl role of GCN5 in severl types of cncers. Hitherto no conclusive study hs been reported tht signifies the role of GCN5 in HCC. With such conspicuous role of GCN5 in cellulr functions nd puttive links to cncer, we investigted the role of GCN5 in HCC progression. We found tht GCN5 ws highly expressed in humn HCC tissues nd HCC cell lines. Further scrutiny of the role of GCN5 in HCC reveled tht GCN5 potentited HCC progression by enhncing the expression of AIB, n oncogene tht plys vitl promoting role in HCC progression. Results GCN5 expression is frequently up regulted in humn HCC tissues nd cell lines To evlute the involvement of GCN5 in HCC, we exmined the expression of GCN5 in set of 3 humn HCC specimens nd four different humn HCC cell lines by Western blot nlysis. Our results showed tht GCN5 protein levels were significntly up-regulted in 7 specimens (5.8 %), but down-regulted in 8 specimens (5.8 %), in totl of 3 HCC specimens versus the surrounding non-tumorous liver tissues (Fig. ). Intriguingly, some GCN5 bnd shifts were observed (Fig. ). In ddition, we observed tht the mrna levels of GCN5 were significntly incresed in HCC specimens compred with non-tumorous tissues (Fig. b). Furthermore, we nlyzed GCN5 expression in humn HCC cell lines MHCC97H, Sk-Hep-, HepG nd Huh-7 nd heptocyte cell line L-O. We observed significnt increse in GCN5 expression in HCC cell lines when compred to heptocyte cell line L-O (Fig. c). Hence the elevted expression of GCN5 in humn HCC specimens nd cell lines indictes tht GCN5 my be n impertive cndidte in HCC progression. GCN5 knockdown reduces HCC cell prolifertion nd colony formtion To determine the role of GCN5 in cell prolifertion, HCC cell lines HepG nd Huh-7 cells s well s heptocyte cell line LO were trnsiently trnsfected with pcmv- Myc expression plsmids to overexpress GCN5. As shown in Fig., GCN5 overexpression significntly enhnced the cell prolifertion rte of HepG, Huh-7, nd LO. Furthermore, two stble GCN5-knockdown HepG cell lines were estblished to determine the effects of GCN5 knockdown on cell prolifertion. Knockdown of GCN5 significntly decresed the cell prolifertion (Fig. b), nd colony formtion (Fig. c). These results indicte tht GCN5 could potentilly promote HCC cell prolifertion nd colony formtion. GCN5 knockdown inhibits xenogrft tumor formtion To investigte the role of GCN5 in HCC progression in vivo, we ssessed the effects of GCN5 knockdown on the growth of HCC xenogrft tumors in nude mice. We subcutneously injected HepG control cells (), nd shgcn5- cells in dorsl flnks of five nude mice, respectively. Five dys fter injection, the tumors were mesured every or 3 dys for weeks with Vernier cliper. GCN5-knockdown tumors grew considerbly slower s compred to the control tumors (Fig. 3). At the end of study dy (3th) the mice were scrificed nd tumors were excised. The control tumors nd shgcn5- knockdown tumors were ligned for comprison. As shown in Fig. 3b, HepG- nd shgcn5- tumors were much smller in size s compred to HepG control tumors. The tumor volume of GCN5-knockdown group (38 ± mm 3 ) ws only 3. % of the control group ( ± 3 mm 3 ) (Fig. 3c). Consistently, the expression of prolifertion mrker proliferting cell nucler ntigen (PCNA) ws significntly decresed in ll representtive GCN5-knockdown HepG tumors (Fig. 3d). These results suggest tht GCN5 plys key role in HCC tumor growth. GCN5 knockdown inhibits cell cycle progression Since GCN5 knockdown decresed cell prolifertion in HCC cells nd ttenuted the formtion of HCC xenogrft tumors in nude mice, we hypothesized tht inhibition of HCC prolifertion by GCN5 knockdown is due to the cell cycle rrest. To confirm our hypothesis, we nlyzed the cell cycle dynmics by flow cytometric nlysis. Compring to the control cells, the cell popultion in G phse ws significntly incresed in GCN5- knockdown cells, with corresponding decrese in S nd G/M phses (Fig. ). These dt suggest tht GCN5 is required for the G-to-S phse trnsition nd its knockdown inhibits the growth of GCN5-knockdown cells by impeding G/S phse trnsition of the cell cycle.

3 Mjz et l. Cell Biosci () :7 Pge 3 of 3 # 5 # N T N T N T T N T N T N T N T N T N T N T N T 7 # 8 # 9 # # 3 5 N T N T N T N T N T N T N T N T N T N T 8 # # 3 3 N T N T N T N T N T N T N T 37 5 N T N T N T b Reltive mrna level 5 3 GCN5 c L-O MHCC97H SK-Hep- HepG Huh-7 Norml Tumor Fig. GCN5 expression is frequently up-regulted in humn HCC tissues nd cell lines. Western blot nlysis of GCN5 protein expression in set of 3 humn HCC specimens nd surrounding non-tumorous tissues. N non-tumorous tissue, T tumor tissue. Asterisk indictes GCN5 up-regulted HCC specimens. Hsh indictes GCN5 down-regulted HCC specimens. β-ctin ws used s loding control. b Reltive mrna levels of GCN5 were up-regulted in HCC specimens. GCN5 mrna levels in pirs of specimens (tumorous nd surrounding non-tumorous liver tissues) were mesured by rel-time PCR. Reltive quntifiction ws chieved by normliztion to GAPDH. p <.5. c Protein expression of GCN5 ws up-regulted in HCC cell lines (MHCC97H, SK-Hep-, HepG, nd Huh-7) compred with heptocyte cell line L-O. All cell lines were cultured in DMEM. β-ctin ws used s loding control To understnd the mechnism by which GCN5 knockdown inhibits cell cycle progression, protein levels of severl cell cycle-relted genes were compred. In two GCN5-knockdown cell lines, while the protein levels of PCNA were significntly decresed s expected, the protein levels of cell cycle inhibitor p Cip/Wf were significntly incresed (Fig. b). It hs been reported tht inhibition of Akt signling cn led to up-regultion of p Cip/Wf [], nd GCN5 cn regulte the ctivtion of Akt [7], we therefore detected the protein levels of phosphorylted Akt t Ser73. As shown in Fig. b, the expression of phosphorylted Akt t Ser73 ws significntly decresed in GCN5-knockdown cells, suggesting tht up-regultion of p Cip/Wf is t lest in prt due to the down-regultion of phosphorylted Akt in GCN5- knockdown cells. AIB hs been implicted in severl cncers [8, 9], nd ttenution of AIB frequently inhibits the ctivtion of Akt signling by suppressing the expression of insulin receptor substrte (IRS)- nd IRS- [ ]. We therefore wondered whether the expression of AIB is down-regulted in GCN5-knockdown cells. Our results showed tht GCN5 knockdown significntly decresed the protein levels of AIB (Fig. b). Consistently, GCN5 knockdown significntly decresed the mrna levels of AIB, but incresed the mrna levels of p Cip/Wf (Fig. c). These results imply tht GCN5 promotes cell cycle progression t lest in prt through upregulting AIB to inhibit p Cip/Wf expression. To further determine whether GCN5 regultes cell prolifertion through AIB, we performed rescue experiment for prolifertion in GCN5-knockdown cells: GCN5- knockdown cells were trnsfected with AIB expression

4 Mjz et l. Cell Biosci () :7 Pge of HepG Ctrl Myc b HepG Normlized men OD Normlized men OD Ctrl Myc Time (h) Huh-7 Ctrl Myc Ctrl Myc Normlized Men OD c.... shgcn Time (h) HepG shgcn Time (h) Normlized Men OD Ctrl Ctrl L-O Myc Myc Time (h) Number of colonies shgcn5- Fig. GCN5 knockdown reduces cell prolifertion in HCC cell lines. GCN5 overexpression enhnced cell prolifertion in HepG, Huh-7 nd L-O cells. Overexpression of GCN5 ws confirmed by Western blot nlysis. MTT ssy ws performed to determine cell prolifertion rte. p <.5, p <.. b Prolifertion ws reduced in stble GCN5-knockdown HepG cells, s mesured by MTT ssy. Down-regultion of GCN5 ws confirmed by Western blot nlysis. c Knockdown of GCN5 inhibited HCC cell colony formtion. p <.5, p <. constructs, nd then cell prolifertion ws mesured by MTT ssy. The results showed tht trnsfection of AIB expression constructs could restore cell prolifertion potentil of GCN5-knockdown cells (Fig. d), suggesting tht GCN5 promotes HCC cell prolifertion t lest modertely through regulting AIB expression. Western blot nlysis of AIB-restored cells showed decrese in p Cip/Wf protein expression (Fig. e), which further

5 Mjz et l. Cell Biosci () :7 Pge 5 of Tumor volume (mm 3 ) 8 8 shgcn Time fter injection (dy) b shgcn5- - -shgcn5 c Tumor volume (mm 3 ) 8 d shgcn5- -PCNA -PCNA Fig. 3 GCN5 knockdown inhibits xenogrft tumor formtion. Knockdown of GCN5 inhibited HCC cell tumorigenesis in vivo. HepG control cells, nd shgcn5- cells were subcutneously injected into dorsl flnks of nude mice, respectively. Five dys fter cell injection, tumor volume ws mesured every or 3 dys. n = 5, p <.5, p <.. b GCN5-knockdown tumors showed significnt decrese in tumor volume compred with control tumors. An imge of tumors is shown. c Tumor volume ws significntly reduced in GCN5-knockdown tumors. d The expression of the PCNA ws decresed in GCN5-knockdown tumors substntites our results nd vlidtes tht GCN5 promotes cell cycle progression through up-regulting AIB to inhibit p Cip/Wf expression. GCN5 regultes AIB expression by enhncing de novo trnscription of the AIB gene Since the mrna levels of AIB were down-regulted in GCN5-knockdown HepG cells, we wondered whether GCN5 cn regulte de novo trnscription of the AIB gene. We therefore exmined the effect of GCN5 overexpression on the AIB promoter ctivity by using AIB promoter reporter ssy. Our results showed tht GCN5 significntly enhnced the AIB promoter ctivity (Fig. 5). Unlike trnscription fctor, GCN5 protein does not contin DNA binding domin. Rther thn binding to DNA directly, GCN5 is recruited by trnscription fctors to specific regions of DNA to regulte gene trnscription [3]. Becuse GCN5 hs been shown to be crucil component of EF--trnsctivting complexes for stimulting EF-dependent trnscription [], nd EF cn enhnce the AIB promoter ctivity directly [5], we contemplted whether GCN5 is required for EF-medited up-regultion of AIB promoter ctivity. As reveled in Fig. 5b, overexpression of EF significntly enhnced the AIB promoter ctivity s expected, but knockdown of GCN5 significntly decresed the AIB promoter ctivity induced by EF trnsfection. These results suggest tht GCN5 coopertes with EF to enhnce de novo trnscription of the AIB gene. Consistently, ChIP ssy reveled tht GCN5 ws recruited to AIB promoter t EF binding sites (Fig. 5c). Anlysis of AIB promoter suggested tht 5/+35 bp region contins two EF binding sites (Fig. 5d). We performed muttion nlysis to determine the role of these EF binding sites in EF/GCN5-medited ctivtion of AIB promoter. We mutted EF binding sites- nd sites- on AIB promoter nd mesured AIB promoter ctivity induced by GCN5, respectively (Fig. 5d). Muttion of EF binding site- significntly decresed the AIB promoter ctivity induced by GCN5 (Fig. 5e), wheres muttion of EF binding site- hd no effect on AIB promoter ctivity induced by GCN5 (Fig. 5e). These results suggest tht GCN5 is recruited to EF binding site- on AIB promoter to promote AIB expression. To

6 Mjz et l. Cell Biosci () :7 Pge of b Percentge % shgcn5- SubG G S G/M -PCNA -Cyclin D -p -p-akt -Akt -AIB c Reltive mrna level GCN5 Reltive mrna level Cyclin D Reltive mrna level AIB Reltive mrna level p d Normlized men OD shgcn5 shgcn5+aib HepG Time (h) Fig. GCN5 knockdown inhibits cell cycle progression. Cell cycle nlysis of stble GCN5-knockdown cells nd control cells were performed by flow cytometry. A totl of 5 cells were seeded into six-well pltes, synchronized by serum strvtion for h nd re-entered into the cell cycle by n exchnge of % FBS DMEM for h. Cell were hrvested nd cell cycle sttus ws mesured by flow cytometry. p <.. b The protein levels of PCNA, p-akt nd AIB were decresed, but the protein levels of p were incresed in GCN5-knockdown cells. c The mrna levels of AIB were decresed, but the mrna levels of p were drsticlly incresed in GCN5-knockdown cells. p <.5, p <.. d Forced expression of AIB rescued the prolifertion of GCN5-knockdown HepG cells. Ech experiment ws performed t lest twice with similr results. All dt re the mens + sd. (n = 3) t ech time point. p <.5, p <.. e Forced expression of AIB in GCN5 knockdown cells decresed the protein level of p e shgcn5 shgcn5+aib -AIB -p

7 Mjz et l. Cell Biosci () :7 Pge 7 of Reltive luciferse ctivity AIB reporter b AIB reporter Ctrl GCN5 Reltive luciferse ctivity c TSS AIB promoter EF binding sites + site site ChIP Input IgG IP:GCN AIB promoter d AIB promoter: AIB promoter mut : AIB promoter mut : TSS EF binding Sites Site Site TSS EF binding Sites Site TSS Site X EF binding Sites Site Site X e Reltive luciferse ctivity 5 3 Ctrl GCN5 AIB promoter AIB promoter mut AIB promoter mut f GCN5 Enrichment sictrl sief sictrl sief -EF IP:IgG IP:GCN5 IP:IgG IP:cetyl-H3K9 Fig. 5 GCN5 regultes AIB expression by enhncing de novo trnscription of the AIB gene. GCN5 enhnced AIB promoter ctivity. 93T cells were trnsfected with AIB promoter reporters with or without PCMV-Myc expression plsmids. Renill luciferse ws trnsfected s internl control. Luciferse ctivities were mesured nd normlized to renill luciferse vlue. All dt re men of independent experiments with three replictes per experiments. p <.. b Knockdown of GCN5 significntly decresed AIB promoter ctivity induced by EF trnsfection. 93T cells were trnsfected with AIB promoter reporters with pgipz-shgcn5 plsmids nd/or EF expression plsmids. Luciferse ctivities were mesured 8 h fter trnsfection. p <.. c GCN5 ws recruited to AIB promoter, s mesured by ChIP ssy. HepG cells were lysed for ChIP ssys using control IgG nd nti ntibody for immunoprecipittion. d Two EF binding sites were mutted in AIB promoter. e Muttion of EF binding site (+5 ~ + bp) significntly decresed the AIB promoter ctivity induced by GCN5 trnsfection. Luciferse ctivities were ssyed nd normlized to Renill luciferse ctivities. p <.. f EF knockdown reduced GCN5 enrichment on AIB promoter. sief ws used to knock down EF in HepG cells. Cells were lysed for ChIP ssys using control IgG nd nti ntibody for immunoprecipittion. p <.5. g GCN5 knockdown reduced H3K9 cetyltion of EF binding site on AIB promoter s mesured by ChIP ssy using nti-histone H3 (cetyl K9) ntibody for immunoprecipittion. p <. g H3K9 cetyl level shgcn5 shgcn5

8 Mjz et l. Cell Biosci () :7 Pge 8 of explore whether EF is essentil for GCN5 recruitment on AIB promoter, we knocked down EF using sirna nd then performed ChIP ssy. As shown in Fig. 5f, down-regultion of EF reduced GCN5 enrichment on AIB promoter, suggesting tht GCN5 is recruited to AIB promoter through ssociting with EF. To determine whether GCN5 is needed to cetylte H3K9 round EF binding site on AIB promoter, we knocked down GCN5 nd performed ChIP ssys using nti-histone H3(cetyl K9) ntibody. Our results showed tht H3K9 cetyltion of EF binding site on AIB promoter ws significntly reduced in GCN5-knockdown cells s compred to control cells (Fig. 5g), indicting tht GCN5 regultes AIB expression by cetylting H3K9 round EF binding site on AIB promoter. The expression of GCN5 positively correltes with AIB in humn HCC specimens from two GEO profile dtsets To determine whether the positive correltion between the expression of GCN5 nd AIB cn be verified in lrger cohort of humn HCC specimens, we nlyzed the expression of GCN5 nd AIB in humn HCC specimens from two GEO profile dtsets (GSE9 nd GSE73). The expression of GCN5 ws positively correlted with AIB in these two GEO profile dtsets (Fig. ). These results further support our notion tht GCN5 regultes AIB expression. Collectively, we drft possible model in which GCN5 enhnces HCC prolifertion t lest prtilly by enhncing AIB expression: GCN5 ssocites with EF nd binds to AIB promoter to enhnce AIB trnscription by promoting the H3K9 cetyltion on AIB promoter, which leds to hyper prolifertion of HCC (Fig. 7). Discussion In this study, we demonstrted the key role of GCN5 in HCC progression. GCN5 ws up-regulted (5.8 %) in humn HCC specimens nd in severl HCC cell lines, suggesting the involvement of GCN5 in HCC progression. This notion is supported by the fct tht GCN5 knockdown hmpered the in vitro prolifertion of HCC cells nd the in vivo growth of HCC tumors in nude mice. Down-regultion of GCN5 in HepG cells resulted in cell cycle rrest. The expression of cell cycle inhibitor p Cip/Wf ws significntly incresed in GCN5- knockdown HepG cells, suggesting tht up-regultion of p Cip/Wf t lest in prt ccounts for cell cycle rrest. It hs been reported tht inhibition of Akt signling cn led to the up-regultion of p Cip/Wf []. In this study, we demonstrted tht GCN5 knockdown significntly inhibited Akt signling by down-regulting p-akt expression, indicting tht up-regultion of p Cip/Wf in GCN5-knockdown HepG cells is prtly due to the reduced Akt signling. Our previous study hs shown tht AIB is bonfide oncogene tht is overexpressed in humn HCC specimens nd promotes HCC progression by enhncing cell prolifertion nd invsion, nd AIB knockdown leds to p-akt down regultion, p Cip/Wf up-regultion nd cell cycle rrest in HepG cells []. Therefore, we speculted tht GCN5 knockdown inhibits HCC cell prolifertion by down-regulting AIB expression. Indeed, knockdown of GCN5 mrkedly decresed both protein nd mrna levels of AIB, suggesting tht GCN5 promote HCC cell prolifertion t lest in prt by enhncing AIB expression. In this study, we demonstrte tht GCN5 cn cooperte with EF to enhnce AIB trnscription. Interestingly, it AIB expression 8 R=.5 p <. n=88 GSE39 8 GSE73 R=. p <. n=3 8 GCN5 expression GCN5 expression Fig. The expression of GCN5 positively correltes with AIB in humn HCC specimens from two GEO profile dtsets. Positive correltion between GCN5 nd AIB (R =.5, p <., n = 88). Expression profiles of 88 humn HCC specimens from GEO dtset (GSE39). The GCN5 probe ID used ws ILMN_787, the AIB probe ID used ws ILMN_7885. b Positive correltion between GCN5 nd AIB (R =., p <., n = 3). Expression profiles of 35 humn HCC specimens from GEO dtset (GSE73). The GCN5 probe ID used ws ILMN_787, the AIB probe ID used ws ILMN_7885 baib expression

9 Mjz et l. Cell Biosci () :7 Pge 9 of TSS GCN5 EF AIB c Site Site EF binding sites HCC prolifertion AIB promoter Fig. 7 A proposed model illustrting the mechnism by which GCN5 enhnces AIB expression nd promotes prolifertion of HCC cells. GCN5 ssocites with EF nd binds to AIB promoter to enhnce AIB trnscription by cetylting H3K9 round EF binding site on AIB promoter hs been shown tht AIB cn lso cooperte with EF to enhnce gene trnscription [5], nd EF cn stimulte GCN5 trnscription [7]. Therefore, it is possible tht AIB cn cooperte with EF to enhnce GCN5 trnscription. If so, GCN5 nd AIB my form n mplifiction circuit to up-regulte ech other through cooperting with EF, leding to drmticlly enhnced cncer cell cycle progression. Further study is needed to vlidte this possibility. GCN5 is histone cetyl trnsferse (HAT), which cetyltes histones to estblish n ctive chromtin environment for trnscriptionl ctivtion. Inhibition of HAT enzymtic ctivity by using HAT inhibitors cn result in the inhibition of cncer cell prolifertion [5]. Severl GCN5-specific HAT inhibitors such s CPTH hve been developed [8, 9]. The effects of GCN5-specific HAT inhibitors on AIB expression nd HCC cell prolifertion re under investigtion. Conclusions Since AIB plys promoting role in HCC progression, our results suggest tht GCN5 promotes HCC progression t lest in prt by enhncing AIB expression. To our knowledge, this study emphsizes for the first time n importnt role of GCN5 in HCC progression. Our study leds us towrd n dditionl strtegy for trgeting AIB in severl cncers which could provide with new options for combintoril therpies thus highlighting its significnce s potentil therpeutic trget for HCC tretment. Methods Tissue smples nd cell lines Tumorous nd djcent non-tumorous liver tissues were collected from 3 ptients who underwent surgery for HCC t the First Affilited Hospitl of Ximen University. Both tumor nd non-tumorous tissues were confirmed histologiclly. Informed consent ws obtined from ech ptient nd the study protocol tht conforms to the ethicl guidelines of the 975 Declrtion of Helsinki ws pproved by the Institute Reserch Ethics Committee, Ximen University. Humn HCC cell lines MHCC97H, SK-Hep-, HepG, nd Huh-7 nd heptocyte cell line L-O were cultured in DMEM supplemented with fetl bovine serum (FBS) nd penicillin streptomycin. Cell trnsfection nd luciferse ctivity ssys The HEK93T cells were trnsfected with reporter plsmids together with PCR3. Rluc s n internl control, in the presence of indicted plsmids by using CCl trnsfection. Cells were hrvested h post-trnsfection nd luciferse ctivity ws ssyed nd normlized to Renill luciferse ctivity by using dul luciferse reporter ssy system (Promeg, Mdison, WI, USA). RNA interference nd stble cell lines pgipz-shgcn5 plsmids were purchsed from Thermo Scientific Compny. To generte stbly trnsfected cells, HepG cells were trnsfected with pgipz-shgcn5 nd control vector, respectively, Approximtely week fter trnsfection the cells were treted with μg/ ml puromycin for 3 weeks. Five hundred cells were plced in mm dish nd individul drug resistnt clones were picked nd expnded for further identifiction. The clones exhibiting significnt GCN5 knockdown were used for further experiments. GCN5 specific trgeting sequence is TTGAGGGTTGTG- TAGAGCT nd EF specific trgeting sequence is AAGUCACGCUAUGAGACCUCA.

10 Mjz et l. Cell Biosci () :7 Pge of Cell prolifertion Cell prolifertion ws nlyzed by MTT ssy. A totl of 3 3 cells were seeded into 9-well pltes nd MTT ws dded to ech well every h. The pltes were incubted for h before ddition of solubilizing solution (. M HCl in % SDS). The bsorbnce ws mesured t 5 nm by using microplte reder. Cell cycle nlysis For cell cycle nlysis, 5 cells were synchronized by serum strvtion for h nd induced to re-enter the cell cycle by n exchnge of % FBS DMEM for h. Both floting nd dherent cells were hrvested nd fixed in 75 % ethnol t C overnight. Cells were incubted with RNse A t 37 C for 3 min, nd then stined with propidium iodide (PI). Cell cycle ws mesured by flow cytometry. Reverse trnscription nd rel time PCR Totl RNA ws isolted with Trizol regent (Invitrogen) ccording to the mnufcturer s instructions. The cdna ws synthesized from μg of totl RNA using MMLV trnscriptse (Toyobo, Shnghi, Chin) with rndom primers. Rel-time PCR were performed using SYBR Premix ExTq (TKR, Dlin, Chin). Reltive quntifiction ws chieved by normliztion to the mount of GAPDH. Primers used were: AIB forwrd: GACCGCTTTTACTTCAGGCATT; AIB reverse: TGTGTTAACCAGGTCCTCTTGCT; p forwrd: CAGGGGAGCAGGCTGAAG; p reverse: GGATTAGGGCTTCCTCTTGG; GAPDH forwrd: AACTTTGGCATTGTGGAAGG, GAPDH reverse: GGATGCAGGGATGATGATGTTCT; GCN5 forwrd: GCACAAGACTCTGGCCTTGA; GCN5 reverse: CGGCGTAGGTGAGGAAGTAG; CyclinD forwrd: GTCTGTGCATTTCTGGTTGCA; CyclinDreverse: GCTGGAAACATGGCCGGTTA. Western blot nlysis Equl mounts of protein lystes were seprted by SDS- PAGE nd trnsferred onto PVDF membrnes. Filters were probed with the following specific primry ntibodies: nti (Snt-cruz), nti-aib (BD Bioscience) nti-p Cip/Wf (BD Biosciences), PCNA (Abcm, Cmbridge, MA, USA), β-ctin (Sigm, St Louis, MO, USA), Akt nd phosphorylted-akt (Cell signling, Dnvers, MA, USA), Anti-histone H3 (cetyl K9) ntibody-chip Grde (Abcm, Cmbridge, MA, USA) nti-cyclind (Abcm, Cmbridge, MA, USA). Blots were then incubted with horserdish peroxidse-conjugted secondry ntibody (Pierce, Rockford, IL, USA) nd visulized by chemiluminescence. The bnd density ws quntified by densitometry using Scion Imge softwre nd normlized to β-ctin levels. Colony formtion ssys For focus formtion ssy, 5 cells were cultured in sixwell pltes in DMEM with % FBS. After 3 weeks, cells were stined with.5 % crystl violet for h to detect foci. Colonies > μm in dimeter were counted. ChIP ssy ChIP ssy were processed ccording to the mnufcturer s instructions. The following primers were used to mplify the DNA frgment corresponding to the sequence from + to +35 on AIB promoter: forwrd: 5 -GTCTCAGCCGCTCCACAGCGACGGC-3 nd reverse: 5 -TGAGGGGAAGCGGCGCGGCCCCGAC-3. Tumor xenogrfts Four to -week-old mle nude mice were obtined from Lbortory Animl Center of Ximen University. HepG-shGCN5 cells nd control cells were subcutneously injected into the dorsl flnks of mice, respectively. From dy 5 fter cell injection, the size of the tumor ws mesured every or 3 dys by vernier cliper long two perpendiculr xes. The volume of the tumor ws clculted following the formul: Volume = Length Width.5. Thirty dys fter injection, mice were scrificed nd the tumors were photogrphed nd used for western blot nlysis. All experimentl procedures involving nimls were performed in ccordnce with niml protocols pproved by Lbortory Animl Center of Ximen University. Sttisticl nlysis The dt were collected from severl independent experiments, with three replictes per experiment. All dt were expressed s mens + sd. Sttisticl significnt effects (p vlue <.5) were exmined using t test in SPSS. for Windows (SPSS Inc., Chicgo, IL, USA). Abbrevitions AIB: mplified in brest cncer ; Ch-IP: chromtin immunoprecipittion; FBS: fetl bovine serum; GCN5: generl control non-depressible 5; GEO: gene expression omnibus; HAT: histone cetyl trnsferse; HCC: heptocellulr crcinom; MTT:,5-(dimethyl--thizolyl)-,5-diphenyl--H-tetrzolium bromide; PCNA: proliferting cell nucler ntigen; PI: propidium iodide. Authors contributions SM, ZT, WL nd CY conceived nd coordinted the study nd wrote the pper. SM, ZT, KP, WW, WR, ML, KL nd PM designed, performed nd nlyzed the experiments shown in Figs.,, 3,, 5,, 7. WL collected humn HCC specimens nd nlyzed the experiments shown in Fig.. All uthors reviewed the results. All uthors red nd pproved the finl mnuscript.

11 Mjz et l. Cell Biosci () :7 Pge of Author detils Stte Key Lbortory of Cellulr Stress Biology, Innovtion Center for Cell Signling Network, School of Life Sciences, Ximen University, Ximen 3, Fujin, Chin. Ximen City Key Lbortory of Biliry Trct Diseses, Chenggong Hospitl of Ximen University, Ximen, Chin. 3 Deprtment of Pthology, Chenggong Hospitl of Ximen University, Ximen, Chin. School of Life Sciences, Engineering Reserch Center of Moleculr Dignostics, Ministry of Eduction, Ximen University, Ximen, Chin. Acknowledgements We would like to thnk Yuzhen Dn for technicl ssistnt. Competing interests The uthors declre tht they hve no competing interests. Avilbility of dt nd supporting mterils section The dtsets supporting the conclusions of this rticle re included within the rticle. Ethics pprovl nd consent to prticipte Tumorous nd djcent non-tumorous liver tissues were collected from 3 ptients who underwent surgery for HCC t the First Affilited Hospitl of Ximen University. Informed consent ws obtined from ech ptient nd the study protocol tht conforms to the ethicl guidelines of the 975 Declrtion of Helsinki ws pproved by the Institute Reserch Ethics Committee, Ximen University. All experimentl procedures involving nimls were performed in ccordnce with niml protocols pproved by Lbortory Animl Center of Ximen University. Funding This work ws supported in prt by grnts from Ntionl Bsic Reserch Progrm of Chin (973 Progrm, No. 5CB5538 to CY), nd the Nturl Science Foundtion of Chin (No nd No. U55 to CY, No. 338 to PM, nd No. 87 to WL). Received: 7 April Accepted: July References. Alzwi W, Cunninghm M, Derden J, Foster GR. Systemtic review: outcome of compensted cirrhosis due to chronic heptitis C infection. Aliment Phrmcol Ther. ;3: Bosch FX, Ribes J, Diz M, Cleries R. Primry liver cncer: worldwide incidence nd trends. Gstroenterology. ;7:S5. 3. Jeml A, Bry F, Center MM, Ferly J, Wrd E, Formn D. Globl cncer sttistics. CA Cncer J Clin. ;:9 9.. Jin Q, Yu LR, Wng L, Zhng Z, Ksper LH, Lee JE, et l. Distinct roles of GCN5/PCAF-medited H3K9c nd CBP/p3-medited H3K8/7c in nucler receptor trnsctivtion. EMBO J. ;3:9. 5. Ngy Z, Tor L. Distinct GCN5/PCAF-contining complexes function s co-ctivtors nd re involved in trnscription fctor nd globl histone cetyltion. Oncogene. 7;: Li S, Shogren-Knk MA. The Gcn5 bromodomin of the SAGA complex fcilittes coopertive nd cross-til cetyltion of nucleosomes. J Biol Chem. 9;8: Lin CY, Loven J, Rhl PB, Prnl RM, Burge CB, Brdner JE, et l. Trnscriptionl mplifiction in tumor cells with elevted c-myc. Cell. ;5: Flinn EM, Wllberg AE, Hermnn S, Grnt PA, Workmn JL, Wright AP. Recruitment of Gcn5-contining complexes during c-myc-dependent gene ctivtion. Structure nd function spects. J Biol Chem. ;77: Ptel JH, Du Y, Ard PG, Phillips C, Crell B, Chen CJ, et l. The c-myc oncoprotein is substrte of the cetyltrnsferses hgcn5/pcaf nd TIP. Mol Cell Biol. ;:8 3.. Holmlund T, Lindberg MJ, Grnder D, Wllberg AE. GCN5 cetyltes nd regultes the stbility of the oncoprotein EA-PBX in cute lymphoblstic leukemi. Leukemi. 3;7: Lu Q, Kmps MP. Heterodimeriztion of Hox proteins with Pbx nd oncoprotein E-Pbx genertes unique DNA-binding specifities t nucleotides predicted to contct the N-terminl rm of the Hox homeodomin demonstrtion of Hox-dependent trgeting of E-Pbx in vivo. Oncogene. 997;: Chen J, Luo Q, Yun Y, Hung X, Ci W, Li C, et l. Pygo ssocites with MLL histone methyltrnsferse nd GCN5 histone cetyltrnsferse complexes to ugment Wnt trget gene expression nd brest cncer stem-like cell expnsion. Mol Cell Biol. ;3: Chen L, Wei T, Si X, Wng Q, Li Y, Leng Y, et l. Lysine cetyltrnsferse GCN5 potentites the growth of non-smll cell lung cncer vi promotion of EF, cyclin D, nd cyclin E expression. J Biol Chem. 3;88:5.. Li L, Liu B, Zhng X, Ye L. The oncoprotein HBXIP promotes migrtion of brest cncer cells vi GCN5-medited microtubule cetyltion. Biochem Biophys Res Commun. 5;58: Gjer JM, Furds SD, Grunder A, Gothwl M, Heinicke U, Keller K, et l. Histone cetyltrnsferse inhibitors block neuroblstom cell growth in vivo. Oncogenesis. 5;:e37.. Thler S, Hhnel PS, Schd A, Dmmnn R, Schuler M. RASSFA medites pcip/wf-dependent cell cycle rrest nd senescence through modultion of the Rf-MEK-ERK pthwy nd inhibition of Akt. Cncer Res. 9;9: Kikuchi H, Kuribyshi F, Tkmi Y, Imjoh-Ohmi S, Nkym T. GCN5 regultes the ctivtion of PI3K/Akt survivl pthwy in B cells exposed to oxidtive stress vi controlling gene expressions of Syk nd Btk. Biochem Biophys Res Commun. ;5: Zhou G, Hshimoto Y, Kwk I, Tsi SY, Tsi MJ. Role of the steroid receptor coctivtor SRC-3 in cell growth. Mol Cell Biol. 3;3: Tong ZT, Wei JH, Zhng JX, Ling CZ, Lio B, Lu J, et l. AIB predicts bldder cncer outcome nd promotes bldder cncer cell prolifertion through AKT nd EF. Br J Cncer. 3;8:7 9.. Yn J, Yu CT, Ozen M, Ittmnn M, Tsi SY, Tsi MJ. Steroid receptor coctivtor-3 nd ctivtor protein- coordintely regulte the trnscription of components of the insulin-like growth fctor/akt signling pthwy. Cncer Res. ;:39.. Kung SQ, Lio L, Wng S, Medin D, O Mlley BW, Xu J. Mice lcking the mplified in brest cncer /steroid receptor coctivtor-3 re resistnt to chemicl crcinogen-induced mmmry tumorigenesis. Cncer Res. 5;5: Kung SQ, Lio L, Zhng H, Lee AV, O Mlley BW, Xu J. AIB/SRC-3 deficiency ffects insulin-like growth fctor I signling pthwy nd suppresses v-h-rs-induced brest cncer initition nd progression in mice. Cncer Res. ;: Frri A, Li W, Dent SY. KATs in cncer: functions nd therpies. Oncogene. 5;3:9 3.. Lng SE, McMhon SB, Cole MD, Hering P. EF trnscriptionl ctivtion requires TRRAP nd GCN5 cofctors. J Biol Chem. ;7: Mussi P, Yu C, O Mlley BW, Xu J. Stimultion of steroid receptor coctivtor-3 (SRC-3) gene overexpression by positive regultory loop of EF nd SRC-3. Mol Endocrinol. ;: Xu Y, Chen Q, Li W, Su X, Chen T, Liu Y, et l. Overexpression of trnscriptionl coctivtor AIB promotes heptocellulr crcinom progression by enhncing cell prolifertion nd invsiveness. Oncogene. ;9: Yin YW, Jin HJ, Zho W, Go B, Fng J, Wei J, et l. The histone cetyltrnsferse GCN5 expression is elevted nd regulted by c-myc nd EF trnscription fctors in humn colon cncer. Gene Expr. 5;: Chimenti F, Bizzrri B, Mccioni E, Secci D, Bolsco A, Chimenti P, et l. A novel histone cetyltrnsferse inhibitor modulting Gcn5 network: cyclopentylidene-[-( -chlorophenyl)thizol--yl)hydrzone. J Med Chem. 9;5: Biel M, Kretsovli A, Krtzli E, Ppmthekis J, Ginnis A. Design, synthesis, nd biologicl evlution of smll-molecule inhibitor of the histone cetyltrnsferse Gcn5. Angew Chem. ;3:397.