Targeting Estrogen-Related Receptor Alpha Inhibits Epithelial-to-Mesenchymal Transition and Stem Cell Properties of Ovarian Cancer Cells

Transcription

1 Acquired nd multigenic disese The Americn Society of Gene & Cell Therpy originl rticle Trgeting Estrogen-Relted Receptor Alph Inhiits Epithelil-to-Mesenchyml Trnsition nd Stem Cell Properties of Ovrin Cncer Cells Sophi SN Lm, Ay SC Mk, Judy WP Ym, Annie NY Cheung, Hextn YS Ngn 3, nd Alice ST Wong School of Biologicl Sciences, University of Hong Kong, Pokfulm Rod, Pokfulm, Hong Kong; Deprtment of Pthology, University of Hong Kong, Sssoon Rod, Pokfulm, Hong Kong; 3 Deprtment of Ostetrics nd Gynecology, University of Hong Kong, Sssoon Rod, Pokfulm, Hong Kong Epithelil mesenchyml trnsition represents key event in cncer progression nd hs emerged s promising nticncer trget. Estrogen-relted receptor lph () is frequently elevted in dvnced-stge ovrin cncer, ut its potentil role in tumor progression is not known. Here we show tht functions in epithelil mesenchyml trnsition nd in susequent stem cell trits responsile for the cquisition of high degree of ggressiveness nd potentil for metstsis tht re chrcteristic of ovrin cncer. Importntly, trgeted inhiition of lso inhiited the expression of, repressor of E-cdherin nd n inducer of epithelil mesenchyml trnsition. Interestingly, induction of resulted from not only chnges in mrna trnscription rte ut lso mrna stility. We thus identified the mir- fmily s new plyer in the -medited posttrnscriptionl regultion of, nd ntgonism of mir-/ could revert the decresed expression of nd reversl of epithelil mesenchyml trnsition nd stem cell chrcteristics due to depletion. Finlly, we showed tht RNA interference medited inhiition of significntly reduced tumor urden, scites formtion, nd metsttic peritonel nodules in vivo in n orthotopic model of ovrin cncer. These results suggest ctivtion s mechnism of tumor ggressiveness nd imply tht trgeting my e promising pproch in ovrin cncer tretment. Received 3 Septemer 3; ccepted 8 Decemer 3; dvnce online puliction 8 Ferury 4. doi:.38/mt.4. INTRODUCTION Ovrin cncer is n ggressive disese, with 4, cses dignosed worldwide ech yer, nd is the leding cuse of deth mong ll gynecologic tumors. The lte dignosis, comined with widespred intrperitonel metstsis nd scites formtion, mkes it extremely chllenging to tret ovrin cncer in which current tretment options re lrgely ineffective, resulting in disml 5-yer survivl of <5%. Therefore, understnding the moleculr mechnisms tht medite ovrin cncer progression is criticlly importnt in the serch for novel therpeutic pproches. Estrogen-relted receptor lph () ws mong the first orphn memers of the nucler receptor superfmily to e discovered. Becuse of its structurl similrities with estrogen receptor, initil studies on the possile roles of focused minly on the potentil cross tlk etween these two receptors. However, this concept hs recently een revisited to revel estrogen receptor independent functions tht re unique to in tumor iology. Of prticulr interest, levels of, ut not those of other fmily memers, re ssocited with worse prognosis nd hve een reported to e elevted in the more-ggressive tumors in ovrin cncer. 3,4 This opens the possiility tht could directly regulte tumor progression of ovrin cncer cells. However, whether nd how is involved in the process of metstsis remins unknown. Epithelil-to-mesenchyml trnsition (EMT) is considered key step in metstsis, including ovrin cncer, which endows crcinom cells with enhnced migrtory nd survivl ilities tht fcilitte mlignnt progression. 5,6 Recent findings further illustrte link etween EMT nd the gin of stem cell properties, nd these studies provide new concept for therpies tht trget cncer stem cells (CSCs). 7 Understnding the moleculr mechnisms tht enle ovrin cncer cell dissemintion, in prticulr chrcterizing EMT effectors, will yield importnt insights. Loss or reduction of E-cdherin is well-estlished hllmrk of EMT, nd the zinc finger trnscription fctors of the / Slug fmily hve een implicted in this repression. 8 Although downstrem effects of /Slug ctivtion re well defined, less is known out primry events tht initite EMT. Moreover, given tht directly inhiiting trnscription fctors is currently infesile, 9, identifying their upstrem regultors will lso hve gret therpeutic significnce. In this study, we show for the first time tht trgeted inhiition of in highly metsttic ovrin cncer cells significntly ttenutes EMT, CSC formtion, nd metstsis in vitro nd in vivo. We lso provide mechnistic insight suggesting tht mir-s, newly identified trgets of ction, is criticl upstrem effector of -dependent repression of E-cdherin of in this process. Correspondence: Alice ST Wong, School of Biologicl Sciences, University of Hong Kong, 4S-4 Kdoorie Biologicl Sciences Building, Pokfulm Rod, Pokfulm, Hong Kong. Emil: wong@hku.hk. Moleculr Therpy vol. no. 4, pr

2 Trgeting in Ovrin Cncer The Americn Society of Gene & Cell Therpy RESULTS Trgeted inhiition of suppresses EMT EMT is n importnt driver of cncer progression. To ssess the functionl role of in EMT, we first trnsfected OVCAR-3 cells with the wild-type construct, tking dvntge of its low expression nd epithelil morphology, nd chnges in cell ehvior were followed y opticl microscopy. Figure shows tht OVCAR-3 cells trnsfected with lost their colestone-like epithelil morphology ut were dispersed nd ssumed spindle-like firolst ppernce. These chnges re typicl of cells with mesenchyml phenotype. Conversely, we used RNA interference medited suppression of in SKOV- 3, which hd high expression nd the cells in which were spindle-shped nd exhiited reduced cell cell contct (Figure ). The effectiveness of this smll interfering RNA () in depleting expression ws confirmed y western lotting c OVCAR-3 OVCAR-3 E-cdherin N-cdherin E-cdherin N-cdherin % of scttered colonies % of scttered colonies NS NS E-cdherin N-cdherin E-cdherin N-cdherin Figure induces EMT in ovrin cells. () OVCAR-3 cells trnsfected with empty vector or construct or () cells trnsfected with or for 4 hours were fixed nd ssessed for morphologic chnges consistent with EMT. Left, the presence of spindle-shped cells with loss of epithelil cell morphology ws noted in -overexpressing nd treted cells. Right, scttered colonies were scored. Inset, whole-cell lystes were nlyzed for the levels of y western lot nlysis. (c) Expression of the epithelil cell molecule E-cdherin nd expression of mesenchyml mrker N-cdherin were ssessed y western lotting. ws included s loding control. The nd intensities were quntified y densitometric nlysis nd expression levels reltive to tht of re indicted. Results re presented s the men ± SD nd were nlyzed using Mnn Whitney U-test. P <.5, compred with or. Br = 5 μm. EMT, epithelil mesenchyml trnsition;, estrogen-relted receptor lph; NS, nonspecific;, smll interfering RNA. (Figure, inset). Knockdown of could revert the mesenchyml phenotype to n epithelil phenotype (Figure ). This ws lso confirmed y western lot nlysis, which showed decrese of the epithelil cell mrker, E-cdherin expression, nd n increse of the mesenchyml cell mrker, N-cdherin expression, on overexpression (Figure c). Knocking down lso stimulted the induction of E-cdherin nd suppressed the expression of N-cdherin (Figure c). The use of nonspecific hd no effect. In ddition, there ws correltion etween expression nd metsttic phenotype in cell lines (Supplementry Figure S). ws highly expressed in COV-3,, nd HEYA8 cells, ll of which hve een shown to frequently metstsize when inoculted into mice. OVCAR-3 nd OV-9 cells, which possess less metsttic potentil, showed lower expression. ws sent in humn ovrin surfce epithelium (OSE), the tissue of origin of epithelil ovrin crcinoms. Together, these dt show criticl role of in the induction of EMT nd metsttic phenotypes. represses E-cdherin expression through nd Slug re zinc finger trnscription fctors tht induce EMT nd repress E-cdherin gene trnscription. 3 5 To elucidte the mechnism of -regulted EMT, we exmined chnges in expression levels of these trnscription fctors. Our results showed tht overexpression of ws ssocited with n increse in the expression of ut it hd no effect on Slug (Figure ). To further elucidte the involvement of in upregultion, ws repressed y the use of. -specific OVCAR-3 Slug Slug Figure induces the expression of. () OVCAR-3 cells were trnsfected with empty vector or construct or () cells were trnsfected with nonspecific (NS) or for 4 hours. Totl RNA ws extrcted nd reverse trnscription polymerse chin rection ws performed using sequence-specific primers to,, nd Slug. ws included s n internl control. The signl intensities were quntified y densitometric nlysis nd the mount ws normlized for the mount of. Results re presented s the men ± SD nd were nlyzed using Mnn Whitney U-test. P <.5, compred with or., estrogenrelted receptor lph;, smll interfering RNA. Slug Slug vol. no. 4 pr. 4

3 The Americn Society of Gene & Cell Therpy Trgeting in Ovrin Cncer mrkedly reduced mrna (Figure ). No inhiition ws oserved with nonspecific (Figure ). Similrly, did not ffect Slug expression (Figure ), suggesting potent role of in -medited EMT regultion. ctivtes vi oth trnscriptionl nd posttrnscriptionl mechnisms Next, we exmined the mechnism y which increses mrna expression. This increse could e due to the result of incresed synthesis of the trnscript nd/or stility. To exmine whether ws ctivted t the trnscriptionl level, luciferse reporter contining the 5 promoter region of ws expressed in -expressing cells. As shown, the expression of cused significnt increse in the ctivtion of the promoter (Figure 3). To exmine whether regultes expression t the posttrnscriptionl level, we performed ctinomycin D chse experiments to determine the hlf-life of mrna. Figure 3 shows tht the hlf-life of mrna ws drmticlly prolonged y expression. However, in cells tht were treted with, there ws sustntil decrese in the hlf-life of mrna (Figure 3c), suggesting tht the significnt increse in mrna levels in response to could e due to the comined effects on oth trnscription rte nd stility. OVCAR-3 OVCAR-3 Fold chnge of luciferse ctivities pgl-3 sic + promoter + pgl-3 sic + promoter 4 6 (h) 5 c 4 Time (h) (h) 5 4 Time (h) 6 Figure 3 ctivtes the promoter of nd ttenutes its mrna degrdtion. () OVCAR-3 cells were trnsiently trnsfected with.5 μg of the promoter nd 5 ng of β-glctosidse plsmid for 4 hours. Luciferse nd β-glctosidse ctivities were ssyed, nd the luciferse ctivity of ech smple ws normlized with β-glctosidse ctivity. The luciferse ctivity ws clculted reltive to tht with promoter lone, which ws ritrrily ssigned vlue of one. () OVCAR-3 cells trnsfected with the empty vector or construct or (c) cells trnsfected with nonspecific (NS) or were incuted with ctinomycin D (ActD; 5 μg/ml) over time course of,,, 4, nd 6 hours. Totl RNA ws then extrcted nd reverse trnscription polymerse chin rection ws performed using sequence specific primers. ws included s n internl control. The signl intensities were quntified y densitometric nlysis, nd the mount ws normlized for the mount of. Results re presented s the men ± SD nd were nlyzed using Kruskl Wllis test followed y Dunn s test for post hoc nlysis. P <.5, compred with., estrogen-relted receptor lph;, smll interfering RNA. Moleculr Therpy vol. no. 4 pr

4 Trgeting in Ovrin Cncer The Americn Society of Gene & Cell Therpy mir- fmily memers re regulted y MicroRNAs (mirnas), clss of - to 3-nucleotide-long noncoding RNAs, re emerging s n ttrctive mechnism to inhiit gene expression posttrnscriptionlly y either trnsltionl lockge or mrna degrdtion. 6 To identify mirnas tht re regulted y, we performed n unised screen using prediction softwres nd the set of mirnas known to e ssocited with ovrin cncer progression. 7,8 We thus identified the mir- fmily (mir-4, mir-, mir-, nd mir-c) s regultors. Although previously pulished dt hve shown tht mir- fmily memers cn regulte in epilst differentition during development, 9 the regultion of y mir- fmily memers in tumor cells hs never een investigted efore. On exmining the expression level of mir-4, mir-, mir-, nd mir-c, we found tht the mirnas re highly expressed in treted cells, wheres nonspecific treted cells showed no effect (Figure 4). -regulted mir- fmily is involved in medited EMT nd CSC To ssess whether mir- ws required for -induced EMT regultion, we used hs-mir- nd hs-mir- ntgomirs. By inhiiting mir- nd/or mir-, the decresed expression nd the reversl of EMT cused y depletion ws significntly inhiited (Figure 5). Becuse cncer cells tht undergo EMT cn cquire stem cell properties tht promote ggressive metsttic ehvior, we determined the presence of CSCs in knockdown cells. Knockdown of significntly reduced formtion of CSC-enriched spheres (Figure 6). There ws lso significnt decrese in the expression of Nnog, Bmi-, nd Oct-4, which re estlished ovrin CSC mrkers, in knockdown cells (Figure 6). We lso oserved tht mir- nd mir- ntgomirs hd sustntil function in reverting medited inhiition of sphere formtion (Figure 6c). These results revel key role of the mir- fmily memers in -medited EMT regultion nd show tht mir- lso hs role in EMT-regulted CSCs. mir-4 mir- mir- mir-c U mir-4 mir- mir- Figure 4 -induced EMT requires mir- fmily memers. cells were trnsfected with or for 4 hours. Totl RNA ws extrcted nd reverse trnscription polymerse chin rection ws performed using sequence-specific primers to mir- 4, mir-, mir-, nd mir-c. U6 ws included s n internl control. The signl intensities were quntified y densitometric nlysis nd the mount ws normlized for the mount of U6. Results re presented s the men ± SD nd were nlyzed using Mnn Whitney U-test. P <.5, compred with. EMT, epithelil mesenchyml trnsition;, estrogen-relted receptor lph; NS, nonspecific;, smll interfering RNA. mir-c Silencing inhiits orthotopic ovrin cncer metstsis To extend these studies in n niml model, we investigted the effect of silencing on ovrin cncer metstsis. In this in vivo study, luciferse-leled nonspecific or expressing cells were orthotopiclly injected into the ovrin urs, which emultes the clinicl presenttion of humn ptients with ovrin cncer, nd sujected to ioluminescence imging. The results showed tht cells expressing nonspecific grew s highly ggressive tumors nd the tumor cells disseminted to the peritoneum with visile tumor msses growing on the omentum, mesenteries, nd smll owels nd developed scites, reflecting chrcteristics commonly displyed y ovrin cncer lesions (Figure 7). knockdown led to mrked reduction of the scites volume compred with the volume in nonspecific treted cells (Figure 7). Similrly, the numer nd the size of tumor nodules were sustntilly decresed y tretment with thn with nonspecific (Figure 7c), giving further support to the importnce of in ovrin cncer metstsis. DISCUSSION As crucil initil step in cncer metstsis, nti-emt strtegies hold gret promise for the tretment of mny cncers tht currently lck effective therpies. As such, identifying fctors tht control EMT nd the ssocited mlignnt fetures is criticl. overexpression is correlted with poor outcome in ovrin cncer, 3,4 ut the moleculr mechnism underlying the ggressive nture of these tumors remins lrgely unknown. Furthermore, lthough originlly identified s metolic regultor, recent evidence suggests tht its ctions re not confined to metolic regultion. 3 The work presented here is significnt in severl wys. First, we show for the first time n dditionl nd novel role for s criticl positive regultor of EMT nd susequent CSC-like properties nd n inducer of ovrin cncer metstsis, oth in vitro nd in vivo. Moreover, we show new mechnism of ction y which regultes the mir- fmily to modulte the EMT-inducing trnscription fctor to suppress E-cdherin expression. Given tht EMT represents fundmentlly importnt process in ovrin cncer 4 nd tht E-cdherin repression is ssocited with poor outcome in ovrin cncer ptients, 5 our result tht is involved in the regultion of ovrin tumor progression nd metstsis is cliniclly relevnt. There is incresing evidence tht memers of the fmily of trnscription fctors cn e differentilly regulted. 5 Thus, despite the mny similrities etween nd Slug, they might ply importnt ut distinct roles in cncer progression, nd these roles re comptile with current models. 6,7 Moreover, in ddition to, other memers of the zinc finger trnscription fctors, including Ze, SIP, E/E47, nd Twist, hve lso een shown to induce EMT nd metstsis through the repression of E-cdherin. Although is implicted in the erly step of EMT, Ze nd other repressors re responsile for mintennce of the migrtory phenotype. 8 Our dt showing tht induces expression of suggest tht my regulte the first nd necessry phse of the ovrin cncer dissemintion process. These oservtions follow clinicl reports in which primry vol. no. 4 pr. 4

5 The Americn Society of Gene & Cell Therpy Trgeting in Ovrin Cncer nti-mir- nti-mir- nti-mir- nti-mir- % of scttered colonies nti-mir- nti-mir- nti-mir- nti-mir- nti-mir- nti-mir-.5.5 nti-mir- nti-mir- nti-mir- nti-mir- nti-mir- nti-mir- Figure 5 -induced EMT requires mir- fmily memers. () cells were trnsfected with nonspecific (NS) or in comintion with, nti-mir-, or nti-mir- for 4 hours. Morphologic chnges were ssessed y light microscopy (upper) nd scttered colonies were scored (lower). () Totl RNA ws extrcted nd reverse trnscription polymerse chin rection ws performed using sequence-specific primers to. ws included s n internl control. The signl intensities were quntified y densitometric nlysis nd the mount ws normlized for the mount of. Results re presented s the men ± SD nd were nlyzed using Kruskl Wllis test followed y Dunn s test for post hoc nlysis. P <.5, compred with. Br = 5 μm. EMT, epithelil mesenchyml trnsition;, estrogen-relted receptor lph;, smll interfering RNA. ovrin tumors re elieved to engge the EMT progrm t the initil dissemintion stge. 4 It is lso relevnt tht expression in ovrin crcinoms is ssocited with worse prognosis nd shows more ggressive iologicl ehvior. 9 3 We show tht ffects expression not only through trnscriptionl regultion of ut lso through posttrnscriptionl regultion tht trgets the 3 untrnslted region of. This dul mechnism of regultion is similr to wht hs een recently descried for insulin-like growth fctor (IGF)-I signling. EWS-Fli regultes the IGF-I promoter directly nd the expression of IGF-I vi mirnas indirectly. 3,33 The comined ility of in incresing trnscription nd in preventing mrna degrdtion indictes tht it plys centrl role in regulting expression nd thus EMT. Here, we lso descrie novel oncogenic role of in regulting mirnas, lthough previously pulished dt hve shown tht cn e regulted y mir The moleculr mechnism y which might regulte mirna-s is not known. However, there re severl plusile mechnisms: (i) In its cpcity s trnscriptionl regultor, 35,36 my directly lter mir- gene expression. response elements were found t the promoter regions of the mir-/ cluster nd mir-c/4. (ii) Alterntively, my regulte mirna iogenesis y downregulting Drosh nd Dicer trnscriptionlly. Trnscription is incresingly recognized s n importnt mechnism of Drosh nd Dicer regultion, 37 nd -inding sites (TNAGGTCA) within the humn Drosh (GenBnk ccession numer NC_5.9) nd Dicer (GenBnk ccession numer NG_63.) promoters hve een identified. (iii) In ddition, lthough the trnscriptionl mechnism is well recognized, there is now evidence tht nucler receptors cn medite rpid nongenomic signling. 38 These issues remin to e elucidted. There is incresing evidence tht the induction of EMT in trnsformed ovrin cncer cells in vitro or in mouse models genertes cells with CSC chrcteristics, suggesting tht ovrin epithelil cells cn gin CSC chrcteristics through EMT. 39,4 Moreover, CSCs derived from ovrin tumors nd metsttic ovrin peritonel effusions express EMT-ssocited mrkers. 4 Similrly, EMT nd CSC mrkers re frequently ssocited with ovrin crcinoms tht hve propensity to metstsize, thus reinforcing the close reltionship of these processes. 4 Our studies revel role for in linking EMT nd CSCs, which not only Moleculr Therpy vol. no. 4 pr

6 Trgeting in Ovrin Cncer The Americn Society of Gene & Cell Therpy 8 No. of spheres 6 4 Nnog Oct-4 Bmi-.5 Nnog Oct-4 Bmi-.5 NS c 8 nti-mir- No. of sphere 6 4 nti-mir- nti-mir- nti-mir- nti-mir- nti-mir- Figure 6 Knockdown of inhiits CSC phenotype. () cells were trnsfected with nonspecific (NS) or for 7 hours. The numer of tumor spheres generted ws photogrphed (left) nd counted (right). Results re presented s the men ± SD nd were nlyzed using Mnn Whitney U-test. () Totl RNA ws extrcted nd reverse trnscription polymerse chin rection ws performed using sequence-specific primers to Nnog, Oct-4, nd Bmi-. β-actin ws included s n internl control. The signl intensities were quntified y densitometric nlysis nd the mount ws normlized for the mount of. Results re presented s the men ± SD nd were nlyzed using Mnn Whitney U-test. (c) The numer of tumor spheres generted ws photogrphed (left) nd counted (right). Br = 5 μm. Results re presented s the men ± SD nd were nlyzed using Kruskl Wllis test followed y Dunn s test for post hoc nlysis. P <.5; P <., compred with. Br = 5 μm. CSC; cncer stem cells;, estrogen-relted receptor lph;, smll interfering RNA. expnds our understnding of the moleculr mechnism ut lso sheds light on new therpeutic concept tht wrrnts clinicl investigtion. This study further confirms n essentil role of in ovrin cncer progression nd positions it s n importnt trget for cncer tretment. Becuse cells of the humn OSE generlly do not express (Supplementry Figure S), its therpeutic trgeting my offer highly selective pproch. It is lso worth noting tht high levels of re found in vrious cncers, including ovrin cncer, nd high expression is ssocited with poor prognosis in rest, colon, nd ovrin cncers, 4 45 suggesting tht the role of in EMT my hve roder implictions for other tumor cell types. Smll molecules tht modulte ctivity re not yet ville. However, severl orphn nucler receptor ntgonists hve recently entered vrious clinicl trils with success, ut these lso cuse unwnted side effects. 46 Therefore, seeking sfe nd effective therpeutic method is crucil. In recent yers, the use of, powerful gene-silencing technology, hs een widely used for silencing mlignnt genes, including nucler receptors, nd in mny cses, it possesses dvntges (e.g., sfe, efficient, nd specific) s compred with smll molecule inhiitors. 47 The peritonel dissemintion of ovrin cncer my offer significnt trgeting dvntge for intrperitonel gene delivery in tht the therpeutic cn e sensitive nd specific to the trget cells owing to the closed spce of the peritonel cvity. 48 In summry, our studies identify novel role for s positive regultor of EMT. These studies not only provide insights into the roles nd mechnisms for in ovrin cncer progression ut lso suggest tht disruption of signling could serve s new strtegy for reversing EMT nd tumor metstsis, oth mjor dverse events in ovrin cncer tht cuse mortlity. MATERIALS AND METHODS Cell culture nd trnsfection. Humn OSEs were collected with informed consent, nd pprovl of the pproprite institution ethicl committee ws otined efore the study. OSE-57 nd OSE-535 were otined from ovries during lproscopy on women undergoing surgery for nonmlignnt gynecologic diseses. These cells were trnsfected with SV4 lrge T vol. no. 4 pr. 4

7 The Americn Society of Gene & Cell Therpy Trgeting in Ovrin Cncer NS shrna shrna (Life Technologies, Crlsd, CA) ccording to the mnufcturer s instructions. The dt were nlyzed y GeneMpper 4. Softwre (Foster City, CA). Cells were tested in Novemer 3. To express, cells were trnsiently trnsfected with μg plsmid DNA per well in six-well pltes, which ws ccomplished using Lipofectmine regent (Invitrogen, Crlsd, CA), nd incuted for 4 hours ccording to the mnufcturer s instructions. FLAG-tgged ws purchsed from Addgene (Cmridge, MA). c Ascites volume (ml) No. of metstsis NS shrna NS shrna NS shrna shrna shrna shrna Figure 7 knockdown inhiits peritonel dissemintion of ovrin cncer cells in vivo. () NOD/SCID mice were orthotopiclly injected with cells trnsduced y nonspecific (NS) shrna or shrna (three mice per group). At the time of scrifice, ioluminescence imging ws gin performed, nd the peritonel cvity ws ssessed for evidence of metstses. () Ascites fluid ws collected nd the volume ws mesured. (c) The metsttic lesions were excised nd their totl numer ws counted. Results re presented s the men ± SD nd were nlyzed using Mnn Whitney U-test., estrogen-relted receptor lph; NOD/SCID, nonoese dietic/severe comined immunodeficient; shrna, short hirpin RNA. ntigen to increse the prolifertive life spn of the cells ut remin nontrnsformed. 49 The humn ovrin cncer cells COV-3, OVCAR-3, nd ( gift from Dr. N. Auersperg, University of British Columi, Vncouver, BC, Cnd) were mintined in Medi 99/MCDB5 (:), nd the OV-9 (Americn Type Culture Collection, Rockville, MD) nd HEYA8 ( gift from Dr. J. Liu, M. D. Anderson Cncer Center, Houston, TX) were mintined in RPMI 64; oth medi contined % fetl ovine serum, units/ml penicillin, nd μg/ml streptomycin, nd cells were cultured in humidified incutor with 5% CO t 37 C. All cell lines were regulrly exmined to monitor cellulr morphology nd tested to ensure the sence of mycoplsm contmintion. Cell lines were uthenticted with n AmpFLSTR Identifier Plus PCR Amplifiction Kit 5 RNA interference-medited gene silencing. gene specific duplexes (5 -GGCCUUCGCUGAGGACUUA-3 ) or nonspecific control oligonucleotides (5 -GGCTACGTCCAGGAGCGCA-3 ) were purchsed from Dhrmcon (Lfyette, CO). Trnsfection ws performed t finl concentrtion of nmol/l using silentfect (Bio-Rd, Hercules, CA). Stle trnsfection ws performed first to produce virl prticles constitutively expressing short hirpin RNA or nonspecific short hirpin RNA with pckging cell line 93T using Lipofectmine regent (Invitrogen). The medium contining lentivirus ws collected 48 hours lter, cells were infected with lentivirus, nd the trnsfected cells were selected in μg/ml puromycin (Invitrogen). Reverse trnscription polymerse chin rection nlysis. Totl RNA ws isolted using Trizol regent (Invitrogen). RNA ws reverse trnscried to cdna using the SuperScript III first-strnd synthesis kit ccording to the mnufcturer s instructions (Invitrogen). The primers used in this study were the following: 5 -TCCAGCTCCCACTC- GCTGCC-3 (sense) nd 5 -ACACTCGTTGGAGGCCGGAC-3 (ntisense));, 5 -TTCCAGCAGCCCAACGACCAG-3 (sense) nd 5 -CGGACTCTTGGTGCTTGTGGA-3 (ntisense); Slug, 5 -ACGCCTC- CAAAAAGCCAAAC-3 (sense) nd 5 -GGTAATGTGTGGGTCC- GAAT-3 (ntisense); Nnog, 5 -AAGACAAGGTCCCGGTCAAG-3 (sense) nd 5 -CCTAGTGGTCTGCTGTATTAC-3 (ntisense); Oct-4, 5 -ATCCTGGGGGTTCTATTTGG-3 (sense) nd 5 -TCTCCAGGTT- GCCTCTCACT-3 (ntisense); Bmi-, 5 -ATGTGTGTGCTTTGTG- GAG-3 (sense) nd 5 -AGTGGTCTGGTCTTGTGAAC-3 (ntisense); nd, 5 -TCACCGAGGCCCCTCTGAACCCTAGA-3 (sense) nd 5 -GGCAGTAATCTCCTTCTGCATCCT-3 (ntisense). The numer of mplifiction cycles, during which polymerse chin rection product formtion ws limited y templte concentrtion, ws determined in pilot experiments. To mesure the expression of mture mir-s, totl RNA from cells ws isolted using Trizol regent (Invitrogen). Reverse trnscription polymerse chin rection rections were crried out using Tqmn microrna reverse trnscription kit (Applied Biosystems, Foster City, CA) nd the following specific stem loop primers: mir-4, 5 -GTTGGCTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAG CCAACCCATCT-3 ; mir-, 5 -GTTGGCTCTGGTGCAGGGTCCG AGGTATTCGCACCAGAGCCAACACATCG-3 ; mir-, 5 -GTTGG CTCTGGTGCAGGGTCCGAGGTATTCGCACCAGAGCCAACTC ATCA-3 ; nd mir-c, 5 -GTTGGCTCTGGTGCAGGGTCCGAGG- TATTCGCACCAGAGCCAACTCCATC-3. U6 ws used s n internl control. Western lotting. Whole-cell lystes were prepred using sodium dodecyl sulfte lysis uffer (6 nmol/l Tris HCl, ph 6.8,.8% sodium dodecyl sulfte, 4% glycerol), μg/ml leupeptin, protinin, nd mmol/l phenylmethylsulfonyl fluoride (Roche Bsel, Switzerlnd). Lystes ( μg) were seprted y 7.5% sodium dodecyl sulfte polycrylmide gel electrophoresis. Proteins were electrotrnsferred to nitrocellulose memrnes efore eing incuted with pproprite primry ntiodies: nti- (:,; Upstte, Lke Plcid, NY), nti-n-cdherin (:,; Zymed, Sn Frncisco, CA), nti-e-cdherin (:,; BD Trnsduction Lortories, Sn Diego, CA), nti-flag (:,), nd nti- (:,; Sigm, St. Louis, MO); the memrnes were then processed for enhnced chemiluminescence detection (Amershm, Little Chlfont, UK) ccording to the mnufcturer s protocol. Moleculr Therpy vol. no. 4 pr

8 Trgeting in Ovrin Cncer The Americn Society of Gene & Cell Therpy Luciferse reporter ssy. Cells were trnsiently trnsfected with.5 μg of the 5 promoter region of ( kind gift of Dr. A. Grci de Herreros, Universitt Pompeu Fr, Brcelon, Spin) nd cotrnsfected with 5 ng of β-glctosidse expression plsmid (psv-β-gl; Promeg, Mdison, WI), using Lipofectmine regent (Invitrogen). At 4 hours fter trnsfection, luciferse ctivities were ssyed using the Luciferse Reporter Assy kit ccording to the mnufcturer s protocol (Promeg). β-glctosidse ctivity ws used to normlize the trnsfection. The promoterless luciferse vector (pgl3-bsic) ws used s n internl control. mirna trget prediction nd ntgonism. Potentil upstrem regultors of were predicted y three pulicly ville lgorithms: mirnd ( TrgetScn ( trgetscn.org/), nd RNAhyrid ( de/rnhyrid/). Humn hs-mir- nd hs-mir- ntgomirs or nonspecific control were llowed to form trnsfection complexes with Lipofectmine (Invitrogen) t finl concentrtion of nmol/l, ccording to the mnufcturer s protocol. Cell sctter ssy. To evlute EMT, morphologic chnges were ssessed y opticl microscopy. Briefly, 6, cells were plted in six-well pltes, llowed to form smll colonies, nd were then trnsfected with the indicted plsmids nd imged. Scttered colonies were judged y typicl chnge in morphology chrcterized y cell cell dissocition nd the cquisition of migrtory firolst-like phenotype. Scttering ctivity ws mesured in the totl numer of scttered colonies from 5 colonies under light microscope. Sphere-forming ssy. Sphere-forming ssys were conducted s previously descried. 5 Briefly, 5, cells/ml were plted in ultr-low-ttchment -mm culturing dish in serum-free stem cell selective medium. After 7 hours, ech well ws exmined using light microscope, nd the numer of spheres ws counted. Orthotopic metsttic ovrin cncer model. All niml cre nd experimentl procedures were crried out ccording to institution-pproved protocols in complince with the Committee for the Use of Lortory Animls. Femle nonoese dietic/severe comined immunodeficient mice (Chrles River Lortories, Wilmington, MA) were used. Luciferseleled cells ( 6 ) were inoculted under the ovrin urs of 6- to 8-week-old femle nonoese dietic/severe comined immunodeficient mice (n = 3 mice per group, nd the experiment ws conducted twice). Mice were ssessed weekly for metstsis vi intrperitonel injections with μl of 3 mg/ml d-luciferin nd in vivo ioluminescence ws ssessed using Xenogen IVIS cooled chrge-coupled device cmer (Xenogen, Almed, CA). At the time of scrifice, scites volume ws determined with pipette, nd the numer of ll visile (>. cm dimeter) tumor nodules in the peritonel cvity ws ssessed s evidence of metstses. Sttisticl nlysis. Experiments were done in duplicte or triplicte nd were repeted t lest four or five times, with ech experiment yielding essentilly identicl results. Dt were expressed s men ± SD. All sttisticl nlyses were performed using IBM SPSS softwre (SPSS, Chicgo, IL). P <.5 ws considered sttisticlly significnt. ACKNOWLEDGMENTS The uthors cknowledge the ssistnce of the Fculty Core Fcility of the Li K Shing Fculty of Medicine t the University of Hong Kong (HKU). This work ws supported y HKU Committee on Reserch nd Conference Grnts grnt 95979, Reserch Grnts Council Collortive Reserch Fund grnt CUHK8/CRF/R, nd Croucher Senior Reserch Fellowship to A. S. T. W. The uthors declre no conflict of interest. SUPPLEMENTARY MATERIAL Figure S. Expression of is humn ovrin surfce epithelium nd ovrin cncer cells. REFERENCES. Siegel, R, Nishdhm, D nd Jeml, A (). Cncer sttistics,. CA Cncer J Clin 6: 9.. Giguère, V, Yng, N, Segui, P nd Evns, RM (988). Identifiction of new clss of steroid hormone receptors. Nture 33: Sun, P, Wei, L, Denkert, C, Lichtenegger, W nd Sehouli, J (6). The orphn nucler receptors, estrogen receptor-relted receptors: their role s new iomrkers in gynecologicl cncer. Anticncer Res 6(C): Fujimoto, J, Alm, SM, Jhn, I, Sto, E, Skguchi, H nd Tmy, T (7). Clinicl impliction of estrogen-relted receptor (ERR) expression in ovrin cncers. J Steroid Biochem Mol Biol 4: Thiery, JP nd Sleemn, JP (6). Complex networks orchestrte epithelilmesenchyml trnsitions. Nt Rev Mol Cell Biol 7: Hung, RY, Chung, VY nd Thiery, JP (). Trgeting pthwys contriuting to epithelil-mesenchyml trnsition (EMT) in epithelil ovrin cncer. Curr Drug Trgets 3: Polyk, K nd Weinerg, RA (9). Trnsitions etween epithelil nd mesenchyml sttes: cquisition of mlignnt nd stem cell trits. Nt Rev Cncer 9: Rdisky, DC (5). Epithelil-mesenchyml trnsition. J Cell Sci 8(Pt 9): Groom, CR nd Hopkins, AL (). Protein kinse drugs optimism doesn t wit on fcts. Drug Discov Tody 7: Imming, P, Sinning, C nd Meyer, A (6). Drugs, their trgets nd the nture nd numer of drug trgets. Nt Rev Drug Discov 5: Buick, RN, Pullno, R nd Trent, JM (985). Comprtive properties of five humn ovrin denocrcinom cell lines. Cncer Res 45: Lngdon, SP (4). Isoltion nd culture of ovrin cncer cell lines. Methods Mol Med 88: Btlle, E, Sncho, E, Frncí, C, Domínguez, D, Monfr, M, Bulid, J et l. (). The trnscription fctor snil is repressor of E-cdherin gene expression in epithelil tumour cells. Nt Cell Biol : Cno, A, Pérez-Moreno, MA, Rodrigo, I, Locscio, A, Blnco, MJ, del Brrio, MG et l. (). The trnscription fctor snil controls epithelil-mesenchyml trnsitions y repressing E-cdherin expression. Nt Cell Biol : Bolós, V, Peindo, H, Pérez-Moreno, MA, Frg, MF, Esteller, M nd Cno, A (3). The trnscription fctor Slug represses E-cdherin expression nd induces epithelil to mesenchyml trnsitions: comprison with nd E47 repressors. J Cell Sci 6(Pt 3): Iorio, MV nd Croce, CM (). MicroRNA dysregultion in cncer: dignostics, monitoring nd therpeutics. A comprehensive review. EMBO Mol Med 4: Hu, X, Mcdonld, DM, Huettner, PC, Feng, Z, El Nq, IM, Schwrz, JK et l. (9). A mir- microrna cluster s prognostic mrker in dvnced ovrin cncer. Gynecol Oncol 4: Leskelä, S, Lendro-Grcí, LJ, Mendiol, M, Brriuso, J, Ingld-Pérez, L, Muñoz, I et l. (). The mir- fmily controls et-tuulin III expression nd is ssocited with pclitxel-sed tretment response nd progression-free survivl in ovrin cncer ptients. Endocr Relt Cncer 8: Gill, JG, Lnger, EM, Lindsley, RC, Ci, M, Murphy, TL, Ky, M et l. (). nd the microrna- fmily ct in opposition to regulte epithelil-to-mesenchyml trnsition nd germ lyer fte restriction in differentiting ESCs. Stem Cells 9: Zhng, S, Blch, C, Chn, MW, Li, HC, Mtei, D, Schilder, JM et l. (8). Identifiction nd chrcteriztion of ovrin cncer-inititing cells from primry humn tumors. Cncer Res 68: Mooth, VK, Hndschin, C, Arlow, D, Xie, X, St Pierre, J, Sihg, S et l. (4). Errlph nd Gp/ specify PGC-lph-dependent oxidtive phosphoryltion gene expression tht is ltered in dietic muscle. Proc Ntl Acd Sci USA : Stein, RA, Gillrd, S nd McDonnell, DP (9). Estrogen-relted receptor lph induces the expression of vsculr endothelil growth fctor in rest cncer cells. J Steroid Biochem Mol Biol 4: Delois, G, Hll, JA, Perry, MC, Lgnière, J, Ghhremni, M, Prk, M et l. (9). Genome-wide identifiction of direct trget genes implictes estrogen-relted receptor lph s determinnt of rest cncer heterogeneity. Cncer Res 69: Ahmed, N, Thompson, EW nd Quinn, MA (7). Epithelil-mesenchyml interconversions in norml ovrin surfce epithelium nd ovrin crcinoms: n exception to the norm. J Cell Physiol 3: Sundfeldt, K (3). Cell-cell dhesion in the norml ovry nd ovrin tumors of epithelil origin; n exception to the rule. Mol Cell Endocrinol : Côme, C, Mgnino, F, Bieu, F, De Snt Brr, P, Becker, KF, Theillet, C et l. (6). nd slug ply distinct roles during rest crcinom progression. Clin Cncer Res : Shields, MA, Krntz, SB, Bentrem, DJ, Dngi-Grimell, S nd Munshi, HG (). Interply etween ß-integrin nd Rho signling regultes differentil scttering nd motility of pncretic cncer cells y snil nd Slug proteins. J Biol Chem 87: Peindo, H, Olmed, D nd Cno, A (7)., Ze nd HLH fctors in tumour progression: n llince ginst the epithelil phenotype? Nt Rev Cncer 7: Imi, T, Horiuchi, A, Wng, C, Ok, K, Ohir, S, Nikido, T et l. (3). Hypoxi ttenutes the expression of E-cdherin vi up-regultion of SNAIL in ovrin crcinom cells. Am J Pthol 63: Elloul, S, Elstrnd, MB, Neslnd, JM, Tropé, CG, Kvlheim, G, Golderg, I et l. (5)., Slug, nd Smd-intercting protein s novel prmeters of disese ggressiveness in metsttic ovrin nd rest crcinom. Cncer 3: Blechschmidt, K, Sssen, S, Schmlfeldt, B, Schuster, T, Höfler, H nd Becker, KF (8). The E-cdherin repressor is ssocited with lower overll survivl of ovrin cncer ptients. Br J Cncer 98: Cironi, L, Riggi, N, Provero, P, Wolf, N, Suvà, ML, Suvà, D et l. (8). IGF is common trget gene of Ewing s srcom fusion proteins in mesenchyml progenitor cells. PLoS ONE 3: e vol. no. 4 pr. 4

9 The Americn Society of Gene & Cell Therpy Trgeting in Ovrin Cncer 33. McKinsey, EL, Prrish, JK, Irwin, AE, Niemeyer, BF, Kern, HB, Birks, DK et l. (). A novel oncogenic mechnism in Ewing srcom involving IGF pthwy trgeting y EWS/Fli-regulted micrornas. Oncogene 3: Zho, Y, Li, Y, Lou, G, Zho, L, Xu, Z, Zhng, Y et l. (). MiR-37 trgets estrogen-relted receptor lph nd impirs the prolifertive nd migrtory cpcity of rest cncer cells. PLoS ONE 7: e Sldek, R, Bder, JA nd Giguère, V (997). The orphn nucler receptor estrogenrelted receptor lph is trnscriptionl regultor of the humn medium-chin cyl coenzyme A dehydrogense gene. Mol Cell Biol 7: Tshiro, S, Wng, Z, Kotomur, N, Niw, O, Ued, K nd Kmd, N (997). Nucler proteins inding to the recomintion hotspot region of the retinoic cid receptor lph gene. Leukemi Suppl 3: Dvis, BN nd Ht, A (9). Regultion of MicroRNA Biogenesis: A mirid of mechnisms. Cell Commun Signl 7: Boonyrtnkornkit, V nd Edwrds, DP (7). Receptor mechnisms mediting non-genomic ctions of sex steroids. Semin Reprod Med 5: Kng, KS, Choi, YP, Go, MQ, Kng, S, Kim, BG, Lee, JH et l. (3). CD4? ovry cncer cells exhiit n invsive mesenchyml phenotype. Biochem Biophys Res Commun 43: Ltifi, A, Auker, K, Cstrechini, N, Wrd, AC, Liongue, C, Doill, F et l. (). Cispltin tretment of primry nd metsttic epithelil ovrin crcinoms genertes residul cells with mesenchyml stem cell-like profile. J Cell Biochem : Visvder, JE nd Lindemn, GJ (8). Cncer stem cells in solid tumours: ccumulting evidence nd unresolved questions. Nt Rev Cncer 8: Arizi, EA, Clrk, GM nd Mertz, JE (). Estrogen-relted receptor lph nd estrogen-relted receptor gmm ssocite with unfvorle nd fvorle iomrkers, respectively, in humn rest cncer. Cncer Res 6: Suzuki, T, Miki, Y, Moriy, T, Shimd, N, Ishid, T, Hirkw, H et l. (4). Estrogen-relted receptor lph in humn rest crcinom s potent prognostic fctor. Cncer Res 64: Cvllini, A, Notrnicol, M, Ginnini, R, Montemurro, S, Lorusso, D, Visconti, A et l. (5). Oestrogen receptor-relted receptor lph (ERRlph) nd oestrogen receptors (ERlph nd ERet) exhiit different gene expression in humn colorectl tumour progression. Eur J Cncer 4: Arizi, EA nd Jordn, VC (6). Estrogen-relted receptors s emerging trgets in cncer nd metolic disorders. Curr Top Med Chem 6: Shi, Y (7). Orphn nucler receptors in drug discovery. Drug Discov Tody : Weiss, WA, Tylor, SS nd Shokt, KM (7). Recognizing nd exploiting differences etween RNAi nd smll-molecule inhiitors. Nt Chem Biol 3: Kimll, KJ, Numnum, TM, Rocconi, RP nd Alvrez, RD (6). Gene therpy for ovrin cncer. Curr Oncol Rep 8: Mines-Bndier, SL, Kruk, PA nd Auersperg, N (99). Simin virus 4-trnsformed humn ovrin surfce epithelil cells escpe norml growth controls ut retin morphogenetic responses to extrcellulr mtrix. Am J Ostet Gynecol 67: Chu, WK, Ip, CK, Mk, AS, Li, HC nd Wong, AS (3). c-kit medites chemoresistnce nd tumor-inititing cpcity of ovrin cncer cells through ctivtion of Wnt/ß-ctenin-ATP-inding cssette G signling. Oncogene 3: Moleculr Therpy vol. no. 4 pr. 4 75