Massively Parallel Sequencing of ALG-1 Associated Small RNAs Specifies C. elegans mirnas

Transcription

1 Massively Parallel Sequencing of ALG-1 Associated Small RNAs Specifies C. elegans mirnas in preparation 55

2 56

3 ALG-1 Associated Small RNAs Massively Parallel Sequencing of ALG-1 Associated Small RNAs Specifies C. elegans mirnas Florian A. Steiner, Ronald H.A. Plasterk, Titia Sijen*, and Eugene Berezikov Hubrecht Institute KNAW, Utrecht, 3584 CT, The Netherlands * present address: Netherlands Forensic Institute, The Hague, 2497 GB, The Netherlands Abstract MicroRNAs (mirnas) are important post-transcriptional regulators of gene expression that function through association with Argonaute proteins. The Argonaute proteins required for the mirna pathway in C. elegans are ALG-1 and ALG-2. We used massively parallel sequencing to analyze the spectrum of small RNAs associated with ALG-1. We found that this protein almost exclusively binds to mirnas. Argonaute association is thus an ideal criterion for mirna definition. In addition to 84 known mirnas, we found ten novel mirnas. Introduction MicroRNAs (mirnas) have been discovered as regulators of developmental timing in C. elegans 1,2. It soon became obvious that mirnas are an abundant class of small RNAs that are found in almost all organisms 3. mirnas are transcribed as long RNA polymerase II transcripts which fold into complex secondary structures 4,5. These pri-mirnas are processed into stem-loop precursors (pre-mirnas) by the RNAse III enzyme Drosha in the nucleus 6. PremiRNAs are exported to the cytoplasm 7,8, where another RNase III enzyme, Dicer, cleaves them to release nt mirna duplexes Subsequent to dicing, the mirna duplexes are loaded into a mirnp complex that contains an Argonaute protein as core enzyme One strand of the mirna duplexes becomes the mature mirna, whereas the other strand (mirna star) is discarded. The mature mirnas stably interact with the Argonaute protein and guide the mirnps to the 3 untranslated region of mrnas by partial base pairing 15,16, which results in inhibition of mrna translation or mrna de-adenylation and degradation 17. A second source of mirnas is the recently discovered mirtrons, introns that mimic the structural features of pre-mirnas to enter the mirna-processing pathway without Drosha-mediated cleavage. Instead, mirtron hairpins are defined by the action of the splicing machinery and lariat-debranching enzyme. The mirtron biogenesis pathway merges with the canonical mirna pathway during hairpin export to the cytoplasm, where hairpins of both pathways are diced, and the mature mirnas associate with Argonaute proteins 18,19. 57

4 Figure 1 HA::ALG-1 immunoprecipitation and detection of associated RNA. (a) HA::ALG-1 was immmunoprecipitated from nematode extracts and detected by western blotting. (b) Associated RNA was isolated, treated with phosphatase, 32 P- 5 -labeled and visualized in a 15 % polyacylamide gel. Argonaute proteins function in almost all silencing pathways involving small RNAs Two conserved RNAbinding domains, the Piwi and PAZ domain, interact with the 5 - and 3 -end of the small RNAs, leaving the internal nucleotides available for base pairing Most organisms encode for multiple members of the Argonaute protein family that are involved in different pathways. There are 27 Argonaute proteins in C. elegans, for many of which the function is still unknown. ALG-1 and ALG-2 are two closely related family members that are essential for processing and function of mirnas 10. While plant mirnas usually bind the target mrna with perfect complementarity 26, animal mirnas in most cases recognize target sequences complementary to the seven nucleotide seed of the mirna (nt 1 7 or 2 8) 16, Computational predictions indicate that thousands of genes are regulated by mirnas, and that the average number of genes that is targeted by a mirna is about ,30. Several efforts have been made to characterize the spectrum of mirnas in different organisms. These studies included computational predictions as well as cloning and detection by RNA blotting 3, The total number of mirnas differed greatly depending on the method used. The different approaches and outcomes raised the question how to define mirnas, and how to distinguish them from other small RNAs or from degradation products with no biological relevance 47,48. Since mirnas are expressed from stem-loop precursors, most computational approaches are based on local secondary structure prediction. The mirna that are predicted using this approach were considered mirna candidates, and were considered confirmed when the corresponding ~21mer, or preferably both the mirna and the mirna star, could be detected by RNA blotting or cloning procedures. However, this definition only confirms processing, not function. Here we show that the range of small RNAs associated with the C. elegans ALG-1 consist almost exclusively of mirnas. Massively parallel sequencing reveals 84 58

5 ALG-1 Associated Small RNAs known and ten candidate mirnas. mirnas that are bound by an Argonaute protein are potentially functional. We therefore propose Argonaute association as a new layer of mirna definition. Results ALG-1 binds specifically to mirnas In order to determine the small RNA binding spectrum of ALG-1, a HA-tagged version of the protein was immunoprecipitated from nematode extract of a previously generated transgenic line 49, and RNA was isolated from the immunoprecipitate. 32 P- 5 -end labeling of the RNA showed that it is strongly enriched for small RNAs with a length of about 22 nucleotides (Fig. 1). The RNA from the immunoprecipitate was used to generate a small RNA library that was analyzed by massively parallel sequencing. Analysis of the library generated 114,016 reads, 99.9 % of which are known mirnas. Table 1 gives an overview of the different classes of small RNAs associated with ALG-1, compared to a library made from total small RNA 50. Genomic location and cloning frequencies of the small RNAs present in the two libraries are depicted in Figure 2. Strikingly, ALG-1 displays a very high binding specificity for mirnas, as other classes of small RNAs are bound only at background levels. This suggests that ALG- 1-association is a good criterion for mirna definition. In line with this proposal, 21 of the 88 sequences in the ALG-1 library that do not correspond to known mirnas, are predicted to be expressed from hairpin precursors and thus very likely represent novel mirnas. Sequence analysis reveals ten novel mirnas 135 mirnas are listed in mirbase for C. elegans ( v.10.0). 85 of these are present in our ALG-1 library and are listed in Supplementary table 1. The 21 novel sequences are annotated to ten genomic loci, and may thus represent ten novel mirnas. Table 2 shows sequence and cloning frequencies of these novel mirnas. In case of novel mirna CEL_20, the two clones do not correspond to the same sequence, but rather to both arms of the hairpin precursor, further establishing it as a small RNA class total library ALG-1 library scrna repeats 8, sirna 4,988 2 non-hairpin region 3, known mirna 326, ,928 novel mirna additional hairpin Sense 3, other RNA U 40,185 0 snrna rrna 11,633 0 snorna trna 6,072 0 total 407, ,016 Table 1 Overview of small RNAs found in the library made from ALG-1 associated small RNAs compared to those found in the library made from total small RNAs (Ruby et al., 2006). If a small RNA maps to more than one genomic locus, its number was divided by the number of genomic loci. 59

6 Figure 2 Genomic location and cloning frequencies of small RNAs found in the library made from ALG-1-associated small RNAs (above) and in the library made from total small RNAs (below 48 ). If a small RNA maps to more than one genomic locus, its number was divided by the number of genomic loci. 60

7 ALG-1 Associated Small RNAs real mirna. The genomic location and folding prediction of the novel mirnas are listed in Supplementary table 2. The novel mirnas are cloned in low numbers compared to known mirnas, probably reflecting their low expression levels. Northern blot analysis reflects cloning frequencies in most cases Cloning frequencies of mirnas from the total and the ALG-1 libraries well correlated, and the same three mirnas (mir-52, mir-58 and mir-80) are present in highest numbers in both libraries. To confirm that cloning frequencies reflect abundance in vivo, we tested a limited number of mirnas by northern blot analysis. Detection levels of mir-44, mir-47, mir-58, mir-71 and mir-81 match the cloning frequencies (Fig. 3). Interestingly, mir-789 is absent from the ALG-1 library and is cloned only in small numbers in the total small RNA library 50. However, preliminary data suggests that it is readily detectable in total RNA by northern blotting. mir-789 may thus not be associated with ALG-1 and underrepresented in the library made from total small RNA. Discussion The C. elegans genome contains 27 genes encoding for Argonaute proteins, and most Argonaute proteins function in different pathways and are associated with different classes of small RNAs. It is therefore not surprising that ALG-1 is very specific in binding mirnas. ALG-2 is an Argonaute protein that is also involved in mirnamediated silencing in C. elegans. Microarray analyses have identified largely overlapping sets of mirnas bound to ALG-1 and ALG The two proteins are 88 % identical and may carry out redundant as well as non-redundant functions 49. It is therefore possible that in addition to the set of mirnas that are bound by both Argonaute proteins, there are mirnas that are only associated with one or the other enzyme. This may explain why some mirnas are cloned from total small RNA libraries but not from the library of ALG-1-associated small RNAs. Analysis of ALG-2 associated small RNAs will be necessary to further investigate the differences between the two Argonautes. It is also possible that some mirnas have been uncorrectly annotated in previous cloning efforts. Most mirnas have been defined by cloning from Figure 3 Cloning frequencies reflect abundance of mirnas in most cases. HA::ALG-1 was immunoprecipitated from nematode extracts. RNA was isolated from input extracts, supernatants and immunoprecipitated protein complexes, and mirnas were detected by northern blotting. mir-44, mir-47, mir-58, mir-71, mir-81 and mir-789 were tested. The numbers to the right of the blots indicate cloning frequencies in libraries from total small RNAs and small RNAs associated with ALG-1 (both libraries scaled to 200,000 clones). 61

8 Candidate Clones Sequence CEL_20 2 UUCAAUAUACCGGAUGGUCUGG CEL_46 1 UGUAUGAGCAAAAUGCGAGG CEL_49 1 UUUUGAUUGUUUUUCGAUGAUGUU CEL_51 1 UGUAAAUGGUUGGAAUCUGGU CEL_91 2 CAAGUGAUACCAGACCGCUAGUU CEL_98 2 AAGAUCAUUGUUAGGACGCCAUCU CEL_120 5 AGUUUCUCUGGGAAAGCUAUCGG CEL_121 1 GCACGUGUUACGAUGCUCC CEL_130 1 UGAUCACUUUUAUCGGUUCCG CEL_131 5 UAGCCAAUGUCUUCUCUAUCAUG Table 2 Sequence and cloning frequencies of novel mirnas found in the library made from ALG-1 associated small RNAs. total small RNA samples, analyzing the sequence context (hairpin prediction) and/or the detection of a small RNA by northern blot analysis. However, these criteria focus on biogenesis, not on function, and can be met by small RNAs other than mirnas. Since small RNAs function through the Argonaute protein they are associated with, ALG-1- associated small RNAs are likely to be true mirnas and biologically relevant. mirnas that are cloned at high frequency from total small RNA libraries, but not from the library of ALG-1-associated small RNAs, might therefore not function as mirnas in vivo and belong to another class of small RNAs (assuming that ALG-1 and ALG-2 indeed bind largely overlapping sets of mirnas). ALG-1 association might thus be the ideal criterion to define C. elegans mirnas. In contrast to other small RNAs, the ends of mirnas are not modified, which makes them clonable by standard techniques 50. mir-789 is absent from the ALG-1 library, and represented only by a few clones in the total small RNA library. However, it seems to be readily detected in total RNA by northern blot analysis, suggesting that it is underrepresented in the library made from total small RNA. It may not be a true mirna, since it is not associated with ALG-1, and it may carry end-modifications that prevent cloning via the protocol used in 50. It will be interesting to find whether some mirnas also carry modified ends, or whether these small RNAs belong to a different (novel?) class with a yet unknown function and Argonaute association. Materials and Methods Nematode strains and extract preparation. The Bristol strain N2 was used as the standard wild-type strain. N2 and a nematode strain expressing a HA-tagged version of ALG-1 (pkis2250) 49 were cultured according to standard procedures. Nematode extract was obtained by freezing about 2 ml of nematodes in IP buffer (10 mm Tris HCl ph 7.5, 100 mm KCl, 2 mm MgCl 2, 0.05% Tween-20, 15% glycerol, 5 mm DTT and 1 tablet complete mini EDTA-free protease inhibitor cocktail (Roche) per 10 ml buffer) in liquid nitrogen, followed by grinding with mortar and pestle and homogenizing with 20 strokes in a tight fitting dounce. Debris were spun down twice five minutes in a tabletop centrifuge at 10,000 g at 4 C. 62

9 ALG-1 Associated Small RNAs RNA-immunoprecipitation. HA::ALG-1 was immunoprecipitated from nematode extract by incubation with anti-ha 3F10 affinity matrix (Roche) for 2 hours at 4 C. Protein G-Agarose (Roche) was used as empty beads control. After five washes with IP buffer, 1 % of the immunoprecipitate was used to detect HA::ALG-1 by western blot analysis according to standard procedures using an anti-ha 3F10 antibody (Roche). RNA from nematode extracts and RNA-immunoprecipitations was isolated using Trizol LS (Invitrogen) according to the manufacturers protocol. To assess the quality of the immunoprecipitated RNA, 1 % of the RNA was treated with shrimp alkaline phosphatase (Promega) and 32 P-5 -labeled using T4 poly-kinase (Promega). The remaining RNA was used for library construction or northern blot analysis. Northern blot analysis. For northern blot analyzes, RNA was separated on 15% denaturing polyacrylamide gels and blotted according to standard procedures. mirnas were detected using DNA probes antisense to the mature mirna sequences. Blots were pre-hybridized for 30 min in hybridization buffer (0.36 M Na 2 HPO 4, 0.14 M NaH 2 PO 4, 1 mm EDTA and 7% SDS) and hybridized overnight in hybridization buffer containing 10 pm 32 P-5 -labeled probe at 37 C. After two stringency washes of 30 min at 37 C in 2x SSC/0.1% SDS, the signal was detected by phosphor-imaging according to standard procedures. Library construction and massively parallel sequencing. The small-rna cdna library was prepared by Vertis Biotechnologie AG (Freising-Weihenstephan, Germany) to be suitable for massively parallel sequencing using 454 technology as described previously 31. Briefly, the small RNA fraction was enriched by excision of the 15 to 30 nt fraction from a polyacrylamide gel. For cdna synthesis the RNA molecules in this fraction were first poly A-tailed using poly(a)polymerase followed by ligation of synthetic RNA adapter to the 5 phosphate of the mirnas. First strand cdna synthesis was then performed using an oligo(dt)-linker primer and M-MLV-RNase H- reverse transcriptase. cdna was PCR-amplified with adapter-specific primers and used in single-molecule sequencing. Massively parallel sequencing was performed by MWG Biotech AG (Ebersberg, Germany) using the Genome Sequencer 20 system. Sequence analysis. Computational analysis of small RNA reads was performed as described previously 31 with some modifications. Base calling and quality trimming of sequence reads was done by the 454 software. After masking adapter sequences and removing redundancy, inserts of length 16 bases and longer were mapped to the C. elegans genome (WS170) using megablast software (ftp://ftp.ncbi.nlm.nih. gov/blast/). Reads that did not match perfectly to any location in the genome were only considered if non-matching nucleotides were insertions of A s at the 3 ends of the reads, since these are often aretefacts of sequencing polya-containing reads on the 454 system, which utilizes pyrosequencing chemistry. Next, for every genomic 63

10 locus matching to an insert, repeat annotations was retrieved from the GFF dump of Wormbase ( WS170) and repetitive regions were discarded from further analysis, with the exception of inverted and tandem repeats. Ribosomal RNAs, trnas and snornas were also excluded from further analysis. Genomic regions not annotated as repeats or structural RNAs but containing reads that also mapped to repeat genomic regions, were also excluded. The remaining genomic regions containing inserts with 100 nt flanks were retrieved from wormbase, and RNAshapes program 51 was used to find hairpin structures in sliding windows of 80, 100 and 120 nt. Only regions that 1) folded into hairpins with the abstract shape [] and had a probability of folding greater than 0.8, and 2) contained an insert in one of the hairpin arms, were used in further analysis. To find homologous hairpins in other genomes, mature mirna regions were blasted against worm genomes of C.brenneri, C. briggsae, C. remanei, P. pacificus, as well as against human, mouse, rat and zebrafish genomes. All hits matching to at least 7 continuous nucleotides starting from 1st, 2nd or 3rd nucleotide of the mature sequence were extracted and folded using the RNAshapes program with the same parameters as mentioned above. Next, similarity between all potential homologous hairpins and the original hairpin was calculated using RNAforester software ( rnaforester). Next, homologs from different organisms were aligned with the original hairpin by clustalw 52 to produce a final multiple alignment of the hairpin region. Chromosomal locations of homologous sequences were used to retrieve gene and repeat annotations from the respective species in Wormbase and Ensembl databases. Hairpins that contained repeat/rna annotations in one of the species, as well as hairpins containing mature regions longer that 25 nt or with GCcontent higher than 85% were discarded. For remaining hairpins, randfold values were calculated for every sequence in an alignment using mononucleotide shuffling and 1,000 iterations 53. The cut-off of was used for randfold and only regions that contained a hairpin below this cut-off for at least one species in an alignment were considered as microrna genes. Finally, positive hairpins were split into known and novel micrornas according to annotations. Acknowledgements We thank B. Tops for providing the HA-tagged ALG-1 strain and R. Ketting for discussions. The work was supported by a VIDI-fellowship from the Dutch Scientific Organization (NWO) to T.S. References 1. Lee, R.C., Feinbaum, R.L. & Ambros, V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75, (1993). 2. Reinhart, B.J. et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403, (2000). 3. Lee, R.C. & Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science 294,

11 ALG-1 Associated Small RNAs (2001). 4. Cai, X., Hagedorn, C.H. & Cullen, B.R. Human micrornas are processed from capped, polyadenylated transcripts that can also function as mrnas. Rna 10, (2004). 5. Lee, Y. et al. MicroRNA genes are transcribed by RNA polymerase II. Embo J 23, (2004). 6. Lee, Y. et al. The nuclear RNase III Drosha initiates microrna processing. Nature 425, (2003). 7. Yi, R., Qin, Y., Macara, I.G. & Cullen, B.R. Exportin-5 mediates the nuclear export of pre-micrornas and short hairpin RNAs. Genes Dev 17, (2003). 8. Bohnsack, M.T., Czaplinski, K. & Gorlich, D. Exportin 5 is a RanGTP-dependent dsrna-binding protein that mediates nuclear export of pre-mirnas. Rna 10, (2004). 9. Ketting, R.F. et al. Dicer functions in RNA interference and in synthesis of small RNA involved in developmental timing in C. elegans. Genes Dev 15, (2001). 10. Grishok, A. et al. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 106, (2001). 11. Hutvagner, G. et al. A cellular function for the RNA-interference enzyme Dicer in the maturation of the let-7 small temporal RNA. Science 293, (2001). 12. Hammond, S.M., Boettcher, S., Caudy, A.A., Kobayashi, R. & Hannon, G.J. Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293, (2001). 13. Hutvagner, G. & Zamore, P.D. A microrna in a multiple-turnover RNAi enzyme complex. Science 297, (2002). 14. Mourelatos, Z. et al. mirnps: a novel class of ribonucleoproteins containing numerous micrornas. Genes Dev 16, (2002). 15. Vella, M.C., Choi, E.Y., Lin, S.Y., Reinert, K. & Slack, F.J. The C. elegans microrna let-7 binds to imperfect let-7 complementary sites from the lin-41 3 UTR. Genes Dev 18, (2004). 16. Lewis, B.P., Burge, C.B. & Bartel, D.P. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microrna targets. Cell 120, (2005). 17. Pillai, R.S., Bhattacharyya, S.N. & Filipowicz, W. Repression of protein synthesis by mirnas: how many mechanisms? Trends Cell Biol (2006). 18. Okamura, K., Hagen, J.W., Duan, H., Tyler, D.M. & Lai, E.C. The mirtron pathway generates micrornaclass regulatory RNAs in Drosophila. Cell 130, (2007). 19. Ruby, J.G., Jan, C.H. & Bartel, D.P. Intronic microrna precursors that bypass Drosha processing. Nature 448, 83-6 (2007). 20. Tolia, N.H. & Joshua-Tor, L. Slicer and the argonautes. Nat Chem Biol 3, (2007). 21. Kim, V.N. Small RNAs just got bigger: Piwi-interacting RNAs (pirnas) in mammalian testes. Genes Dev 20, (2006). 22. Carmell, M.A., Xuan, Z., Zhang, M.Q. & Hannon, G.J. The Argonaute family: tentacles that reach into RNAi, developmental control, stem cell maintenance, and tumorigenesis. Genes Dev 16, (2002). 23. Parker, J.S. & Barford, D. Argonaute: A scaffold for the function of short regulatory RNAs. Trends Biochem Sci 31, (2006). 24. Song, J.J. & Joshua-Tor, L. Argonaute and RNA--getting into the groove. Curr Opin Struct Biol 16, 5-11 (2006). 25. Hall, T.M. Structure and function of argonaute proteins. Structure 13, (2005). 26. Schwab, R. et al. Specific effects of micrornas on the plant transcriptome. Dev Cell 8, (2005). 27. Brennecke, J., Stark, A., Russell, R.B. & Cohen, S.M. Principles of microrna-target recognition. PLoS Biol 3, e85 (2005). 28. Doench, J.G. & Sharp, P.A. Specificity of microrna target selection in translational repression. Genes Dev 18, (2004). 29. Kloosterman, W.P., Wienholds, E., Ketting, R.F. & Plasterk, R.H. Substrate requirements for let-7 function in the developing zebrafish embryo. Nucleic Acids Res 32, (2004). 30. Lim, L.P. et al. Microarray analysis shows that some micrornas downregulate large numbers of target mrnas. Nature 433, (2005). 31. Berezikov, E. et al. Diversity of micrornas in human and chimpanzee brain. Nat Genet 38, (2006). 32. Takada, S. et al. Mouse microrna profiles determined with a new and sensitive cloning method. Nucleic Acids Res 34, e115 (2006). 33. Kloosterman, W.P. et al. Cloning and expression of new micrornas from zebrafish. Nucleic Acids Res 34, (2006). 34. Arazi, T. et al. Cloning and characterization of micro-rnas from moss. Plant J 43, (2005). 35. Chen, P.Y. et al. The developmental mirna profiles of zebrafish as determined by small RNA cloning. 65

12 Genes Dev 19, (2005). 36. Sunkar, R., Girke, T., Jain, P.K. & Zhu, J.K. Cloning and characterization of micrornas from rice. Plant Cell 17, (2005). 37. Lim, L.P. et al. The micrornas of Caenorhabditis elegans. Genes Dev 17, (2003). 38. Lagos-Quintana, M. et al. Identification of tissue-specific micrornas from mouse. Curr Biol 12, (2002). 39. Fahlgren, N. et al. High-Throughput Sequencing of Arabidopsis micrornas: Evidence for Frequent Birth and Death of MIRNA Genes. PLoS ONE 2, e219 (2007). 40. Zhang, B., Pan, X., Wang, Q., Cobb, G.P. & Anderson, T.A. Computational identification of micrornas and their targets. Comput Biol Chem 30, (2006). 41. Berezikov, E. et al. Phylogenetic shadowing and computational identification of human microrna genes. Cell 120, 21-4 (2005). 42. Adai, A. et al. Computational prediction of mirnas in Arabidopsis thaliana. Genome Res 15, (2005). 43. Jones-Rhoades, M.W. & Bartel, D.P. Computational identification of plant micrornas and their targets, including a stress-induced mirna. Mol Cell 14, (2004). 44. Kiriakidou, M. et al. A combined computational-experimental approach predicts human microrna targets. Genes Dev 18, (2004). 45. Lai, E.C., Tomancak, P., Williams, R.W. & Rubin, G.M. Computational identification of Drosophila microrna genes. Genome Biol 4, R42 (2003). 46. Grad, Y. et al. Computational and experimental identification of C. elegans micrornas. Mol Cell 11, (2003). 47. Ambros, V. et al. A uniform system for microrna annotation. Rna 9, (2003). 48. Berezikov, E., Cuppen, E. & Plasterk, R.H. Approaches to microrna discovery. Nat Genet 38 Suppl, S2-7 (2006). 49. Tops, B.B., Plasterk, R.H. & Ketting, R.F. The Caenorhabditis elegans Argonautes ALG-1 and ALG-2: Almost Identical yet Different. Cold Spring Harb Symp Quant Biol 71, (2006). 50. Ruby, J.G. et al. Large-scale sequencing reveals 21U-RNAs and additional micrornas and endogenous sirnas in C. elegans. Cell 127, (2006). 51. Steffen, P., Voss, B., Rehmsmeier, M., Reeder, J. & Giegerich, R. RNAshapes: an integrated RNA analysis package based on abstract shapes. Bioinformatics 22, (2006). 52. Thompson, J.D., Higgins, D.G. & Gibson, T.J. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22, (1994). 53. Bonnet, E., Wuyts, J., Rouze, P. & Van de Peer, Y. Evidence that microrna precursors, unlike other non-coding RNAs, have lower folding free energies than random sequences. Bioinformatics 20, (2004). 66

13 ALG-1 Associated Small RNAs Supplementary information Supplementary Table 1 Cloning frequencies of known mirnas found in the library made from ALG-1 associated small RNAs and in the library made from total small RNAs (Ruby et al., 2006). In columns four (total scaled) and five (ALG-1 scaled), the libraries are scaled to 200,000 reads to facilitate comparison. If a mirna maps to more than one genomic locus, its number was divided by the number of genomic loci. mirna total library ALG-1 library total scaled ALG-1 scaled cel-mir-52 37,661 20,180 23,038 35,426 cel-mir-80 20,975 18,123 12,831 31,815 cel-mir-58 32,148 15,006 19,666 26,343 cel-mir-64 3,347 9,084 2,047 15,947 cel-mir-66 16,514 6,013 10,102 10,556 cel-mir-82 6,640 5, ,062 9,168 cel-mir-81 7,715 4, ,719 8,192 cel-mir-2 14,398 4,640 8,808 8,146 cel-mir , ,034 cel-mir-86 12,173 2,937 7,446 5,156 cel-mir-71 8,913 2,126 5,452 3,732 cel-mir-44 12,537 1,793 7,669 3,148 cel-mir-56 5,505 1,572 3,368 2,760 cel-mir , ,746 cel-mir-228 1,224 1, ,716 cel-mir-34 1,841 1,361 1,126 2,389 cel-mir-46 3,258 1,060 1,993 1,861 cel-mir-48 7,332 1,023 4,485 1,796 cel-mir-55 7,573 1,015 4,633 1,782 cel-mir-54 7, ,489 1,720 cel-mir-79 2, ,740 1,699 cel-lin-4 6, ,200 1,605 cel-mir ,519 cel-mir ,431 cel-mir ,324 cel-mir-77 4, ,798 1,181 cel-mir-53 2, ,316 1,166 cel-mir-47 3, , cel-mir-85 2, , cel-mir-40 4, , cel-mir-72 9, , cel-mir-74 8, , cel-mir-1 14, , cel-mir-60 4, , cel-mir-90 1, , cel-mir-50 2, , cel-mir-51 2, , cel-mir

14 cel-mir-57 4, , cel-mir cel-mir cel-mir cel-mir cel-mir-73 2, , cel-mir cel-mir cel-mir-61 1, , cel-mir-67 1, cel-mir-36 5, , cel-mir-38 3, , cel-mir cel-mir-84 2, , cel-mir cel-mir cel-mir cel-mir cel-let-7 3, , cel-mir cel-mir cel-mir cel-mir cel-mir-83 3, , cel-mir-75 2, , cel-mir-70 2, , cel-mir-239a cel-mir-124 3, , cel-mir cel-mir-241 1, , cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir-62 1, cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir

15 ALG-1 Associated Small RNAs cel-mir cel-mir cel-mir cel-mir-239b cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-lsy cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir cel-mir Sum 326, , , ,000 69

16 Supplementary Table 2 Sequence, folding prediction and genomic location of the novel mirnas identified in this study. For details see text. CEL_20 randfold celegans:0.001 cbrenneri:0.001 cremanei:0.001 TTCAATATACCGGATGGTCTGG #celegans_libfl1_elq5oix02gjjmc 22 1/1 celegans.(((((((((((((((.((..((((((((((((...)))))))))))).))))))))))))))))). celegans TTTCACCAGACTATCTAGGAAATATTGAACTAATACAAATTTTAGTTCAATATACCGGATGGTCTGGTGAAA cbrenneri --TCATCAGATTATGCGGACTGTATTGAACTGTTACTATTCAAAGTTCAATATACCGGATAGTCTGATGA-- cremanei --TCGCCAGACTTTCCGTGTGAAATTGAACCTACACAG-TTTAGGTTCAATATACCGGATAGTCTGGTGA-- ** **** * * ******* ** * **************** ***** *** cbrenneri ((((((((((((.(((..(((((((((((...)))))))))))))).)))))))))))) cremanei ((((((((((.((((.(((..((((((((((.....)))))))))).))))))).)))))))))) celegans chromosome:iii: : :1 exon:coding_transcript F35G III: : :1 ## exon:coding_transcript F35G III: : :1 ## exon:coding_transcript F35G III: : :1 ## three_prime_utr:coding_transcript F35G III: : :1 ## three_prime_utr: Coding_transcript F35G III: : :1 ## three_prime_utr:coding_transcript F35G III: : :1 ## exon:msplicer_transcript msp- F35G III: : :1 ## exon:msplicer_transcript msp-f35g III: : :1 ## coding_exon:msplicer_transcript msp-f35g III: : :1 ## coding_exon:msplicer_transcript msp-f35g III: : :1 ## Transcript:Coding_transcript F35G III: : :1 ## Transcript:Coding_transcript F35G III: : :1 ## Transcript:Coding_transcript F35G III: : :1 ## gene:curated F35G12.2 III: : :1 ## gene:gene WBGene III: : :1 cbrenneri contig:contig126.4:10875:10942:1 intergenic cremanei contig:contig26.29:2606:2490:-1 intergenic CEL_46 randfold celegans:0.001 TGTATGAGCAAAATGCGAGG #celegans_libfl1_elq5oix01ekewf 20 0/1 celegans ((((((((...((((..(((((((((((.((((((.((((.(((((((((..(((...))).))))))))))))).)))))).)))))))))))))))...)))))))) celegans ATTTCGGTTGCCTCGTTCGTCGTATATTCGTCGTATATTGCGTCGTACATTCCGGACTTCCTTCTAAATGTATGAGCAAAATGCGAGGAATGTACGATGCGAATTGCCGAGAT ***************************************************************************************************************** celegans chromosome:iv: : :-1 Transcript:Coding_transcript T19E7.6 IV: : :-1 ## intron:twinscan chriv tw IV: : :- 1 ## intron:coding_transcript T19E7.6 IV: : :-1 ## intron:genefinder T19E7.gc5 IV: : :-1 ## intron:curated T19E7.6 IV: : : -1 ## gene:gene WBGene IV: : :-1 ## {Repeats: inverted_repeat:inverted inverted_repeat:inverted IV: : :0 CEL_49 randfold celegans:0.001 cremanei:0.001 TTTTGATTGTTTTTCGATGATGTT #celegans_libfl1_elq5oix02hkqsl 24 0/1 celegans (((.(((.((((((.(((((((((..(((((((((((..(((((..(((((((...)))))))))))).)))))))))))..))))))))))))))).)))...))). celegans TTCTTCAAAAATTGCATTTTCCATCTTTTGATTGTTTTTCGATGATGTTCGTTAAATCGGTATAAGCGAACCATTGTAAACAATCAAAGAATGGAGAATCAATTTATGATCTGGAA cremanei TGATCTCATTT-CCATTTTTTGATTGTTATTCGATGATGT-CGTCGAAT-GGAATTGTCGAACCATTGAAAATAATCAAAAAATGGAGAGA-GATTCA ** ***** **** *********** *********** *** *** ** ** ********** *** ******* ******** *** * cremanei.((((((.((( ((((((((((((((((.(((((((...( ((.(((.....))).)))..)))))))))))))))))))))))))))) )))).. celegans chromosome:iv: : :1 {Repeats: inverted_repeat:inverted inverted_repeat:inverted IV: : :0 cremanei contig:contig14.51:25927:26020:1 intergenic 70

17 ALG-1 Associated Small RNAs CEL_51 randfold celegans:0.002 TGTAAATGGTTGGAATCTGGT #celegans_libfl1_elq5oix01bnajt 21 1/0 celegans...(((..(((((((((.((.(((.((((((.((((..((((((((.((((...)).))..))))))))..)))).)))))).))).)).))))).))))..)))... celegans GGAATTAATTATTTTTGGAGTGGAGCTGTAAATGGTTGGAATCTGGTATAATGGCTTCGAGACTTTTTATACCAATTTCTTACCATTAGCATCTACACTTTCAAATCTAAATCC ****************************************************************************************************************** celegans chromosome:iv: : :1 CEL_91 randfold celegans:0.001 CAAGTGATACCAGACCGCTAGT #celegans_libfl1_elq5oix01bn55u 22 1/0 CAAGTGATACCAGACCGCTAGTT #celegans_libfl1_elq5oix01byv2l 23 0/1 celegans...((((((...(((((((((((((((((...((((((.(((((...))))).))))))...)))))))))))))))))...))))))... celegans TTTATTCTTACTGTCCTCGAATACAAACTGGCGGTTTGCATTCACTTACATTTATAAGACAAAAATGCAAGTGATACCAGACCGCTAGTTTGTAAAAGGGATAATTTTATGTGAA ******************************************************************************************************************* celegans chromosome:x: : :1 {Repeats: inverted_repeat:inverted inverted_repeat:inverted X: : :0 CEL_98 randfold celegans:0.001 AAGATCATTGTTAGGACGCCATC #celegans_libfl1_elq5oix01c151p 23 1/0 AAGATCATTGTTAGGACGCCATCT #celegans_libfl1_elq5oix01dwmd7 24 0/1 celegans ((((...((((..((((((..((.((((..((((((...))))))...))))))..))))))..))))...)))) celegans GGTCCAAAATCGGCAAGATCATTGTTAGGACGCCATCTTGAAGCAATATAAAGATGATAGTCCAATGATGATCCAGCTGTTCAAGGCT **************************************************************************************** celegans chromosome:x: : :-1 intron:twinscan chrx tw X: : :-1 CEL_120 randfold celegans:0.001 cremanei:0.001 AGTTTCTCTGGGAAAGCTATCGG #celegans_libfl1_elq5oix02ju3o1 23 2/0 GAGCTGCCCTCAGAAAAACTCT #celegans_libfl1_elq5oix01b0ebq 22 0/2 AGTTTCTCTGGGAAAGCTATCG #celegans_libfl1_elq5oix01eaxzb 22 0/1 celegans.((((((...((((.(((((.((((((..(((..((((.((...)).)))))))..)).)))).))))).))))...)))))). celegans TTCTTGAAAACTCCAATAGTTTCTCTGGGAAAGCTATCGGCCAAATTTAACTGTCCGAGCTGCCCTCAGAAAAACTCTTGGCTCATCGAGAA cremanei GCCGAGAGTTTATCCAGGAAAGCTATCGGCCGAGTACTTAGAACCGAGCTGCCCTCGGATAGACTCTTGGC ** * ***** ** *************** * * ************* ** * ********* cremanei ((((((((((((((((((..(((..((((...)))))))..))).))))))))))))))) 71

18 celegans chromosome:ii: : :1 intron:genefinder ZK84.gc5 II: : :1 ## intron:twinscan chrii tw II: : :1 ## intron: Coding_transcript ZK84.2 II: : :1 ## intron:curated ZK84.2 II: : :1 ## Transcript:Coding_transcript ZK84.2 II: : :1 ## intron:genefinder ZK84.gc5 II: : :1 ## intron:twinscan chrii tw II: : :1 ## intron:coding_transcript ZK84.2 II: : :1 ## intron:curated ZK84.2 II: : :1 ## Transcript:Coding_transcript ZK84.2 II: : :1 ## gene:curated ZK84.2 II: : :1 ## gene:gene WBGene II: : :1 ## gene:curated ZK84.2 II: : :1 ## gene:gene WBGene II: : :1 cremanei contig:contig3.3:31120:31190:1 intergenic CEL_121 randfold celegans:0.001 GAATCGTAGCGCGTGTTGTTT #celegans_libfl1_elq5oix02fhtr9 21 1/0 celegans ((((((((.(((.(((((((((((((((((((((((.((((((...)))))).))))))))))))))))))))))).)))..)))))))) celegans GATTGAAATTTCACGCTAAACAGCACGTGTTACGATGCTCCGTTAGTTCGGAGTTTTTACGGAGAATCGTAGCGCGTGTTGTTTAGCGCGAattttttaatt ****************************************************************************************************** celegans chromosome:ii: : :-1 {Repeats: inverted_repeat:inverted inverted_repeat:inverted II: : :0 CEL_130 randfold celegans:0.001 cremanei:0.001 TGATCACTTTTATCGGTTCCG #celegans_libfl1_elq5oix02ibvlz 21 0/1 celegans ((((.(((...((((((..(((((((..((...(((((((((..((...)).)))))))))..))..)))))))...))))))...))).)))) celegans GCCAAAAAGTATTCAAACTGATCACTTTTATCGGTTCCGGTCCCTCTGCAAAAAAGTGGACTGGAAGCATTTAAGTGATAGTGTTTGATCAGTTTATGGC cremanei GCCACGACTCATCTGA-CAGATTACTTTTATTGGTTCCCGTCTCTCT---TAAAAATGAACAGGAAGCAATTAAGTGATAGTGTTTGATGAGATCATGGC **** * ** * * *** ******** ****** *** **** **** ** ** ******* ******************* ** * ***** cremanei ((((.((((((((.(( ((.(((((((..((((.((((.((.((......)))).)))).)))).)))))))..)))).)))))).)).)))) celegans chromosome:i: : :1 intron:coding_transcript T22A3.5 I: : :1 ## intron:curated T22A3.5 I: : :1 ## intron:twinscan chri tw I: : :1 ## intron:genefinder T22A3.gc7 I: : :1 ## Transcript:Coding_transcript T22A3.5 I: : :1 ## intron:coding_transcript T22A3.5 I: : :1 ## intron:curated T22A3.5 I: : :1 ## intron:twinscan chri tw I: : :1 ## intron:genefinder T22A3.gc7 I: : :1 ## Transcript:Coding_transcript T22A3.5 I: : :1 ## gene: curated pash-1 I: : :1 ## gene:gene WBGene I: : :1 ## gene:curated pash-1 I: : :1 ## gene:gene WBGene I: : :1 cremanei contig:contig16.20:6561:6656:1 intergenic CEL_131 randfold celegans:0.001 TAGCCAATGTCTTCTCTATCATG #celegans_libfl1_elq5oix01c3boz 23 2/2 AGCCAATGTCTTCTCTATCAT #celegans_libfl1_elq5oix01cbrs7 21 0/1 celegans (((((((...(((((((...((((...(((.(((((.(((.((((((((.((((...)))).)))))))).)))))))).)))...))))...))))))).))))))) celegans GAAAAAATGTACATTTCAATTTTCGAGTAGCCAATGTCTTCTCTATCATGCATTTTACAAATAATGAGTACATGATAGTGAAATATTTGCTTCCTGAATTTCAGAGATGttttttttt ********************************************************************************************************************** celegans chromosome:i: : :-1 intron:history Y37F4.6a:wp142 I: : :-1 ## intron:history Y37F4.6a:wp142 I: : :-1 72