BIK BIM NOXA PUMA MCL-1. p53
|
|
|
- Aubrey Daniels
- 5 years ago
- Views:
Transcription
1 HT116 cells A IK IM NOXA PUMA ML-1 p Procaspase 3 PARP leaved Product hr 48 hr Figure S1. HT116 cell death by different proteasome inhibitors. A.Western blot analysis of IK, IM, NOXA, PUMA, ML-1 and p53 expression at 24 hr after treatment with indicated PIs..Effect of indicated PIs on caspase-3 activation and PARP cleavage. PSI Epoxo Hdm2 LI Ada lactone MOL.Effect of indicated PIs on cell viability. Viability was determined by the MTT method. The data are expressed as mean±sd from three independent experiments.
2 Saos2 H A LoVo IM ML-1 p53 Saos2 H A LoVo hr Procaspase 3 Activated caspase 3 PARP leaved Product hr 48 hr Figure S2. -induced death in different cell lines. A.Western blot analysis of IK, IM, NOXA, PUMA, ML-1 and p53 expression at 24 hr after treatment with in Saos2, H1299, -33A, LoVo cell lines..effect of on caspase-3 activation and PARP cleavage in indicated cell lines. Saos2 H A LoVo.Effect of on viability of indicated cell lines. Viability was determined by the MTT method. The data are expressed as mean ± SD from three independent experiments.
3 Saos2 H1299 IM IM ML-1 ML-1-33A LoVo IM IM ML-1 ML-1 p53 p53 Figure S3. Induction of H3-only proteins and p53 by different proteasome inhibitors in different tumor cell lines. Western blot analysis of IK, IM, NOXA, PUMA, ML-1 and p53 expression at 24 hr after treatment with indicated PIs in Saos2, H1299, -33A, LoVo cell lines.
4 Pull-down: Ub-matrix W: ML-1 p53 NOXA PUMA IM IK 3 Gapdh Mcl-1s Mcl-1l Puma Noxa tv 2 Gapdh Mcl-1s Mcl-1l Puma Noxa im tv 7 im tv 2 Relative Luciferase Activity 2 1 p53-luc pis-k p53-luc pis-k im tv 1 tv 7 im tv 1 ik D HT116 HT116 p53-/- p53 +/+ p53 -/- ik Tp53 Tp Fold of Increase E2F-1 Actin E Relative Luciferase Activity E2F-1 E2F-1 mt E2F-1 E2F-1 mt p53 +/+ p53 -/- Figure S4. Transcriptional and post-transcriptional regulation of H3-only proteins and p53. A. Effect of on the ubiquitination of H3-only proteins and p53. HT116 cells were treated with or for 16 hr and subjected to a pull-down assay using the ubiquitin affinity matrix. The proteins associated with the matrix were detected by Western blot analysis using antibodies against the indicated proteins.. Effect of on IK, IM, ML-1, NOXA, PUMA and p53 mrna levels. A representative experiment is shown in the left panel. Right panel represents values of mrna levels induced by expressed as mean fold increase ±SD relative to vehicle-treated cells; n=3.. Transcriptional activity of p53 in HT116 and p53-/- cells treated with or. The graph represents means of relative transcriptional activity of p53 as determined by the luciferase assay in three independent experiments done in duplicate, bars correspond to SD. D. Western blot analysis of E2F-1 expression in HT116 and p53-/- cells treated with or for 24 hr. E. Transcriptional activity of E2F-1 in HT116 and p53-/- cells treated with or. The graph represents means of relative transcriptional activity of E2F-1 as determined in.
5 HT116, 6 hr HT116, 6 hr HT116 #5, 6 hr ell Diameter, Relative Units #5 Figure S5. Morphologic features of apoptosis induced by in HT116 cell lines. A.Transmission electron microscopic images of (left panel) or -treated HT116 (middle panel) or HT116ax-/-ak #5 (right panel) cells at 6 hr. Note, that exposure to resulted in a distinctly dilated ER. ars = 5 μm..high magnification image of -treated cells shows dilated rough ER delimited by electron-dense ribosomes. ar =.5 μm..analysis of cellular sizes in light microscope images of HT116 and ax-/-ak #5 cell lines at 24 hr after treatment with or. Values for major and minor axes were acquired for 26 individual cells in each of three separate images to calculate an average diameter of cells. Data are means ± SD.
6 2 ax-/ anti-ak # , mm Epoxo, μm D ax-/- cl-2 #35 ax-/- cl-2 #35 L-2 AK ell viability, % 1 5 ax-/- cl-2 # E HT116 ax-/- HT116 ax-/- ak #5 Time, hrs 1 +zvad-fmk 1 +zvad-fmk Time, hrs Time, hrs Figure S6. PIs induced cell death in HT116 cell lines. A. HT116 cell lines were treated with or Epoxo as indicated and at 48 hr after exposure cell death were determined by MTT assay. Data are expressed as mean ± SD from three independent experiments.. Western blot analysis of L-2 expression in HT116ax-/- or HT116ax-/-cl-2 #35 cells. Level of AK shown to demonstrate equal protein loading.. Representative light microscopic (12X) images of HT116ax-/- or HT116ax-/-cl-2 #35 cells at 24 hr after treatment with or. D. -induced death. ell viability was determined by MTT assay and expressed as mean percent ± SD relative to vehicle-treated cell lines. Data are from tree independent experiments. E. Effect of zvad-fmk on -induced death in HT116 cell lines. HT116 cell lines were treated with alone or in combination with 5μM zvad-fmk. ell viability was determined at indicated times after exposure by MTT assay and expressed as mean percent ± SD relative to vehicle-treated cell lines. Data are from three independent experiments.
7 Annexin V-Positive, % E AX,AK DKO +zvad +sa zvad sa +zvad Time, hr aspases 3/7 activity, RLU D 2.E+6 1.E+6 5.E+5.E+ +zvad ytosol +zvad +sa Etoposide AX,AK DKO +sa zvad sa - - Mitochondria +zvad +sa Etoposide AIF yt c OX IV Procaspase 3 6% 3% 27% AX,AK DKO 8% 23% 11% 21% 21% Etoposide +zvad +sa Figure S7. -induced cell death in AX/AK DKO MEFs. A. Viability of and AX,AK DKO MEFs treated with or alone or in combination with zvad-fmk or sa at 48 hr after exposure determined by the MTT assay. Results are expressed as mean+/- SD relative to vehicle-treated cells, n=3.. aspase 3/7 activity in and AX,AK DKO MEFs at 24 hr after treatment with, and zvad-fmk or sa as measured with caspase-glo 3/7 kit (Promega).. Analysis of apoptosis in AX,AK DKO MEFs. ells were treated with, and zvad-fmk. Annexin V-positive cells were analysed by flow cytometry. Data are mean values +/- SD from three independent experiments. D. Western blot analysis of cytochrome c and AIF in cytosolic and mitochondrial fractions of AX,AK DKO MEFs treated as indicated. Markers for cytosolic and mitochondrial fractions are also indicated. E. Effect on ΔΨm. and AX,AK DKO MEFs were treated with, and zvad-fmk or sa and ΔΨm was measured by flow cytometry using Rh123 at 16 hr after treatment.
SUPPLEMENTARY INFORMATION
Figure S1 Induction of non-apoptotic death of SV40-transformed and primary DKO MEFs, and DKO thymocytes. (A-F) STS-induced non-apoptotic death of DKO MEF. (A, B) Reduced viability of DKO MEFs after exposure
Supplementary Figure 1
A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent
Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent activation of caspase-8 and is under the control of inhibitor of apoptosis proteins in melanoma cells Arnim Weber, Zofia Kirejczyk,
Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
Page 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
Supporting Information. Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via
Supporting Information Epigallocatechin-3-gallate (EGCG) promotes autophagy-dependent survival via influencing the balance of mtor-ampk pathways upon endoplasmic reticulum stress Figure S1. EGCG induces
Supporting Information. FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce. apoptosis
1 2 Supporting Information 3 4 5 FADD regulates NF-кB activation and promotes ubiquitination of cflip L to induce apoptosis 6 7 Kishu Ranjan and Chandramani Pathak* 8 9 Department of Cell Biology, School
Samali A Figure S1.
Deegan S, Saveljeva S, Logue SE, Pakos-Zebrucka K, Gupta S, Vandenabeele P, Bertrand MJ,Samali A. (2014) Deficiency in the mitochondrial apoptotic pathway reveals the toxic potential of autophagy under
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
Table S1. New colony formation 7 days after stimulation with doxo and VCR in JURKAT cells
Table S1. New colony formation 7 days after stimulation with and in JURKAT cells drug co + number of colonies 7±14 4±7 48±11 JURKAT cells were stimulated and analyzed as in Table 1. Drug concentrations
BH3-only proteins are tail-anchored in the outer mitochondrial membrane and can initiate
H3-only proteins are tail-anchored in the outer mitochondrial membrane and can initiate the activation o ax Florian Willing 1, rnim Weber 1, Stephanie Pottho, F.-Nora Vögtle, hris Meisinger, Stean. Paschen
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature9814 a A SHARPIN FL B SHARPIN ΔNZF C SHARPIN T38L, F39V b His-SHARPIN FL -1xUb -2xUb -4xUb α-his c Linear 4xUb -SHARPIN FL -SHARPIN TF_LV -SHARPINΔNZF -SHARPIN
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
A. Generation and characterization of Ras-expressing autophagycompetent
Supplemental Material Supplemental Figure Legends Fig. S1 A. Generation and characterization of Ras-expressing autophagycompetent and -deficient cell lines. HA-tagged H-ras V12 was stably expressed in
Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury
Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Swapan K. Ray, PhD Professor, Department of Pathology, Microbiology, and Immunology USC School of Medicine,
Supplementary Figures
Supplementary Figures Figure S1. Validation of kinase regulators of ONC201 sensitivity. Validation and screen results for changes in cell viability associated with the combination of ONC201 treatment (1
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by
Marine Streptomyces sp. derived antimycin analogues suppress HeLa cells via depletion HPV E6/E7 mediated by ROS-dependent ubiquitin proteasome system Weiyi Zhang 1, +, Qian Che 1, 2, +, Hongsheng Tan 1,
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Silibinin i activates p53-caspase-2 pathway and causes caspase-mediated cleavage of Cip1/p21 in apoptosis
Silibinin i activates p53-caspase-2 pathway and causes caspase-mediated cleavage of Cip1/p21 in apoptosis induction in bladder transitional-cell papilloma RT4 cells: Evidence for a regulatory loop between
Procaspase-3. Cleaved caspase-3. actin. Cytochrome C (10 M) Z-VAD-fmk. Procaspase-3. Cleaved caspase-3. actin. Z-VAD-fmk
A HeLa actin - + + - - + Cytochrome C (1 M) Z-VAD-fmk PMN - + + - - + actin Cytochrome C (1 M) Z-VAD-fmk Figure S1. (A) Pan-caspase inhibitor z-vad-fmk inhibits cytochrome c- mediated procaspase-3 cleavage.
http / / cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology COX-2 NTera-2 NTera-2 RT-PCR FasL caspase-8 caspase-3 PARP.
ISSN 1007-7626 CN 11-3870 / Q http / / cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2012 7 28 7 630 ~ 636 NTera-2 ** ** * 410081 COX-2 NTera-2 MTT NTera-2 NTera-2 Hoechest 33258
PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB
SUPPLEMENTARY FIGURES: PID1 increases chemotherapy-induced apoptosis in medulloblastoma and glioblastoma cells in a manner that involves NFκB Jingying Xu, Xiuhai Ren, Anup Singh Pathania, G. Esteban Fernandez,
In vivo prediction of anti-tumor effect of 3- bromopyruvate in Hepatocellular Carcinoma using Tc-99m labeled annexin-v imaging
In vivo prediction of anti-tumor effect of 3- bromopyruvate in Hepatocellular Carcinoma using Tc-99m labeled annexin-v imaging Won Kim, Jung-Hwan Yoon*, Gi Jeong Cheon, Tae Sup Lee, Chung Yong Kim Department
Supplementary Material
Supplementary Material The Androgen Receptor is a negative regulator of eif4e Phosphorylation at S209: Implications for the use of mtor inhibitors in advanced prostate cancer Supplementary Figures Supplemental
supplementary information
DOI: 10.1038/ncb1875 Figure S1 (a) The 79 surgical specimens from NSCLC patients were analysed by immunohistochemistry with an anti-p53 antibody and control serum (data not shown). The normal bronchi served
Downregulation of the c-myc target gene, peroxiredoxin III, contributes to Arsenic Trioxide-induced apoptosis in Acute Promyelocytic Leukemia (APL)
Downregulation of the c-myc target gene, peroxiredoxin III, contributes to Arsenic Trioxide-induced apoptosis in Acute Promyelocytic Leukemia (APL) Pablo E. Vivas-Mejía, Ph.D. Research Scientist, University
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the
Supplementary Figure 1: Digitoxin induces apoptosis in primary human melanoma cells but not in normal melanocytes, which express lower levels of the cardiac glycoside target, ATP1A1. (a) The percentage
Introduction: 年 Fas signal-mediated apoptosis. PI3K/Akt
Fas-ligand (CD95-L; Fas-L) Fas (CD95) Fas (apoptosis) 年 了 不 度 Fas Fas-L 力 不 Fas/Fas-L T IL-10Fas/Fas-L 不 年 Fas signal-mediated apoptosis 度降 不 不 力 U-118, HeLa, A549, Huh-7 MCF-7, HepG2. PI3K/Akt FasPI3K/Akt
Appendix Table of Contents. 1. Appendix Figure legends S1-S13 and Appendix Table S1 and S2. 2. Appendix Figures S1-S13
Appendix Table of Contents. Appendix Figure legends S-S3 and Appendix Table S and S. Appendix Figures S-S3 . Appendix Figure legends S-S3 and Appendix Table S and S Appendix Figure S. Western blot analysis
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Nature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
SUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
Effective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
The effect of elemene reversing the multidurg resistance of A549/DDP lung cancer cells
213 12 33 12 TUMOR Vol. 33, December 213 www.tumorsci.org 161 Basic Research DOI: 1.3781/j.issn.1-7431.213.12. 5 Copyright 213 by TUMOR A549/DDP 1, 2 2 1 3 4 1 1 1. 3619 2. 355 3. 3611 4. 361 elemene cisplatin
Prolonged mitotic arrest induces a caspase-dependent DNA damage
SUPPLEMENTARY INFORMATION Prolonged mitotic arrest induces a caspase-dependent DNA damage response at telomeres that determines cell survival Karolina O. Hain, Didier J. Colin, Shubhra Rastogi, Lindsey
) and myeloid cell leukemia sequence 1 (Mcl-1). PUMA-mediated Bcl-x L
The p53 Upregulated Modulator of Apoptosis (PUMA) Chemosensitizes Intrinsically Resistant Ovarian Cancer Cells to Cisplatin by Lowering the Threshold Set by and Mcl-1 Zhu Yuan, 1,* Kang Cao, 2,* Chao Lin,
SUPPLEMENTARY FIGURES AND TABLE
SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Characterization of IRE1α mutants. A. U87-LUC cells were transduced with the lentiviral vector containing the GFP sequence (U87-LUC Tet-ON GFP).
Differential modulatory effects of GSK-3b and HDM2 on sorafenib-induced AIF nuclear translocation (programmed necrosis) in melanoma
RESEARCH Open Access Differential modulatory effects of GSK-3b and HDM2 on sorafenib-induced AIF nuclear translocation (programmed necrosis) in melanoma Qingjun Liu 1,2, James W Mier 1 and David J Panka
A BAX/BAK and Cyclophilin D-Independent Intrinsic Apoptosis Pathway
A BAX/BAK and Cyclophilin D-Independent Intrinsic Apoptosis Pathway Sebastián Zamorano 1,2, Diego Rojas-Rivera 1,2, Fernanda Lisbona 1,2, Valentina Parra 2,3, Felipe A. Court 4, Rosario Villegas 4, Emily
Supporting Information
Supporting Information Identification of Novel ROS Inducers: Quinone Derivatives Tethered to Long Hydrocarbon Chains Yeonsun Hong,, Sandip Sengupta,, Wooyoung Hur, *, Taebo Sim,, * KU-KIST Graduate School
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11429 S1a 6 7 8 9 Nlrc4 allele S1b Nlrc4 +/+ Nlrc4 +/F Nlrc4 F/F 9 Targeting construct 422 bp 273 bp FRT-neo-gb-PGK-FRT 3x.STOP S1c Nlrc4 +/+ Nlrc4 F/F casp1
CANCER THERAPEUTICS: A NOVEL APPROACH
CANCER THERAPEUTICS: A NOVEL APPROACH Mary Dwyer, Ph.D. HBRI and ChemRegen, Inc. SCDMDG Meeting October 23, 212 Outline Introduction Hit, HBRI1: identification & characterization Leads, HBRI2 & HBRI3:
To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Anti-Apoptotic Effects of Cellular Therapy
Anti-Apoptotic Effects of Cellular Therapy Jason Lapetoda 1, Lee K Landeen, PhD 1, George K Michalopoulos, MD 2, Patricia W Bedard, PhD 1 1 Vital Therapies, Inc., San Diego, CA, USA 2 University of Pittsburgh
Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes
Downregulation of the small GTPase SAR1A: a key event underlying alcohol-induced Golgi fragmentation in hepatocytes Armen Petrosyan 1*, Pi-Wan Cheng 1,3, Dahn L. Clemens 2,3 & Carol A. Casey 2,3 1 Department
perk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
Expanded View Figures
Shao-Ming Shen et al Role of I in MT of cancers MO reports xpanded View igures igure V1. nalysis of the expression of I isoforms in cancer cells and their interaction with PTN. RT PR detection of Ish and
Supplementary Figure S1 Supplementary Figure S2
Supplementary Figure S A) The blots shown in Figure B were qualified by using Gel-Pro analyzer software (Rockville, MD, USA). The ratio of LC3II/LC3I to actin was then calculated. The data are represented
Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.
Supplementary Materials Supplementary Figures Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients. Figure S2. Expression level of podocyte
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were
Supplementary Figure 1. Validation of astrocytes. Primary astrocytes were separated from the glial cultures using a mild trypsinization protocol. Anti-glial fibrillary acidic protein (GFAP) immunofluorescent
Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A.
UvA-DARE (Digital Academic Repository) Acute lung injury in children : from viral infection and mechanical ventilation to inflammation and apoptosis Bern, R.A. Link to publication Citation for published
BCL-W has a fundamental role in B cell survival and lymphomagenesis.
Thomas Jefferson University Jefferson Digital Commons Department of Cancer Biology Faculty Papers Department of Cancer Biology 2-1-2017 BCL-W has a fundamental role in B cell survival and lymphomagenesis.
Control. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer
AD Award Number: TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, PhD CONTRACTING ORGANIZATION: University
Supplementary Figure S1
Supplementary Figure S1 12 1 8 6 4 2 1-3 1-2 1-1 1 1 1 1 2 1 3 PF-364422 (µm) U87 (EC 5 = 52.2 ± 8.8 µm) 12 1 8 6 4 2 1-4 1-3 1-2 1-1 1 1 1 1 2 CMPD1 (µm) Primary GM (EC 5 = 1.55 ±.3 µm) U138 (EC 5 = 1.7
mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL-
Supplementary Material for mtor Inhibition Specifically Sensitizes Colorectal Cancers with KRAS or BRAF Mutations to BCL-2/BCL- XL Inhibition by Suppressing MCL-1 Anthony C. Faber 1,2 *, Erin M. Coffee
Selec%ve killing of cancer cells by a small molecule targe%ng the stress response to ROS
Selec%ve killing of cancer cells by a small molecule targe%ng the stress response to RS L Raj et al. Nature 475, 231-234 (2011) doi:10.1038/nature10167 Current literature Presented by Zhuzhu WANG 9/3/11
Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.
Supplemental Materials: I. Supplemental Methods II. Supplemental Figure Legends III. Supplemental Figures Supplemental Methods Cell Culture and Transfections for Wild Type and JNK1-/-,JNK2-/- MEFs: The
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
Figure 1 A 2.0. Akt308 Akt Ctl 1h 3h 6h 9h 12h. β-cat. GSK3β. pakt308. pgsk3β/edu E-cad/pAkt308. Akt1. Actin.
Figure 1 pβcat552 β-cat pgsk3β GSK3β 110 110 pgsk3β/du -cad/ TL 20 µm 20 µm pkt473 pankt pkt473 pankt (days) 0 1 2 3 4 (h) 0 1 3 6 9 12 pβ-cat552/nuclei ensitometricanalysis (Pixel intensity) F ensitometricanalysis
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
CAN Resubmission SUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION CAN-05-0686 Resubmission Protein Immunoblotting. Primary antibodies used in this study include: Casp-9, Casp-3 and Survivin from Novus Biologicals (Littleton, CO); Casp-8 (Ab-3)
SUPPLEMENTARY INFORMATION
DOI:.38/ncb2822 a MTC02 FAO cells EEA1 b +/+ MEFs /DAPI -/- MEFs /DAPI -/- MEFs //DAPI c HEK 293 cells WCE N M C P AKT TBC1D7 Lamin A/C EEA1 VDAC d HeLa cells WCE N M C P AKT Lamin A/C EEA1 VDAC Figure
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap
Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized
Supporting Information. Non-thermal plasma with 2-deoxy-D-glucose synergistically induces cell death by targeting glycolysis in blood cancer cells
Supporting Information Non-thermal plasma with 2-deoxy-D-glucose synergistically induces cell death by targeting glycolysis in blood cancer cells Neha Kaushik, 1 Su Jae Lee, 2 Tae Gyu Choi 3, Ku Youn Baik,
HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
Irf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20%
Irf7 Fold changes 3 1 Irf1 fold changes 3 1 8h h 8h 8h h 8h p-p6 p-p6 t-p6 p-irf3 β-actin p-irf3 t-irf3 β-actin TKO TKO STKO (E) (F) TKO TKO % of p6 nuclear translocation % % 1% 1% % % p6 TKO % of IRF3
Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Tumor suppressor Spred2 interaction with LC3 promotes autophagosome maturation and induces autophagy-dependent cell death Supplementary
The Biochemistry of apoptosis
The Biochemistry of apoptosis 1 1 The apoptosis is composed of multiple biochemical events 2 2 Biochemical, cellular, and molecular events in Apoptosis 1. Membrane blebbing; phosphatidyl serine exposure
SUPPORTING INFORMATION
SUPPORTING INFORMATION SUPPLEMENTARY FIGURE LEGENDS Fig. S1. Separation of non-dissolved nanoparticles. Tests were conducted on the separation of non-dissolved nanoparticles added in excess to BEGM (A)
Supplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for
Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for 15 min at 37 C and replaced with fresh complete medium.
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chairoungdua et al., http://www.jcb.org/cgi/content/full/jcb.201002049/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Expression of CD9 and CD82 inhibits Wnt/ -catenin
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
Rapid parallel measurements of macroautophagy and mitophagy in
Supplemental Figures Rapid parallel measurements of macroautophagy and mitophagy in mammalian cells using a single fluorescent biosensor Sargsyan A, Cai J, Fandino LB, Labasky ME, Forostyan T, Colosimo
Supporting Information
Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 212. Supporting Information for Adv. Funct. Mater., DOI:.2/adfm.2122233 MnO Nanocrystals: A Platform for Integration of MRI and Genuine
genome edited transient transfection, CMV promoter
Supplementary Figure 1. In the absence of new protein translation, overexpressed caveolin-1-gfp is degraded faster than caveolin-1-gfp expressed from the endogenous caveolin 1 locus % loss of total caveolin-1-gfp
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
supplementary information
DOI: 1.138/ncb1 Control Atg7 / NAC 1 1 1 1 (mm) Control Atg7 / NAC 1 1 1 1 (mm) Lamin B Gstm1 Figure S1 Neither the translocation of into the nucleus nor the induction of antioxidant proteins in autophagydeficient
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
APPLICATION NOTE 1850 Millrace Drive, Suite 3A Eugene, Oregon
APPLICATION NOTE 185 Millrace Drive, Suite 3A Eugene, Oregon 973 In-Cell ELISA (ICE) Assay Platform Monitoring apoptosis in cells: a high-throughput, quantitative cellbased assay. Rev. Introduction: Apoptosis:
I Antonio Cilla Tatay PhD Postdoctoral researcher
ANTICARCINOGENIC EFFECT OF PHYTOSTEROLS AND/OR BETA-CRYPTOXANTHIN IN COLON CANCER CELLS I Antonio Cilla Tatay PhD Postdoctoral researcher E-mail: antonio.cilla@uv.es Nutrition and Food Science Area. Faculty
The Energy Blocker Inside The Power House: Mitochondria. Targeted Delivery Of 3-Bromopyruvate
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2014 Supporting Information for The Energy Blocker Inside The Power House: Mitochondria Targeted
6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells
6. TNF-α regulates oxidative stress, mitochondrial function and autophagy in neuronal cells 6.1 TNF-α induces mitochondrial oxidative stress in SH-SY5Y cells. The dysregulation of mitochondria and oxidative
Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied.
Supplementary Figure 1 P53 is degraded following Chlamydia infection independent of the cell lysis and protein sample preparation procedure applied. (a) Western blotting analysis showing degradation of
Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.