Role of Serum Amyloid A in Adipocyte-Macrophage Cross Talk and Adipocyte Cholesterol Efflux
|
|
- Juniper Grant
- 6 years ago
- Views:
Transcription
1 ORIGINAL Endocrine ARTICLE Research Role of Serum Amyloid A in Adipocyte-Macrophage Cross Talk and Adipocyte Cholesterol Efflux Christine Poitou, Adeline Divoux, Aurélie Faty, Joan Tordjman, Danielle Hugol, Abdelhaim Aissat, Mayoura Keophiphath, Corneliu Henegar, Stéphane Commans, and Karine Clément Institut National de la Santé et de la Recherche Médicale (C.P., A.D., J.T., M.K., C.H., K.C.), U872 team7, Nutriomique, Cordelier Research Center, Paris 756, France; University Pierre et Marie Curie-Paris-6 (C.P., A.D., J.T., M.K., C.H., K.C.), Unité Mixte de Recherche en Santé, Paris 756, France; Assistance Publique-Hôpitaux de Paris, Endocrinology and Nutrition Department (C.P., C.H., K.C.), Pitié Salpêtrière hospital, Paris 7513, France; GlaxoSmithKline Laboratory (A.F., S.C.), Research Centre metabolic Pathways GlaxoSmithKline, Les Ulis, France; and Assistance Publique- Hôpitaux de Paris, Cytopathology (D.H.) and Surgery (A.A.) Departments, Hotel Dieu Hospital Paris F-75, France Context: Acute phase serum amyloid A (A-SAA) is secreted by hepatocytes in response to injury and is regulated by proinflammatory cytokines. In obese humans, adipocytes are also a major contributor to circulating A-SAA levels. Objective: We aimed to investigate the role and regulation of A-SAA in human adipose tissue (AT). Design: An approach combining microarrays and the FunNet bioinformatics tool was applied to human AT fractions (i.e. adipocytes vs. stroma vascular fraction) to hypothesize genes and functions related to A-SAA. Experiments with human AT from 37 obese subjects and human multipotent adipose-derived stem (hmads) cells were used to confirm the microarray driven hypotheses. Results: Microarray analysis highlighted the relationship between A-SAA and stroma vascular fraction inflammatory genes, and between A-SAA and adipocyte-expressed ATP-binding cassette (ABC) transporters. We confirmed that serum amyloid A (SAA) protein is expressed in sc AT of obese subjects (n 37, body mass index kg/m 2 ) and showed that SAA protein expression correlated with adipocyte size (R.; P ), macrophage infiltration (R.61; P 1 ), and ABC subfamily A1 protein expression (R.3; P ). IL-1, TNF-, and human AT macrophage-conditioned medium significantly induced A-SAA secretion (from 2.6 to 7.6 fold) in hmads cells. Recombinant SAA induced cholesterol ABC subfamily A1-dependent efflux from hmads adipocytes by.3-fold in a dose-dependent manner. Conclusion: This work provides original insight suggesting that A-SAA is a player in the dialogue between hypertrophied adipocytes and macrophages through its regulation of adipocyte cholesterol efflux. (J Clin Endocrinol Metab 9: , 29) Serum amyloid A (SAA) proteins comprise a family of small and differentially expressed proteins. Acute-phase SAA (A- SAA) consists of two closely related isoforms, SAA1 and SAA2, inducible in response to pro-inflammatory stimuli (1). Additional members of the SAA family are SAA3 and SAA. SAA3 is a pseudogene in human and SAA is constitutively expressed. During acute inflammation, hepatic production of A-SAA increases 3-1 times. As an acute phase protein, A-SAA classically contributes to the inflammatory process defense to aggression. In vitro experiments have shown that A-SAA induces ISSN Print X ISSN Online Printed in U.S.A. Copyright 29 by The Endocrine Society doi: 1.121/jc.28-2 Received September 16, 28. Accepted February 6, 29. First Published Online February 17, 29 C.P and A.D. contributed equally to this work. Abbreviations: ABC, ATP-binding cassette; ABCA1, ATP-binding cassette subfamily A; AcM, activated monocyte; apoa-i, apolipoprotein A-I; A-SAA, acute phase serum amyloid A; AT, adipose tissue; ATM, adipose tissue macrophage; BMI, body mass index; DEX, dexamethasone; FBS, fetal bovine serum; HDL, high-density lipoprotein; hmads, human multipotent adipose-derived stem; KEGG, Kyoto encyclopedia of genes and genomes; LXR, liver X receptor; MCP-1, monocyte chemoattractant protein-1; owat, omental white adipose tissue; SAA, serum amyloid A; scwat, sc white adipose tissue; SVF, stroma vascular fraction. 181 jcem.endojournals.org J Clin Endocrinol Metab. May 29, 9(5):
2 J Clin Endocrinol Metab, May 29, 9(5): jcem.endojournals.org 1811 chemotaxis of immunological cells (like T cells, monocytes, neutrophils, mastocytes) and cytokine production such as IL-1 and IL-8 (2). The proposed role of A-SAA is that of an apolipoprotein, which could alter the structure and function of inflammatory high-density lipoprotein (HDL) particles to help remove excess cholesterol released from damaged tissues (3). In the context of obesity related low-grade inflammation, the level of circulating A-SAA remains moderately high ( 1 mg/ liter), about 6-fold higher than in patients with normal weight (, 5) or in obese subjects experiencing weight loss (6, 7). Observational studies showed that a chronically elevated level of circulating SAA is a marker of peripheral and coronary arterial disease. Experiments suggest that A-SAA, involved in cholesterol uptake and efflux, could be involved in the development of atherosclerosis (8). Comparing the level of gene expression of A-SAA in human tissues has shown that adipose tissue (AT) is a major site of A-SAA production in obesity (6, 7, 9), in contrast with mice in which expression is predominantly hepatic, and the isoform expressed in AT is SAA3. In humans, A-SAA is secreted by AT at higher levels than leptin. The production of A-SAA by enlarged AT might participate to the growing pool of circulating SAA in obesity (5, 9). Within AT, the A-SAA gene is predominantly expressed and produced by mature adipocytes, and not by cells of the stroma vascular fraction (SVF) (9). Neither the relationship between A-SAA protein and AT parameters (e.g. adipocyte biology, inflammation) nor the regulation and role of human A-SAA has been extensively examined in vivo. In humans, Yang et al. (9) have shown that recombinant SAA promotes an increased basal lipolysis in adipose cells, and stimulates the production of inflammatory cytokines such as ILs 6 and 8 and monocyte chemoattractant protein-1 (MCP-1) from SVF cells. To gain further insight into the potential role and regulation of A-SAA in human AT, we have explored both the relationship between A-SAA and macrophages, and the role of A-SAA in cholesterol efflux from adipocytes. Subjects and Methods Subjects AT samples were obtained from 37 morbidly obese subjects [body mass index (BMI) kg/m 2 ] involved in a gastric surgery program, prospectively recruited in the Department of Nutrition, Center of Reference for Medical and Surgical Care of Obesity, Pitié-Salpêtrière Hospital (Paris, France). Patients were excluded if they had evidence of acute or chronic inflammation or infectious diseases. None of the subjects was taking medication for type 2 diabetes. Subjects were weight stable for 3 months before surgery. Venous blood samples were collected in the fasting state for determination of routine biochemical parameters and evaluation of adiponectin, IL-6, and high-sensitivity C-reactive protein. Clinical and biological parameters are shown in Table 1. Paired sc white adipose tissue (scwat) and omental white adipose tissue (owat) samples were obtained from the same individuals during the surgery. A portion of each sample was fixed in % paraformaldehyde, and the rest was immediately frozen in liquid nitrogen and stored at 8 C for total RNA preparation. The clinical investigation promoted by the Assistance/Publique Hôpitaux de Paris was approved by the Ethics TABLE 1. Clinical and biochemical characteristics of morbidly obese subjects Parameters Values No. of subjects 37 Gender (F/M) 27/1 Age (yr) Weight (kg) BMI (kg/m 2 ) Glucose (mmol/liter) Insulin ( U/ml) Total cholesterol (mmol/liter).6.2 HDL-cholesterol (mmol/liter) Triglycerides (mmol/liter) Adiponectin ( g/ml) IL-6 (pg/ml).7.6 hscrp (mg/dl) Data are indicated as means SEM. F, Female; hscrp, high-sensitivity C-reactive protein; M, male. Committees (Paris, France). Informed consent was obtained from all severely obese subjects. Gene profiling in SVF and isolated adipocytes from scwat To gain insight about the putative role of A-SAA in human AT, we applied the recently published Bioinformatics FunNet tool ( info) (1, 11) to previously generated microarray data (12). Differences in gene expression between isolated adipocytes and SVF cells were examined in scwat in another group of overweight women (n 9, BMI kg/m 2 ). The procedure was described in Ref. 12. We focused our present analysis on the A-SAA transcripts (SAA1 and SAA2), which are part of genes significantly overexpressed in adipocytes (false discovery rate 5%). It is noteworthy that sequence similarity for SAA1 and SAA2 microarray probes was greater than 97%; therefore, we could not distinguish between these two isoforms. The Spearman s rank correlation coefficient was used to identify transcripts whose expression profiles were similar to that of the A-SAA (i.e. statistically coexpressed genes), among those displaying a significant level of differential expression in mature adipocytes or in the SVF. A threshold of gene coexpression significance, corresponding to an absolute value of a Spearman s R.85, was determined by maximizing a scale-free topology criterion as previously described in Ref. 13. Immunomorphological analysis of AT in obese subjects Samples fixed in paraformaldehyde were dehydrated, paraffin embedded, and sectioned (thin sections of 5 m). Sections were stained with hematoxylin and eosin. Immunohistochemical detection of HAM56 (1: 1; DakoCytomation, Trappes, France), SAA (1:5; DakoCytomation), and ATP-binding cassette subfamily A (ABCA1) (1:5; Abcam, Paris, France) was performed with the avidin-biotin peroxidase method (1). Before staining for SAA and ABCA1, nonspecific sites were blocked using an antirabbit IgG (1:3, 1hatroom temperature). HAM56 is a monoclonal antibody selected in alveolar macrophage pool. According to manufacturer s recommendations, HAM56 labels human macrophages and endothelial cells, but not lymphocytes or granulocytes. Adipocytes staining positive for SAA or ABCA1, and cells positive for HAM56 were counted in 1 randomly chosen areas in each processed slide at magnification by two independent researchers. The mean of positive cells was expressed as a percentage of the total number of adipocytes. Adipocyte cell size was determined using Perfect Images 7. software (Avanquest Software S.A., La Garenne Colombes, France). The diameter of adipocytes was measured in two randomly chosen areas
3 1812 Poitou et al. SAA Promotes Cholesterol Efflux in Human Adipocyte J Clin Endocrinol Metab, May 29, 9(5): TABLE 2. Primers used for A-SAA and ABCA1 gene expression detection Genes A-SAA ABCA1 Primers CGAGCATGGAAGTATTTGTCTG/CGGGACATGTGGAGAGCCT CCACGCTGGGATCACTGTA/GCCTGCTAGTGGTCATCCTG (representing 6 adipocytes) in each processed slide at 1 magnification. Adipocyte sizes reported are the mean of the two fields. For the double staining of SAA/HAM56 or SAA/ABCA1 on the same slide, the protocol described previously was applied for each antibody. SAA staining was revealed using diaminobenzidine and blocked by the reagent Linblock (AbCys, Paris, France). HAM56 or ABCA1 staining was then revealed using Histoprime (AbCys). Quantitative real-time PCR We assessed gene expression changes using primers, TaqMan probes, and 18S ribosomal RNA for normalization, obtained from Applied Biosystems (Foster City, CA), as described (15). Because of the very high degree of homology between inducible A-SAA isoforms, designed primers detected both SAA1 and SAA2 mrna. Primer sequences used for A-SAA and ABCA1 detection are shown in Table 2. Preparation of human blood monocyte-derived macrophages and conditioned medium [activated monocyte (AcM)] Blood from female patients was processed for plasma blood mononuclear cell isolation as previously described in Ref. 16. Macrophages were incubated in RPMI 16 1% fetal bovine serum (FBS) for 2 h with 1 ng/ml lipopolysaccharide (from Escherichia coli 127:B8; Sigma-Aldrich Corp., St. Louis, MO) before collecting the medium (AcM). % OF ADIPOCYTES EXPRESSING SAA ADIPOCYTES SIZE (µm) A B scwat scwat owat owat % OF ADIPOCYTES EXPRESSING SAA % OF ADIPOCYTES EXPRESSING SAA C ADIPOCYTE SIZE (µm) scwat owat ADIPOCYTE SIZE (µm) % OF ADIPOCYTES EXPRESSING SAA D Control medium was RPMI 16 1% FBS kept at 37 C for 2 h in the absence of macrophages. Preparation of adipose tissue macrophages (ATMs) and conditioned medium Isolation of ATM from human SVF was performed as described (17). Isolated SVF cells were obtained from scwat biopsies, as described in Ref. 16. The bead-coupled CD1 cells were maintained for 2 h in RPMI 16 1% FBS to obtain ATM conditioned medium, which was kept at 8 C before use. Adipocyte differentiation of hmads cells Adipocyte differentiation of multipotent adipose-derived stem cells isolated from human AT (hmads) was performed as previously described (18) with the following modifications. At post-confluence (designated d ), cells were induced into adipogenic differentiation through DMEM/Ham F12 media supplemented with.86 M insulin,.2 nm T 3, 1 g/ml transferrin, 1 M dexamethasone (DEX), 1 M isobutylmethylxanthine, and 2 nm GW785, a peroxisome proliferator activated receptor- agonist. Three days later the medium was changed to DMEM/Ham F12 media supplemented with.86 M insulin,.2 nm T 3, and 1 g/ml transferrin only. This media were then changed every 2 d, and cells were used from d 1 after induction. Recombinant human IL-1, TNF, and IL-6 were purchased from PeproTech (Rocky Hill, NJ). DEX was from Sigma-Aldrich. hmads adipocytes were treated for 2 h with or without IL-1 (2 ng/ml), TNF (2 ng/ml), IL-6 (2 ng/ml), and DEX (1 nm), or a combination of these hormones. hmads cells were also treated with control medium, AcM, or ATM medium. After 2 h, culture medium was recovered, and A-SAA was assayed. <6 > 9 ADIPOCYTE SIZE (µm) FIG. 1. SAA protein expression in obese scwat and owat: relationship with adipocyte size. A, Percentage of adipocytes expressing SAA protein in scwat and owat. The value refers to the number of adipocytes that stained positive for SAA per 1 adipocytes. Mean SEM is shown., P (n 37 morbidly obese subjects). B, Mean diameter of adipocytes in scwat and owat. Mean for adipocyte diameter for all 37 subjects SEM is shown, in which the mean adipocyte diameter for each subject was determined by measuring 6 adipocytes., P 1 3 (n 37 obese subjects). C, Correlation between the percentage of adipocytes expressing SAA and mean adipocyte diameter in scwat and owat. Adipocytes expressing SAA were labeled by immunohistochemistry and quantified in 37 obese subjects. Simultaneously, mean adipocyte diameter was calculated in two random fields ( 1) for each patient. R. and P in scwat; and R.9 and P in owat. D, Percentage of adipocytes expressing SAA protein according to adipocyte size. In a 1 field, adipocytes are ranked according to the diameter range, i.e. adipocyte diameter less than 6 m(white), between 6 and 9 m(gray), and more than 9 m(black). Once adipocytes were sorted by diameter, SAA-positive adipocytes were counted. Data are the mean of values obtained in the scwat of three independent obese subjects. A-SAA quantification in culture media Human A-SAA (BioSource, Camarillo, CA) was measured with ELISA kits according to the manufacturer s instructions. Cholesterol efflux Human apolipoprotein A-I (apoa-i) and HDL-cholesterol were purchased from Calbiochem (San Diego, CA). Recombinant human SAA (corresponding to human SAA1 ) was from PeproTech. The cholesterol efflux assay was performed as previously described (19). Cholesterol loading of hmads adipocytes was performed with [ 3 H]cholesterol-labeled low-density lipoprotein ( 3 Ci/ml; 5 g/ml) for 2 h. Cholesterol efflux was induced to various acceptors after a 2-h incubation of the cells with or without the liver X receptor (LXR) agonists GW3965 (1 M), and a 2-h incubation with or without Probucol (1 M) (Sigma-Aldrich). After 6 h, media were collected, and radioactivity was measured by liquid scintillation counting. Cholesterol efflux was calculated as the percentage of total [ 3 H]cholesterol released into the medium after subtraction of values obtained in the absence of cholesterol acceptor.
4 J Clin Endocrinol Metab, May 29, 9(5): jcem.endojournals.org 1813 Statistical analyses Data are expressed as means SEM. General statistical analysis was performed with JMP statistics software (SAS Institute Inc., Cary, NC). Correlations were examined by the nonparametric Spearman s rank correlation test. A P value less than.5 was considered statistically significant. A Wilcoxon nonparametric test was used to compare mean values for data concerning A-SAA secretion and cholesterol efflux in hmads. Results Relationship between SAA protein and adipocyte size in human AT depots We previously showed that A-SAA gene expression was higher in scwat than owat. We examined if this is also the case for SAA protein expression using paired fat depots from 37 obese subjects. In agreement with gene expression findings, immunohistochemistry revealed that the percentage of SAA-positive adipocytes was higher in scwat than owat ( vs %; P ) (Fig. 1A). Because hypertrophy may affect AT SAA expression, we assessed the relationship between adipose cell diameter and percentage of adipocytes expressing SAA in both owat and scwat. For the 37 obese subjects, adipocyte size was normally distributed in both depots. As expected, the mean adipocyte cell diameter in scwat was significantly higher than in owat ( vs m) (Fig. 1B). We observed a significant positive correlation between adipocyte cell diameter and the percentage of adipocytes expressing SAA proteins in both WAT depots (R., P in scwat; R.9, P in owat) (Fig. 1C). More specifically, in scwat the percentage of adipocytes expressing SAA was estimated at 2.% for adipocytes whose size was less than 6 m and 9.% for hypertrophic adipocytes ( 9 m) (Fig. 1D). Results did not change when separating our cohort in females (n 27) and males (n 1). The percentage of SAA-positive fat cells was not related to clinical metabolic data such as fasting glycemia, insulinemia, HDL-cholesterol, and total cholesterol (data not shown). Functional profiles of transcripts coexpressed with A-SAA expression in scwat To gain insight into the role of A-SAA within scwat, we examined the relationships between A-SAA gene expression and groups of genes and functions characterizing the isolated adipocyte and SVF. Using previously published microarray gene expression data in which nine independent female subjects were studied (1), we found that A-SAA was present among the 6587 genes overexpressed in isolated adipocytes compared with the SVF (13. fold). A total of 127 genes belonging to the adipocyte fraction correlated with the A-SAA expression profile (R.85), and 92 genes overexpressed in the SVF correlated with A-SAA gene expression. In this latter gene list, 26 among the 27 genes were independently described to characterize the transcriptomic signature of macrophages by Svensson et al. (2) (supplemental Table, which is published as supplemental data on The Endocrine Society s Journals Online web site at endo.endojournals.org). Figure 2A shows the most significant Kyoto encyclopedia of genes and genomes (KEGG) themes A Up-regulated Transcripts Retinol metabolism 1.3% Ether lipid metabolism 28.6% Olfactory transduction 28.6% ABC transporters - General 28.6% B Autoimmune thyroid disease Cell adhesion molecules (CAMs) Antigen processing and presentation Retinol metabolism ECM receptor interaction ABC transporters General Allograft rejection Type I diabetes mellitus KEGG Down-regulated Transcripts Allograft rejection Autoimmune thyroid disease Type I diabetes mellitus Antigen processing and presentation ECM-receptor interaction Transcriptional domain coverage (%) Cell adhesion molecules (CAMs) 23.5% Leukocyte transendothelial migration 23.5% Cytokine-cytokine receptor interaction 1.2% Cytokine cytokine receptor interaction Ether lipid metabolism Olfactory transduction Leukocyte transendothelial migration FIG. 2. The functional profile (KEGG) of the genes coexpressed with A-SAA and the map of transcriptional interactions relating significantly overrepresented KEGG themes. A, KEGG categories showing a significant enrichment in functions for genes coexpressed with A-SAA. The bar plot represents the percentage of genes differentially expressed and functionally annotated in isolated adipocytes or the SVF and coexpressed with A-SAA. B, These categories were then related to construct a biological interaction map after quantifying their proximity based on the similarity in expression profiles for the annotated genes. Continuous lines indicate the strongest interactions (i.e. superior to the upper quartile of their distribution), whereas dashed lines depict medium-strength interactions (i.e. superior to the median of the distribution but inferior to its upper quartile). The size of the nodes illustrating various KEGG themes is proportional to their interaction centrality in the transcriptional network using genes coexpressed with A-SAA. This figure shows that ABC transporter-general is a central theme that has an important position within the network (as illustrated by the size of the node). ECM, Extracellular matrix. among annotated genes, ranked by their functional coverage of the transcriptional domain. The most significant functions characterizing the genes overexpressed within the SVF and highly correlated with A-SAA were related to inflammatory and immune processes (cytokine-cytokine receptor interaction, leukocyte transendothelial migration, and antigen processing and presentation). The enriched functions characterizing genes of the adipocyte fraction that correlated with A-SAA expression included ATP-binding cassette (ABC) transporters, olfactory transduction, ether lipid metabolism, and retinol metabolism (Fig. 2A), in which ABC transporter function was the most enriched functional theme. Furthermore, ABC transporter function
5 181 Poitou et al. SAA Promotes Cholesterol Efflux in Human Adipocyte J Clin Endocrinol Metab, May 29, 9(5): FIG. 3. Regulation of A-SAA by inflammatory factors: relationship with human AT macrophages. A, Percentage of macrophages (i.e. HAM56 positive cells) in both AT depots. Macrophages were labeled by immunohistochemistry and counted in 37 obese subjects. The mean for the 37 subjects SEM is indicated. This value is expressed as the number of cells stained positive for HAM56 per 1 adipocytes., P 1. B, Proximity of macrophages and adipocytes expressing SAA in WAT. We show immunohistochemistry performed in the scwat of a single obese female (BMI 6.8 kg/m 2 ). The image is representative of what is observed in the 36 other obese subjects. SAA-positive cells are indicated in brown, HAM56-positive cells are shown in green, and cell nuclei are in blue. The asterisk indicates SAApositive adipocytes, and arrows indicate macrophages. C, Correlation between the percentage of SAApositive adipocytes and the percentage of HAM56-positive cells in scwat and owat. Serial fat tissue sections from 37 obese subjects were stained for SAA and HAM56. Values are expressed as the number of cells stained positive for either antibody per 1 adipocytes. R.61, P 1.1 in scwat; and R.6, P.1 3 in owat. D, A-SAA stimulation by inflammatory factors in hmads cells. The recombinant cytokines IL1- and TNF- and macrophage-conditioned media were examined for the influence on A-SAA secretion in differentiated hmads. These experiments were performed in the presence of DEX (1 nm). Values represent the average of quadruplicate determinations (mean SEM). Similar results were obtained in two independent experiments., P.2 vs. controls. C refers to controls, and AcM refers to activated blood monocytes. was also found to occupy a central position in the functional network generated using genes that coexpress with A-SAA in adipocyte fraction (Fig. 2B). Using this functional approach in AT fractions, we generated hypotheses regarding the relationships between A-SAA and inflammatory pathways, especially with monocyte/macrophage functions, and the putative association between A-SAA and cholesterol transport. A-SAA and inflammatory factors in human adipose cells Because of the aforementioned statistical association between A-SAA gene expression and inflammatory related functions in the SVF of AT, we first examined the links between inflammatory characteristics of WAT and SAA in tissues from our obese cohort (n 37). In agreement with our previous observation, we observed in this new group of subjects that the number of infiltrated macrophages (i.e. percentage of HAM56 positive cells) was significantly higher in owat than scwat ( vs %; P.5) (Fig. 3A). In addition to the close proximity between adipocytes expressing SAA and adipocytes with macrophage crown-like structures observed by immunohistochemistry (Fig. 3B), we observed that the percentage of SAA-positive cells significantly correlated with the percentage of macrophages in both obese scwat (R.61; P 1 ) and owat (R.6; P.1 3 ) (Fig. 3C). To explore the possibility of a biological link between human adipocytes expressing SAA and macrophages, we evaluated whether the production of SAA in WAT was subject to regulation by pro-inflammatory mediators known to be produced by macrophages. We used hmads adipocytes to test the induction of A-SAA secretion by pro-inflammatory factors and their different combinations. Treating hmads cells with IL-1, TNF, or a combination of the two significantly induced A-SAA secretion by.6-, 2.6-, and 7.6-fold, respectively (Fig. 3D). Contrary to the in vitro published studies performed in hepatic cells, IL-6 did not have a synergistic effect with IL1- and/or TNF- on A-SAA secretion (data not shown). No significant effect was observed with undifferentiated hmads (data not shown). Next, we found that ATM medium and AcM significantly induced hmads A-SAA secretion 3.6- to 5.8-fold (Fig. 3D). Altogether these observations suggest that the inflammatory environment provoked by macrophage secretions markedly increased the production of A-SAA by differentiated human adipocytes. Role of SAA1 in cholesterol efflux A-SAA is known to increase cholesterol efflux, both dependently and independently of ABCA1, in different cell types such as macrophages and hepatocytes; however, no data exist in adipocytes. First, to confirm the potential association between A-SAA and ABCA1 identified by the microarray data, we explored A-SAA and ABCA1 gene and protein expression. In a subject s subgroup, we observed by quantitative real-time PCR that ABCA1 mrna expression was significantly associated with A-SAA mrna expression (R.7; P 3.1 ;n 16), thus confirming the microarray observations. Using immunohistochemistry we found that ABCA1 protein was present in adipocytes of obese scwat (Fig. A). Some adipocytes tested completely negative for ABCA1, whereas others were strongly positive. A positive correlation was found between the percentage of adipocytes expressing ABCA1 and the percentage of adipocytes expressing SAA (R.3; P ). To illustrate this correlation, we performed a double-immunohistochemical staining for SAA and ABCA1 on the same slide. We showed that the same adipocytes express SAA and ABCA1 (Fig. B). We also observed that macrophages located around adipocytes in crown-like structures were also strongly positive for ABCA1. Second, we assessed the effect of recombinant SAA1 on ABCA1-mediated cholesterol efflux from hmads cells (Fig. 5A). Recombinant SAA1 increased cholesterol efflux by.3-fold in differentiated hmads compared with apoa-i, whereas no
6 J Clin Endocrinol Metab, May 29, 9(5): jcem.endojournals.org 1815 FIG.. Immunohistochemical detection of ABCA1 protein in scwat. A, Presence of ABCA1 in the adipocyte membrane. Cells expressing ABCA1 were labeled by immunohistochemistry in scwat from an obese female (BMI 9.6 kg/m 2 ). The asterisk indicates ABCA1-positive staining in adipocytes. The arrow indicates positive staining of macrophages. B, Colocalization of ABCA1 and A- SAA in adipocytes. scwat from an obese female (BMI 7.1 kg/m 2 ) was stained for SAA and ABCA1. SAA-positive cells are identified by the brown color, ABCA1-positive cells by the green color, and cell nuclei by the blue color. This picture is representative of the other 36 obese subjects. Black arrows indicate ABCA1 staining; brown arrow indicates SAA staining. effect was found in undifferentiated hmads. This effect in differentiated hmads was dose dependent and present even at low doses of SAA1 (1 g/ml) (Fig. 5B). Cholesterol efflux is increased when using the LXR-specific agonist GW3965, a known inducer of ABCA1 expression (Fig. 5A). Probucol, a well-known inhibitor of ABCA1 efflux, decreased markedly the cholesterol efflux (Fig. 5C). These results confirm the specific contribution of ABCA1 in SAA1-mediated cholesterol efflux in human adipocytes. Discussion Human obesity associates with profound morphological and biological changes in AT. The cellular modifications include increased adipocyte cell size (i.e. hypertrophia) (21) and accumulation of inflammatory cells (i.e. macrophages, lymphocytes), whose role remain to be established (22). The cross talk between adipocytes and cellular components of the SVF has modified their respective functions (16, 23, 2). The present study provides novel insight suggesting that A-SAA might be a player in this paracrine dialogue. In agreement with our previous gene expression findings (5), we showed in vivo that SAA protein is strongly related to adipocyte hypertrophy, particularly that SAA is more abundant in scwat, which is significantly more hypertrophic than owat (25). Jernas et al. (26) also showed that A-SAA gene expression is 18.7 times higher in large adipocytes ( 9 m) vs. small adipocytes ( 6 m). Adipocyte hypertrophia associates with metabolic changes (i.e. increased lipolysis, insulino-resistance) and is a condition favoring the secretion of adipokines such as IL-6, IL-8 and MCP-1 (27). In contrast to these proinflammatory factors, synthesized in abundance by cells of the SVF during obesity, SAA is predominantly produced by large adipocytes, thereby suggesting a specific role. Using a hypothesis-generating approach combining microarrays and bioinformatics analysis, we found that A-SAA adipocyte gene expression was coexpressed with SVF genes that are related to inflammatory processes associated with macrophages and adipocyte genes related to cholesterol metabolism, suggesting an association between A-SAA, AT inflammation, and adipocyte cholesterol metabolism. To confirm first the relationship between A-SAA and the inflammatory environment in human AT, we performed a series of tissue and culture experiments using hmads cells (18). In vivo, SAA staining highly correlated with macrophage infiltration in both WAT depots in obese subjects, suggesting a link between SAA production and the presence of AT macrophages. In addition, we showed an induction of human adipocyte A-SAA by culture media obtained from macrophages derived from AcMs or ATM. A cocktail containing the pro-inflammatory molecules TNF- and IL-1 led to an increase in SAA protein expression. Interestingly, this in vitro induction is obtained only in the presence of a glucocorticoid. Thorn et al. (28) have studied A-SAA regulation in HepG2 hepatoma and KB epithelial cell lines, and showed that both SAA1 and SAA2 genes were induced by TNF- and IL-6, where TNF- induction of SAA1, but not SAA2, was enhanced by glucocorticoids in both cell lines. In THP-1 cells, A-SAA secretion was induced with IL-1 in the presence of DEX (29). For the first time, we demonstrate in human adipocytes that, in the presence of a glucocorticoid, A-SAA is regulated by TNF- and IL-1 synergistically, molecules predominantly secreted by nonfat cells (3). IL-6, one of the molecules most secreted by nonfat cells in AT (3) and described to induce A-SAA production by hepatic cell lines (31), has no effect in this model. However, its role in vivo cannot be excluded. Our observations suggest a biological link between human adipocytes expressing A-SAA and macrophages, strengthening recent results obtained in vitro with recombinant SAA1 (9). Yang et al. (9) demonstrated that A-SAA has a pro-inflammatory role. More specifically, the addition of A-SAA protein in media together with cells of the SVF significantly increased the release of IL-6, IL-8, and MCP-1, a chemokine involved in macrophage recruitment, from adipocytes (9). These results agree with our suggestion that A-SAA has a role in the adipocyte-macrophage dialogue. Whether adipocyte hypertrophy is a primary event promoting the increased synthesis of A-SAA, and then macrophages recruitment, or the increased secretion of A-SAA by large adipocytes results from the stimulation of pro-inflammatory mediators produced by macrophages is currently unknown. Under such circumstances, what could be the role of A-SAA in the adipocyte-macrophage dialogue? Our experiments aimed to address primarily the relationship between A-SAA and adipocyte-expressed genes. Within the adipocyte itself, A-SAA was coexpressed with genes coding for proteins involved in metabolism, particularly ABC transporters. Circulating A-SAA is an apolipoprotein component of HDL and was previously shown to
7 1816 Poitou et al. SAA Promotes Cholesterol Efflux in Human Adipocyte J Clin Endocrinol Metab, May 29, 9(5): A SPECIFIC CHOLESTEROL EFFLUX (%) B SPECIFIC CHOLESTEROL EFFLUX (%) C SPECIFIC CHOLESTEROL EFFLUX (%) SAA ( g/ml) + ApoAI + SAA (5 g/ml) FIG. 5. Cholesterol efflux to SAA1 in hmads cells. hmads cells were labeled with.2 Ci/ml [ 3 H]cholesterol for 2 h, equilibrated in media in the absence of cholesterol for 2 h, and then incubated with either recombinant SAA1 (1 g/ml), apoa-i (25 g/ml), or human HDL at 37C for 2 h, and cholesterol efflux was measured. Values represent the average of triplicate experiments (mean SD). A, Recombinant SAA1 increases ABCA1-mediated cholesterol efflux in hmads. ABCA1 expression was stimulated by the LXR agonist (GW3965). Gray bars represent undifferentiated hmads, and black bars represent differentiated hmads., Statistical significance (P ) was observed when comparing SAA1 vs. apoa-i and SAA1 plus GW3965 vs. apoa-i plus GW3965. B, The effect of SAA1 on cholesterol efflux is dose dependent. Squares and triangles reflect SAA effect alone and with GW3965, respectively. C, Effect of an ABCA1 specific inhibitor (Probucol) on cholesterol efflux. White bars represent untreated hmads, gray bars represent hmads pretreated with GW3965, black diagonal bars represent untreated hmads plus Probucol, and gray diagonal bars represent hmads plus GW3965 plus Probucol., P have a role in ABCA1-dependent cholesterol efflux (3). In our study, ABCA1 protein is expressed in human scwat, and SAA expression correlated with ABCA1. We subsequently confirmed that recombinant SAA1 protein affects ABCA1-mediated cholesterol efflux in human adipocytes. This effect was also observed when using lower amounts of SAA1 (1 g/ml), which is more physiologically relevant in obesity. The contribution of other cholesterol transport mechanisms (e.g. the scavenger receptor class B type 1) cannot be excluded; however, no correlative association between A-SAA and such receptors was observed in our microarray data set. Similarly to cleaning mechanisms during acute inflammation, A-SAA could be a mediator of cholesterol transfer and capture by the macrophages in large necrotic adipocytes. In this regard, it has been observed that hypertrophic adipocytes enable the aggregation of macrophages on their surface, and that the vast majority ( 9%) of macrophages in obese mice and humans are found around dying adipocytes (32). Thus, macrophages may engulf adipocyte lipid remnants that could include cholesterol molecules. As such, it will be interesting to establish coculture models of macrophages and hmads cells to investigate cholesterol transfer between them. In summary, our findings suggest that A-SAA has, among others, a localized action in the WAT of obese subjects. In vivo SAA production is associated with macrophage infiltration and with production of the adipocyte ABCA1 transporter. In hmads, A-SAA is regulated by IL1- and TNF-, and by ATM medium and SAA1 is able to induce ABCA1-dependent cholesterol efflux. One limitation of this study is that we did not analyze the involvement of A-SAA on cholesterol efflux in mature adipocytes derived from human WAT, but the fragility of mature human adipocytes in culture and the duration of cholesterol efflux experiments make such studies difficult. Nevertheless, the relationships highlighted in the present work suggest that A-SAA is a mediator of cholesterol efflux in human AT and, therefore, an important player in the cross talk between hypertrophic adipocytes and macrophages. Acknowledgments We thank Florence Marchelli and Christine Baudoin, who contributed to the clinical database constitution at the Centre de Recherche en Nutrition Humaine-Ile de France, and Dr. David Mutch for critical suggestions and editing modifications. Address all correspondence and requests for reprints to: Christine Poitou, M.D., Ph.D., Institut National de la Santé et de la Recherche Médicale Nutriomique U872 (Eq 7), University Pierre et Marie Curie- Paris6, Cordelier Research Center, 15 rue de l école de médecine, 756 Paris, France. christine.poitou-bernert@psl.aphp.fr. This work was supported by Institut National de la Santé etdela Recherche Médicale, Paris6 University, the Assistance/Publique des Hôpitaux de Paris (P5318), and a grant from the European Community seven th framework program: Adipokines as Drug to combat Adverse effects of excess Adipose Tissue project (grant agreement No. 211). Disclosure Summary: The authors have nothing to disclose. References 1. Urieli-Shoval S, Linke RP, Matzner Y 2 Expression and function of serum amyloid A, a major acute-phase protein, in normal and disease states. Curr Opin Hematol 7: Uhlar CM, Whitehead AS 1999 Serum amyloid A, the major vertebrate acutephase reactant. Eur J Biochem 265: van der Westhuyzen DR, de Beer FC, Webb NR 27 HDL cholesterol transport during inflammation. Curr Opin Lipidol 18:17 151
8 J Clin Endocrinol Metab, May 29, 9(5): jcem.endojournals.org van Dielen FM, van t Veer C, Schols AM, Soeters PB, Buurman WA, Greve JW 21 Increased leptin concentrations correlate with increased concentrations of inflammatory markers in morbidly obese individuals. Int J Obes Relat Metab Disord 25: Poitou C, Coussieu C, Rouault C, Coupaye M, Cancello R, Bedel JF, Gouillon M, Bouillot JL, Oppert JM, Basdevant A, Clement K 26 Serum amyloid A: a marker of adiposity-induced low-grade inflammation but not of metabolic status. Obesity (Silver Spring) 1: Poitou C, Viguerie N, Cancello R, De Matteis R, Cinti S, Stich V, Coussieu C, Gauthier E, Courtine M, Zucker JD, Barsh GS, Saris W, Bruneval P, Basdevant A, Langin D, Clement K 25 Serum amyloid A: production by human white adipocyte and regulation by obesity and nutrition. Diabetologia 8: Sjoholm K, Palming J, Olofsson LE, Gummesson A, Svensson PA, Lystig TC, Jennische E, Brandberg J, Torgerson JS, Carlsson B, Carlsson LM 25 A microarray search for genes predominantly expressed in human omental adipocytes: adipose tissue as a major production site of serum amyloid A. J Clin Endocrinol Metab 9: O Brien KD, Chait A 26 Serum amyloid A: the other inflammatory protein. Curr Atheroscler Rep 8: Yang RZ, Lee MJ, Hu H, Pollin TI, Ryan AS, Nicklas BJ, Snitker S, Horenstein RB, Hull K, Goldberg NH, Goldberg AP, Shuldiner AR, Fried SK, Gong DW 26 Acute-phase serum amyloid A: an inflammatory adipokine and potential link between obesity and its metabolic complications. PLoS Med 3:e Henegar C, Tordjman J, Achard V, Lacasa D, Cremer I, Guerre-Millo M, Poitou C, Basdevant A, Stich V, Viguerie N, Langin D, Bedossa P, Zucker JD, Clement K 28 Adipose tissue transcriptomic signature highlights the pathological relevance of extracellular matrix in human obesity. Genome Biol 9:R1 11. Prifti E, Zucker JD, Clement K, Henegar C 28 FunNet: an integrative tool for exploring transcriptional interactions. Bioinformatics 2: Cancello R, Henegar C, Viguerie N, Taleb S, Poitou C, Rouault C, Coupaye M, Pelloux V, Hugol D, Bouillot JL, Bouloumie A, Barbatelli G, Cinti S, Svensson PA, Barsh GS, Zucker JD, Basdevant A, Langin D, Clement K 25 Reduction of macrophage infiltration and chemoattractant gene expression changes in white adipose tissue of morbidly obese subjects after surgery-induced weight loss. Diabetes 5: Zhang B, Horvath S 25 A general framework for weighted gene co-expression network analysis. Stat Appl Genet Mol Biol :Article17 1. Hsu SM, Raine L, Fanger H 1981 Use of avidin-biotin-peroxidase complex (ABC) in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody (PAP) procedures. J Histochem Cytochem 29: Clement K, Viguerie N, Diehn M, Alizadeh A, Barbe P, Thalamas C, Storey JD, Brown PO, Barsh GS, Langin D 22 In vivo regulation of human skeletal muscle gene expression by thyroid hormone. Genome Res 12: Lacasa D, Taleb S, Keophiphath M, Miranville A, Clement K 27 Macrophage-secreted factors impair human adipogenesis: involvement of proinflammatory state in preadipocytes. Endocrinology 18: Curat CA, Miranville A, Sengenes C, Diehl M, Tonus C, Busse R, Bouloumie A 2 From blood monocytes to adipose tissue-resident macrophages: induction of diapedesis by human mature adipocytes. Diabetes 53: Rodriguez AM, Elabd C, Amri EZ, Ailhaud G, Dani C 25 The human adipose tissue is a source of multipotent stem cells. Biochimie 87: Verghese PB, Arrese EL, Soulages JL 27 Stimulation of lipolysis enhances the rate of cholesterol efflux to HDL in adipocytes. Mol Cell Biochem 32: Svensson PA, Hagg DA, Jernas M, Englund MC, Hulten LM, Ohlsson BG, Hulthe J, Wiklund O, Carlsson B, Fagerberg B, Carlsson LM 2 Identification of genes predominantly expressed in human macrophages. Atherosclerosis 177: Spalding KL, Arner E, Westermark PO, Bernard S, Buchholz BA, Bergmann O, Blomqvist L, Hoffstedt J, Naslund E, Britton T, Concha H, Hassan M, Ryden M, Frisen J, Arner P 28 Dynamics of fat cell turnover in humans. Nature 53: Bouloumie A, Casteilla L, Lafontan M 28 Adipose tissue lymphocytes and macrophages in obesity and insulin resistance: makers or markers, and which comes first? Arterioscler Thromb Vasc Biol 28: Suganami T, Nishida J, Ogawa Y 25 A paracrine loop between adipocytes and macrophages aggravates inflammatory changes: role of free fatty acids and tumor necrosis factor. Arterioscler Thromb Vasc Biol 25: Permana PA, Menge C, Reaven PD 26 Macrophage-secreted factors induce adipocyte inflammation and insulin resistance. Biochem Biophys Res Commun 31: Cancello R, Tordjman J, Poitou C, Guilhem G, Bouillot JL, Hugol D, Coussieu C, Basdevant A, Hen AB, Bedossa P, Guerre-Millo M, Clement K 26 Increased infiltration of macrophages in omental adipose tissue is associated with marked hepatic lesions in morbid human obesity. Diabetes 55: Jernas M, Palming J, Sjoholm K, Jennische E, Svensson PA, Gabrielsson BG, Levin M, Sjogren A, Rudemo M, Lystig TC, Carlsson B, Carlsson LM, Lonn M 26 Separation of human adipocytes by size: hypertrophic fat cells display distinct gene expression. FASEB J 2: Skurk T, Alberti-Huber C, Herder C, Hauner H 27 Relationship between adipocyte size and adipokine expression and secretion. J Clin Endocrinol Metab 92: Thorn CF, Lu ZY, Whitehead AS 2 Regulation of the human acute phase serum amyloid A genes by tumour necrosis factor-, interleukin-6 and glucocorticoids in hepatic and epithelial cell lines. Scand J Immunol 59: Yamada T, Wada A, Itoh K, Igari J 2 Serum amyloid A secretion from monocytic leukaemia cell line THP-1 and cultured human peripheral monocytes. Scand J Immunol 52: Fain JN, Madan AK, Hiler ML, Cheema P, Bahouth SW 2 Comparison of the release of adipokines by adipose tissue, adipose tissue matrix, and adipocytes from visceral and subcutaneous abdominal adipose tissues of obese humans. Endocrinology 15: Jensen LE, Whitehead AS 1998 Regulation of serum amyloid A protein expression during the acute-phase response. Biochem J 33(Pt 3): Cinti S, Mitchell G, Barbatelli G, Murano I, Ceresi E, Faloia E, Wang S, Fortier M, Greenberg AS, Obin MS 25 Adipocyte death defines macrophage localization and function in adipose tissue of obese mice and humans. J Lipid Res 6:
DISCLOSURE STATEMENT: the authors have nothing to disclose Clinical Trials ID NCT
J Clin Endocrin Metab. First published ahead of print February 17, 2009 as doi:10.1210/jc.2008-2040 Role of adipocyte serum amyloid A in paracrine cross-talk between adipocytes and macrophages in cholesterol
More informationThe FunCluster Package
The FunCluster Package October 23, 2007 Version 1.07 Date 2007-10-23 Title Functional Profiling of Microarray Expression Data Author Corneliu Henegar Maintainer Corneliu Henegar
More informationObesity is a major health care concern because
Original Article Diet-Induced Increases in Adiposity, but Not Plasma Lipids, Promote Macrophage Infiltration Into White Adipose Tissue Kimberly R. Coenen, 1 Marnie L. Gruen, 1 Alan Chait, 2 and Alyssa
More informationFibrosis in human adipose tissue: composition, distribution and link with lipid metabolism and fat mass loss.
Diabetes Publish Ahead of Print, published online August 16, 2010 Fibrosis in human adipose tissue: composition, distribution and link with lipid metabolism and fat mass loss. Adeline Divoux* (1), Joan
More informationOBESITY RESULTS FROM the expansion of white adipose
0013-7227/07/$15.00/0 Endocrinology 148(2):868 877 Printed in U.S.A. Copyright 2007 by The Endocrine Society doi: 10.1210/en.2006-0687 Macrophage-Secreted Factors Impair Human Adipogenesis: Involvement
More informationLeptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice
Leptin deficiency suppresses progression of atherosclerosis in apoe-deficient mice Atherosclerosis, 2007 Chiba T, Shinozaki S, Nakazawa T, et al. Present by Sudaporn Pummoung Apolipoprotein E (apoe( apoe)
More informationRegulation of inflammation-related genes in human adipose tissue
Symposium doi: 10.1111/j.1365-2796.2007.01851.x Regulation of inflammation-related genes in human adipose tissue K. Clement 1,2,3 & D. Langin 4,5,6,7 From the 1 Inserm, U872 Nutriomique, Paris; 2 Faculty
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationChronic systemic inflammation, evidenced as modest
Dietary Cholesterol Worsens Adipose Tissue Macrophage Accumulation and Atherosclerosis in Obese LDL Receptor Deficient Mice Savitha Subramanian, Chang Yeop Han, Tsuyoshi Chiba, Timothy S. McMillen, Shari
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationAdipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
More informationpatient-oriented and epidemiological research
patient-oriented and epidemiological research Adipocyte triglyceride turnover and lipolysis in lean and overweight subjects Mikael Rydén, * Daniel P. Andersson, * Samuel Bernard, Kirsty Spalding, and Peter
More informationab Adipogenesis Assay Kit (Cell-Based)
ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended
More informationADIPOCYTE TURNOVER: RELEVANCE TO HUMAN ADIPOSE TISSUE MORPHOLOGY
Diabetes Publish Ahead of Print, published online October 21, 29 ADIPOCYTE TURNOVER: RELEVANCE TO HUMAN ADIPOSE TISSUE MORPHOLOGY Running head: Erik Arner 1, Pål O Westermark 2, Kirsty L Spalding 3, Tom
More informationIs obesity an inflammatory illness? Role of low-grade inflammation and macrophage infiltration in human white adipose tissue
DOI: 10.1111/j.1471-0528.2006.01004.x www.blackwellpublishing.com/bjog Review article Is obesity an inflammatory illness? Role of low-grade inflammation and macrophage infiltration in human white adipose
More informationAdipose Tissue Dysfunction and Diabetic Cardiovascular Disease
Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Xin-Liang Ma, MD, PhD Thomas Jefferson University Philadelphia, PA USA CVD As The #1 Causes of Death In USA Male Female Heart Disease and
More information902 Biomed Environ Sci, 2014; 27(11):
902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type
More information* Author to whom correspondence should be addressed; Tel.: ; Fax:
Int. J. Mol. Sci. 2014, 15, 6184-6223; doi:10.3390/ijms15046184 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Obesity and Its Metabolic Complications:
More informationNew therapeutic targets for T2DM
New therapeutic targets for T2DM Targeting inflammation: NF- B, salsalate Gwanpyo Koh Department of Internal Medicine Jeju National University School of Medicine Introduction Obesity is occurring at epidemic
More informationAdipose tissue dysfunction in obesity. Gijs Goossens, PhD
Adipose tissue dysfunction in obesity -The role of adipose tissue oxygenation - Gijs Goossens, PhD NUTRIM School of Nutrition and Translational Research in Metabolism Maastricht University Medical Centre
More informationRole of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD
Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Our laboratory focuses on the role of apolipoprotein (apo) B- containing lipoproteins in normal
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationObesity is considered a chronic low-grade inflammatory
CCL Promotes Macrophage Recruitment and Survival in Human Adipose Tissue Mayoura Keophiphath; Christine Rouault; Adeline Divoux; Karine Clément, MD, PhD; Danièle Lacasa, PhD Objectives To examine the role
More informationHSN301 Diet and Disease Entire Note Summary
Topic 1: Metabolic Syndrome Learning Objectives: 1. Define obesity 2. Factors causing obesity 3. Obesity as a risk factor for metabolic syndrome 4. The pathogenesis of metabolic syndrome 5. Treatment of
More informationCrosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea
Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationIKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung
IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung Se-Ran Yang, Samantha Valvo, Hongwei Yao, Aruna Kode, Saravanan Rajendrasozhan, Indika Edirisinghe, Samuel
More informationGlossary For TheFatNurse s For All Ages Series Adipocytes, also known as lipocytes and fat cells, are the cells that primarily compose adipose tissue, specialized in storing energy as fat. Apolipoprotein
More informationEffect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice
ACTA ACADEMIAE MEDICINAE SINICAE 410011 0731-85295846 lixia2014@vip. 163. com 4 C57BL /6 20-1 mrna 20 P < 0. 05 O 20 P > 0. 05 M2 P < 0. 05-1 mrna P < 0. 05 P > 0. 05 R589. 2 DOI 10. 3881 /j. issn. 1000-503X.
More informationChanges and clinical significance of serum vaspin levels in patients with type 2 diabetes
Changes and clinical significance of serum vaspin levels in patients with type 2 diabetes L. Yang*, S.J. Chen*, G.Y. Yuan, D. Wang and J.J. Chen Department of Endocrinology, Affiliated Hospital of Jiangsu
More informationImmunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on
Supplemental Methods Immunohistochemical Analyses Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on prostatectomy sections obtained post-study. Briefly,
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationThematic review series: The Immune System and Atherogenesis
thematic review Thematic review series: The Immune System and Atherogenesis Lipoprotein-associated inflammatory proteins: markers or mediators of cardiovascular disease? Alan Chait, 1 Chang Yeop Han, John
More informationObesity is considered a chronic low-grade inflammatory
Original Article Reduction of Macrophage Infiltration and Chemoattractant Gene Expression Changes in White Adipose Tissue of Morbidly Obese Subjects After Surgery-Induced Weight Loss Raffaella Cancello,
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More informationAssociation of serum adipose triglyceride lipase levels with obesity and diabetes
Association of serum adipose triglyceride lipase levels with obesity and diabetes L. Yang 1 *, S.J. Chen 1 *, G.Y. Yuan 1, L.B. Zhou 2, D. Wang 1, X.Z. Wang 1 and J.J. Chen 1 1 Department of Endocrinology,
More informationLIPOCALIN 2 DEFICIENCY INFLUENCES TRANSFORMING GROWTH FACTOR-β EFFECT ON INFLAMMATION AND EXTRACELLULAR MATRIX REMODELING IN INGUINAL ADIPOCYTES
LIPOCALIN 2 DEFICIENCY INFLUENCES TRANSFORMING GROWTH FACTOR-β EFFECT ON INFLAMMATION AND EXTRACELLULAR MATRIX REMODELING IN INGUINAL ADIPOCYTES A THESIS SUBMITTED TO THE FACULTY OF THE UNIVERSITY OF MINNESOTA
More informationΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ
ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΘΩΜΑΣ ΠΑΠΑΔΟΠΟΥΛΟΣ, MD, PHD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡΔΙΟΛΟΓΟΣ ΙΑΤΡΙΚΟ ΔΙΑΒΑΛΚΑΝΙΚΟ ΚΕΝΤΡΟ Inflammation as a cause of disease has entered the popular imagination. Diet ( macronutrients )
More informationPathologic Stage. Lymph node Stage
ASC ASC a c Patient ID BMI Age Gleason score Non-obese PBMC 1 22.1 81 6 (3+3) PBMC 2 21.9 6 6 (3+3) PBMC 3 22 84 8 (4+4) PBMC 4 24.6 68 7 (3+4) PBMC 24. 6 (3+3) PBMC 6 24.7 73 7 (3+4) PBMC 7 23. 67 7 (3+4)
More informationResearch Article Serum Ratio of Leptin to Adiponectin in Patients with Chronic Periodontitis and Type 2 Diabetes Mellitus
ISRN Biomarkers, Article ID 952636, 5 pages http://dx.doi.org/10.1155/2014/952636 Research Article Serum Ratio of Leptin to Adiponectin in Patients with Chronic Periodontitis and Type 2 Diabetes Mellitus
More informationCytokines modulate the functional activities of individual cells and tissues both under normal and pathologic conditions Interleukins,
Cytokines http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter22/animation the_immune_response.html Cytokines modulate the functional activities of individual cells and tissues both under
More informationPossible roles of adiponectin in inflammatory process of rheumatoid arthritis
193 Mini Review Possible roles of adiponectin in inflammatory process of rheumatoid arthritis Miho Suzuki and Masahiko Mihara Product Research Department, Fuji-Gotemba Research Laboratories, Chugai Pharmaceutical
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationUpdate On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?
Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown
More informationC-reactive protein levels in relation to various features of non-alcoholic fatty liver
C-reactive protein levels in relation to various features of non-alcoholic fatty liver disease among obese patients Esther Zimmermann 1,2, Rodolphe Anty 3,4,5, Joan Tordjman 6,7,8, An Verrijken 9, Philippe
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationSupplemental Table 1. Primer sequences for transcript analysis
Supplemental Table 1. Primer sequences for transcript analysis Primer Sequence (5 3 ) Primer Sequence (5 3 ) Mmp2 Forward CCCGTGTGGCCCTC Mmp15 Forward CGGGGCTGGCT Reverse GCTCTCCCGGTTTC Reverse CCTGGTGTGCCTGCTC
More informationLipid/Lipoprotein Structure and Metabolism (Overview)
Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationBy: Dr Mehrnoosh Shanaki
Resveratrol could partly improve the crosstalk between canonical β-catenin/wnt and FOXO pathways in coronary artery disease patients with metabolic syndrome: A case control study By: Dr Mehrnoosh Shanaki
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationSupplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
More informationSupplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.
SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationThe true cost of inpatient obesity impact on inflammatory stress and morbidity.
The true cost of inpatient obesity impact on inflammatory stress and morbidity. Professor Bob Grimble, Institute of Human Nutrition, Institute of Developmental Sciences Building, University of Southampton
More informationBasis of Immunology and
Basis of Immunology and Immunophysiopathology of Infectious Diseases Jointly organized by Institut Pasteur in Ho Chi Minh City and Institut Pasteur with kind support from ANRS & Université Pierre et Marie
More informationPPAR history of research
PPAR Rubens, 1640 PPAR history of research number of publications 3000 2000 1000 0 till now: : 16 296 publications 1985 1990 1995 2000 2005 year liver, brown adipocytes, kidney, heart, skeletal muscles,
More informationMetabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.
Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,
More informationLipid (Oil Red O) staining Kit
Lipid (Oil Red O) staining Kit Catalog Number KA4541 1 Kit Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information... 4 Materials
More informationGastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
More informationTargeting Adipose Tissue in Rheumatoid Arthritis TARA study HOFFA L SCAPTIPL 0.1013606 0.270906 0.3759505 0.3373511 0.4050987 0.404667 11.6 DISCUSSIONS The study targeted the serum levels of adipokines
More informationNature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
More informationHuman Leptin ELISA Kit
Product Manual Human Leptin ELISA Kit Catalog Numbers MET-5057 MET-5057-5 96 assays 5 x 96 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Leptin is a polypeptide hormone
More informationCRP. Downloaded from ijdld.tums.ac.ir at 7:15 IRDT on Friday July 20th 2018 CRP HDL CRP FBS. t-student. correlation CRP
214-220 (2 ) 10 1389 -.. 1 2 1* 1 :. 21 40 :. HDL (TG) (FBS)... correlation t-student t :.(P=0/001) TG. (P=0/004) HDL : HDL FBS... : -1-2 ( )... : afagh_anjomshoaa@yahoo.com : 0241-7270815 : 0241-7270814
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More informationMetabolic Syndrome. Antibodies and antigens
Metabolic Syndrome Antibodies and antigens HYTEST METABOLIC SYNDROME Introduction Metabolic syndrome is a cluster of conditions that increases the likelihood of cardiovascular heart diseases and diabetes.
More informationRat Primary Pre-adipocytes Culture Kit
Primary Cell Co., Ltd Rat Primary Pre-adipocytes Culture Kit Primary Cells from rat mesenteric, epididymal, and subcutaneous adipose tissues. Catalog # PMC-VAC01-COS, PMC-EAC01-COS, PMC-SAC01-COS Notice
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationNature Genetics: doi: /ng Supplementary Figure 1. Assessment of sample purity and quality.
Supplementary Figure 1 Assessment of sample purity and quality. (a) Hematoxylin and eosin staining of formaldehyde-fixed, paraffin-embedded sections from a human testis biopsy collected concurrently with
More informationEndocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
More informationCYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION
CYTOKINE RECEPTORS AND SIGNAL TRANSDUCTION What is Cytokine? Secreted popypeptide (protein) involved in cell-to-cell signaling. Acts in paracrine or autocrine fashion through specific cellular receptors.
More informationExamination of Mechanisms of Hepatotoxicity of Anti-diabetic PPARγ Agonists Using Applied Biosystems Rat Whole Genome Microarrays
Examination of Mechanisms of Hepatotoxicity of Anti-diabetic PPARγ Agonists Using Applied Biosystems Rat Whole Genome Microarrays Lu Zhang b, Lei Guo a, Leming Shi a, Weida Tong a, Yongming Sun b, Gary
More informationAdiponectin, TG/HDL-cholesterol index and hs-crp. Predictors of insulin resistance.
ORIGINAL ARTICLE Adiponectin, TG/HDL-cholesterol index and hs-crp. Predictors of insulin resistance. Bonneau GA y Pedrozo WR 1 Ministry of Public Health, Province of Misiones, 2 School of Exact, Chemical
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationHuman obesity is associated with the development of
CD1 dim CD1 and CD1 CD1 Monocytes in Obesity and During Weight Loss Relationships With Fat Mass and Subclinical Atherosclerosis Christine Poitou, Elise Dalmas, Mariana Renovato, Vanessa Benhamo, Froogh
More informationSummary and concluding remarks
Summary and concluding remarks This thesis is focused on the role and interaction of different cholesterol and phospholipid transporters. Cholesterol homeostasis is accomplished via a tightly regulated
More informationIntroduction. Acute sodium overload produces renal tubulointerstitial inflammation in normal rats
Acute sodium overload produces renal tubulointerstitial inflammation in normal rats MI Roson, et al. Kidney International (2006) Introduction Present by Kanya Bunnan and Wiraporn paebua Tubular sodium
More informationNicolucci C. (1), Rossi S. (2), Catapane M. (1), Introduction:
Bisphenol A and Nicolucci C. (1), Rossi S. (2), Catapane M. (1), (1) Dept. Experimental Medicine, Second University of (2) Institute of Genetic and Biophysics, CNR, Naples (3) Dept. of Pediatrics 'F. Fede',
More informationEffector T Cells and
1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New
More informationSupplementary Information
Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya
More informationSupplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
More informationGlossary For TheFatNurse s For All Ages Series Apolipoprotein B (APOB or ApoB) are the primary apolipoproteins of chylomicrons and low-density lipoproteins (LDL - known commonly by the misnomer "bad cholesterol"
More informationSupplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
More informationMETABOLISM of ADIPOSE TISSUE
METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation
More informationEffective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features
Effective activity of cytokine-induced killer cells against autologous metastatic melanoma including cells with stemness features Loretta Gammaitoni, Lidia Giraudo, Valeria Leuci, et al. Clin Cancer Res
More informationFAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat
Mary-Kate Perrone Capstone Seminar July 14, 2007 Draft #2 Fat Stats FAT. It s Not All That! A Closer Look at the Two Main Types of Fat in Our Bodies: Visceral and Subcutaneous Fat According to the 2003-2004
More information( ) Downloaded from ijem.sbmu.ac.ir at 20: on Friday March 22nd 2019 VEFG. HIIT. MICT. :.
( ) VEFG 2 1 1 ( ) (2 (1 : ( e-mail: Mostafa.rahimi20@gmail.com (MICT) (HIIT) :. (VEGF) ( ± ) :. (HIIT) (MICT) MICT. HIIT.. :. Real-time RT-PCR (P / ) VEGF.(P / ) :. : 96/5/15 : 96/4/20 96//6 : 1 2014
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationMetabolism and Atherogenic Properties of LDL
Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal
More informationPotential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy. Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L.
Potential Atheroprotective Effects of Ixmyelocel-T Cellular Therapy Kelly J. Ledford, Nikki Murphy, Frank Zeigler, Ronnda L. Bartel 1 Ixmyelocel-T, an expanded, autologous multicellular therapy cultured
More informationSupplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich
More informationFAPESP Week /21/2017
Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr
More informationJournal Club Semmler Lorenz
Beer et al. 2015 - Analysis of the Secretome of Apoptotic Peripheral Blood Mononuclear Cells: Impact of Released Proteins and Exosomes for Tissue Regeneration Journal Club 13.11.2017 1 Introduction to
More informationSupplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
More informationIncreased oxidative stress according to number of risk factors in metabolic syndrome patients
University of Londrina, Paraná, Brazil Increased oxidative stress according to number of risk factors in metabolic syndrome patients Danielle Venturini, PhD 2016 Venturini, Danielle 1*, Alves, Caroline
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More information