Effect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice

Size: px
Start display at page:

Download "Effect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice"

Transcription

1 ACTA ACADEMIAE MEDICINAE SINICAE com 4 C57BL / mrna 20 P < O 20 P > M2 P < mrna P < P > R DOI /j. issn X A X Effect of High-fat or High-glucose Diet on Obesity and Visceral Adipose Tissue in Mice TANG Li-li TANG Xiao-han LI Xia YU Hai-bo XIE Zhi-guo LIU Xin-yuan ZHOU Zhi-guang Department of Endocrinology the Second Xiangya Hospital Central South University Diabetes Center Institute of Metabolism and Endocrinology Central South University Diabetes Immunology Ministry of Education Key Laboratory National Clinical Research Center for Metabolic Disease Changsha China Corresponding author LI Xia Tel lixia2014@vip com ABSTRACT Objective To investigate the effect of high-fat or high-glucose diet on obesity and visceral adipose tissue in C57BL /6 mice. Methods Four-week-old C57BL /6 mice were allocated into normal diet group high-fat diet group and high-glucose diet group according to the random number table until 20 weeks old. Body weight epididymal adipose tissue weight blood leptin fat infiltration in liver M1 /M2 macrophage subtypes and monocyte chemoattractant protein-1 mrna in epididymal adipose tissues were measured. Results Compared with normal diet group body weight epididymal adipose tissue weight and leptin concentration in high fat diet group at 20 weeks were significantly increased P < and oil red O staining showed more prominent adipocyte infiltration in liver in high-fat diet group than those in normal diet and high-glucose diet Supported by the National Natural Sciences Foundation of China The first two author contributed equally to this article 614

2 group. However no apparent differences were seen in high-glucose diet group at 20 weeks in terms of body weight epididymal adipose tissue weight and leptin concentration. In high-fat diet group the macrophages infiltration in epididymal adipose tissue increased with time and the percentage of M2 macrophage decreased in highfat diet group than that in high-glucose diet group P < Compared with normal diet group monocyte chemoattractant protein-1 mrna expression increased significantly in high-fat diet group P < In highglucose group however no significant differences were discerned P > Conclusion High-fat diet rather than 60% high glucose diet will lead to obesity and macrophage infiltration in adipose tissues. Key words adipose tissue high-fat diet high-glucose diet macrophages obesity Acta Acad Med Sin mm 2 mm 1 C6885 Sigma 2 USA min -1 monocyte chemoattractant protein-1 MCP cm r /min 5 min M1 M2 M1 Th1 M2 Millipore Th2 Excel 5 10 μm 35 C57BL /6 10 min O 5 min F4 /80 CD11c CD11b 5 20 Biolengend Flow Cytometer F4 /80 + MCP-1 mrna 60% CD11b + CD11c + M1 F4 / % CD11b + CD11c - M2 10% MCP-1 mrna Trizol RNA cdna MCP-1 5 -CACT- CACCTGCTGCTACTCAT-3 5 -CTACAGCTTCTTTGGGA

3 CACC-3 PCR ABI- PRISM 7000 PCR threshold cycle val- PCR ± g ± g ± g PCR ± g P < ue CT ± g ± g SPSS ± g P = ± P = A 1B ± % ± % ONE-WAY ANOVA P < ±0. 60 % ± P < % P = C ± ng /ml ± ng /ml P = ± g ± g ± g ± g P < P < ± g ± g ± ng /ml ± ng /ml ± g ± g P < ± g ± ng /ml ± ng /ml P < ± ng /ml ± ng /ml P = D ND HG HF a P < ND normal diet group HG high-glucose diet group HF high-fat diet group a P < compared with the normal diet group A. B. C. D. A. body weight B. epididymal adipose tissue weight C. percentage of epididymal adipose tissue weight ratio D. serum leptin levels 1 Fig 1 Comparison of body weight epididymal adipose tissue weight and leptin levels among three groups 616

4 O ± % ± % 3C M ± % ± % 10 P < D ± % ± % A. B. C. A. normal diet group B. high-fat diet group C. high-glucose diet group Fig 2 Comparison of adipocyte infiltration among three groups by liver oil red staining 20 FITC APC FSC PerCP - - M1 M1 M2 M2 a P < FITC fluorescein isothiocyanate APC allophycocyanin FSC forward scattering angle PerCP peridinin-chlorophyll-protein M1 M1 macrophages M2 M2 macrophages a P < compared with the high-glucose diet group A. B. M1 C. D. 20 M1 /M2 A. flow chart of macrophages in adipose tissue in high-fat diet group B. flow chart of M1 type macrophages in adipose tissue in high-fat diet group C. comparison of percentage of macrophages for each group D. comparison of percentage of M2 macrophage at week 20 for each group 3 Fig 3 Comparison of macrophages infiltration among three groups.. 617

5 MCP-1 mrna PCR 10 60% MCP-1 20 MCP ± ± P < 60% MCP ± ± P > α tumor necrosis factorα TNF-α interleukin IL -6 IL-1β M1 IL-10 β M MCP-1 mrna 20 4 Fig MCP-1 mrna Expressions of MCP-1 mrna at the 4 th 10 th and 20 th week in each group MCP-1 MCP-1 M2 M2 M1 MCP-1-1 a P < MCP-1 monocyte chemoattractant protein-1 a P < compared with Huang 8 the normal diet group NADPH NADPH 618

6 Matos Ferreira 14 Swiss 64% 19% 7 Chinetti-Gbaguidi G Staels B. 11% 45% 17% 38% Lipidol MCP-1 MCP-1 Scientific World J Dickinson S Hancock DP Petocz P et al. High-glycemic 20 MCP-1 in mononuclear cells of young lean healthy subjects J. 10 Ghanim H Aljada A Hofmeyer D et al. Circulating mono- 60% nuclear cells in the obese are in a proinflammatory state J. Circulation Van der Heiden K Cuhlmann S Luong LA et al. Role of nuclear factor kappa B in cardiovascular health and disease J. Clin Sci Lond / Cipolletta D. Adipose tissue-resident regulatory T cells phenotypic specialization functions and therapeutic potential J. Immunology Jakobsdottir G Xu J Molin G et al. High-fat diet reduces the formation of butyrate but increases succinate inflammation liver fat and cholesterol in rats while dietary fibre counteracts these effects J. PLoS One e Deshmane SL Kremlev S Amini S et al. Monocyte chemoattractant protein-1 MCP-1 an overview J. J Interferon Cytokine Res Kanda H Tateya S Tamori Y et al. MCP-1 contributes to -κb TNF-α 9-11 MCP-1 macrophage infiltration into adipose tissue insulin resistance and hepatic steatosis in obesity J. J Clin Invest M1 TNF-α IL Sica A Mantovani A. Macrophage plasticity and polarization in vivo veritas J. J Clin Invest Lee 13 C57BL / Weisberg SP Mccann D Desai M et al. Obesity is associ- TNF-α ated with macrophage accumulation in adipose tissue J. J Clin Invest Macrophage polarization in metabolic disorders functions and regulation J. Curr Opin 8 Huang CJ Zourdos MC Jo E et al. Influence of physical activity and nutrition on obesity-related immune function J. index carbohydrate increases nuclear factor-kappa B activation Am J Clin Nutr Makki K Froguel P Wolowczuk I. Adipose tissue in obesityrelated inflammation and insulin resistance cells cytokines and chemokines J. ISRN Inflamm Lee IS Shin G Choue R. Shifts in diet from high fat to high carbohydrate lmproved levels of adipokines and pro-inflammatory cytokines in mice fed a high-fat diet J. Endocr J Matos Ferreira AV Mario EG Jardim Porto LC et al. High-carbohydrate diet selectively induces tumor necrosis factor-alpha production in mice liver J. Inflammation

An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes

An excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,

More information

Naohito AOKI, Erina ARAKAWA and Miyuki ITO. Department of Life Science, Graduate School of Bioresources, Mie University Tsu ABSTRACT

Naohito AOKI, Erina ARAKAWA and Miyuki ITO. Department of Life Science, Graduate School of Bioresources, Mie University Tsu ABSTRACT Naohito AOKI, Erina ARAKAWA and Miyuki ITO Department of Life Science, Graduate School of Bioresources, Mie University Tsu 514-857 ABSTRACT C57BL/6J mice (male, 4wk old) were fed low fat diet (LF), high

More information

Abstract: I. A ims Aim 1:

Abstract: I. A ims Aim 1: Abstract: Previous work from our laboratory demonstrated that obese mice have alterations in antiviral cytokine gene expression when infected with the influenza virus. Since these cytokines play a major

More information

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9.

Supplemental Table 1: Demographics and characteristics of study participants. Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± ± 9. SUPPLEMENTAL DATA Supplemental Table 1: Demographics and characteristics of study participants Lean (n=15) Obese (n=12) Male, n (%) 3 (20%) 6 (50%) Age, years [mean ± SD] 33.3 ± 9.5 44.8 ± 9.1 White, n

More information

Immune profiles of T lymphocyte subsets in adipose tissue of obese mouse induced by high-fat diet

Immune profiles of T lymphocyte subsets in adipose tissue of obese mouse induced by high-fat diet Indian J. Anim. Res., 51 (5) 2017 : 868-874 Print ISSN:0367-6722 / Online ISSN:0976-0555 AGRICULTURAL RESEARCH COMMUNICATION CENTRE www.arccjournals.com/www.ijaronline.in Immune profiles of T lymphocyte

More information

Tomasz J Guzik. Diabetes, perivascular adipose tissue and inflammation.

Tomasz J Guzik. Diabetes, perivascular adipose tissue and inflammation. Tomasz J Guzik Diabetes, perivascular adipose tissue and inflammation. Translational Research Laboratory Department of Internal and Agricutural Medicine Jagiellonian University School of Medicine Cracow,

More information

FAPESP Week /21/2017

FAPESP Week /21/2017 Texas Tech University Dr Naima Moustaid-Moussa Texas Tech University FAPESP Week 2017 09/21/2017 University of Sao Paulo Dr Sonia Jancar ICB-USP Theresa Ramalho MS PhD candidate, Immunology ICB-USP Dr

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity

Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Downloaded from http:// on December 17, 2017. https://doi.org/10.1172/jci.insight.87748 Epigenetic regulation of macrophage polarization and inflammation by DNA methylation in obesity Xianfeng Wang, 1

More information

Supplementary Figures

Supplementary Figures Supplementary Figures mir-150 regulates obesityassociated insulin resistance by controlling B cell functions Wei Ying, Alexander Tseng, Richard Cheng-An Chang, Haiqing Wang, Yu-lieh Lin, Srikanth Kanameni,

More information

Zinc Deficiency Contributes to Chronic Inflammation in Obesity. Honors Research Thesis

Zinc Deficiency Contributes to Chronic Inflammation in Obesity. Honors Research Thesis Zinc Deficiency Contributes to Chronic Inflammation in Obesity Honors Research Thesis Presented in Partial Fulfillment of the Requirements for Graduation with Honors Research Distinction in the Undergraduate

More information

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University

Adipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,

More information

We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan

We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan Supplementary Methods Animal models We obtained Male C57BL/6J, ob/ob, and Cd8a-deficient mice from Charles River Japan or Jackson Laboratories. All mice were housed under a 12-h light-dark cycle and allowed

More information

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018

Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,

More information

ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ

ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΦΛΕΓΜΟΝΗ ΚΑΙ ΔΙΑΒΗΤΗΣ ΘΩΜΑΣ ΠΑΠΑΔΟΠΟΥΛΟΣ, MD, PHD ΕΠΕΜΒΑΤΙΚΟΣ ΚΑΡΔΙΟΛΟΓΟΣ ΙΑΤΡΙΚΟ ΔΙΑΒΑΛΚΑΝΙΚΟ ΚΕΝΤΡΟ Inflammation as a cause of disease has entered the popular imagination. Diet ( macronutrients )

More information

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes

Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,

More information

HVEM-deficient mice fed a high-fat diet are protected from adipose tissue inflammation and glucose intolerance

HVEM-deficient mice fed a high-fat diet are protected from adipose tissue inflammation and glucose intolerance FEBS Letters 585 (2011) 2285 2290 journal homepage: www.febsletters.org HVEM-deficient mice fed a high-fat diet are protected from adipose tissue inflammation and glucose intolerance Ha-Jung Kim a, Hong-Min

More information

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.

Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Yiying Zhang, PhD Research Scientist. Research Summary:

Yiying Zhang, PhD Research Scientist. Research Summary: Yiying Zhang, PhD Research Scientist Research Summary: Address: Naomi Berrie Diabetes Center at Columbia University Medical Center Russ Berrie Medical Science Pavilion 1150 St. Nicholas Avenue New York,

More information

Dietary regulation of nuclear receptors in obesity-related metabolic syndrome

Dietary regulation of nuclear receptors in obesity-related metabolic syndrome 126 Asia Pac J Clin Nutr 2008;17(S1):126-130 Review Article Dietary regulation of nuclear receptors in obesity-related metabolic syndrome Teruo Kawada PhD 1, Tsuyoshi Goto 1, Shizuka Hirai PhD 1, Min-Sook

More information

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.

3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H. U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,

More information

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra

Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue. Rinke Stienstra Inflammasome-mediated caspase-1 activity Gatekeeper of inflammation in the adipose tissue Rinke Stienstra Obesity promotes the development of insulin resistance and type 2 diabetes County-level Estimates

More information

New therapeutic targets for T2DM

New therapeutic targets for T2DM New therapeutic targets for T2DM Targeting inflammation: NF- B, salsalate Gwanpyo Koh Department of Internal Medicine Jeju National University School of Medicine Introduction Obesity is occurring at epidemic

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease

Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Xin-Liang Ma, MD, PhD Thomas Jefferson University Philadelphia, PA USA CVD As The #1 Causes of Death In USA Male Female Heart Disease and

More information

Research Article Serum Ratio of Leptin to Adiponectin in Patients with Chronic Periodontitis and Type 2 Diabetes Mellitus

Research Article Serum Ratio of Leptin to Adiponectin in Patients with Chronic Periodontitis and Type 2 Diabetes Mellitus ISRN Biomarkers, Article ID 952636, 5 pages http://dx.doi.org/10.1155/2014/952636 Research Article Serum Ratio of Leptin to Adiponectin in Patients with Chronic Periodontitis and Type 2 Diabetes Mellitus

More information

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity

MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Research article MCP-1 contributes to macrophage infiltration into adipose tissue, insulin resistance, and hepatic steatosis in obesity Hajime Kanda, 1 Sanshiro Tateya, 1 Yoshikazu Tamori, 1 Ko Kotani,

More information

METABOLISM of ADIPOSE TISSUE

METABOLISM of ADIPOSE TISSUE METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation

More information

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of

Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.

More information

Supplementary Table 1

Supplementary Table 1 Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,

More information

Quantitative Real-Time PCR was performed as same as Materials and Methods.

Quantitative Real-Time PCR was performed as same as Materials and Methods. Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B

More information

902 Biomed Environ Sci, 2014; 27(11):

902 Biomed Environ Sci, 2014; 27(11): 902 Biomed Environ Sci, 2014; 27(11): 902-906 Letter to the Editor Curcuminoids Target Decreasing Serum Adipocyte-fatty Acid Binding Protein Levels in Their Glucose-lowering Effect in Patients with Type

More information

Thrombin promotes diet-induced obesity through fibrin-driven inflammation

Thrombin promotes diet-induced obesity through fibrin-driven inflammation Thrombin promotes diet-induced obesity through fibrin-driven inflammation Anna K. Kopec, 1 Sara R. Abrahams, 2 Sherry Thornton, 3 Joseph S. Palumbo, 4 Eric S. Mullins, 4 Senad Divanovic, 5 Hartmut Weiler,

More information

Natural Killer T cells and their functions in atherosclerosis and obesity: a therapeutic perspective for cardiovascular diseases

Natural Killer T cells and their functions in atherosclerosis and obesity: a therapeutic perspective for cardiovascular diseases REVIEW Natural Killer T cells and their functions in atherosclerosis and obesity: a therapeutic perspective for cardiovascular diseases A.M. van de Vrugt 1 and E. Kalkhoven 2 1 Biology of Disease Master

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

SUPPLEMENTARY METHODS

SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,

More information

HHS Public Access Author manuscript Obesity (Silver Spring). Author manuscript; available in PMC 2014 November 01.

HHS Public Access Author manuscript Obesity (Silver Spring). Author manuscript; available in PMC 2014 November 01. Lower NLRP3 Inflammasome activity in NAG-1 transgenic mice is linked to a resistance to obesity and increased insulin sensitivity Xingya Wang 1, Kali Chrysovergis 1, Justin Kosak 1, and Thomas E. Eling

More information

University of California, San Diego La Jolla CA 92093

University of California, San Diego La Jolla CA 92093 AD Award Number: W81XWH-11-1-0131 TITLE: Role of Inflammation and Insulin Resistance in Mouse Models of Breast Cancer PRINCIPAL INVESTIGATOR: Jerrold Olefsky, M.D. CONTRACTING ORGANIZATION: University

More information

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value

Supplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)

More information

Tissue factor-par2 signaling promotes diet-induced obesity and adipose

Tissue factor-par2 signaling promotes diet-induced obesity and adipose Supplementary figures for Tissue factor-par2 signaling promotes diet-induced obesity and adipose inflammation. Leylla Badeanlou 1, Christian Furlan-Freguia 2, Guang Yang 1, Wolfram Ruf 2,3, and Fahumiya

More information

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1]

TBP (H) CACAGTGAATCTTGGTTGTAAACTTGA AAACCGCTTGGGATTATATTCG ANGPTL8 (H) CTGGGCCCTGCCTACCGAGA CCGATGCTGCTGTGCCACCA [1] ESM Table 1. Immunoblot antibodies. Primary Supplier Dilution Antibody Akt Cell Signaling 1:1000 Technology Phosphorylated Cell Signaling 1:1000 Akt (Ser 473) Technology PKCε Cell Signaling 1:1000 Technology

More information

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation

STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation ORIGINAL ARTICLE STAT4 Deficiency Reduces Obesity-Induced Insulin Resistance and Adipose Tissue Inflammation Anca D. Dobrian, 1 Elena V. Galkina, 2 Qian Ma, 1 Margaret Hatcher, 1 Sabai Myo Aye, 1 Mathew

More information

HSN301 Diet and Disease Entire Note Summary

HSN301 Diet and Disease Entire Note Summary Topic 1: Metabolic Syndrome Learning Objectives: 1. Define obesity 2. Factors causing obesity 3. Obesity as a risk factor for metabolic syndrome 4. The pathogenesis of metabolic syndrome 5. Treatment of

More information

MICROBIOM AND OBESITY HEINZ GYAKY 2018 BUDAPEST

MICROBIOM AND OBESITY HEINZ GYAKY 2018 BUDAPEST MICROBIOM AND OBESITY HEINZ GYAKY 2018 BUDAPEST HUMAN MICROBIOM 10 Billion bacterias are building a 1,5 2 kg heavy human microbiom It is located mainly in the human gut There is a intestinal controlled

More information

* Author to whom correspondence should be addressed; Tel.: ; Fax:

* Author to whom correspondence should be addressed;   Tel.: ; Fax: Int. J. Mol. Sci. 2014, 15, 6184-6223; doi:10.3390/ijms15046184 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Obesity and Its Metabolic Complications:

More information

Brian Francis Zamarron

Brian Francis Zamarron Metabolic Abnormalities and Adipose Tissue Leukocyte Dynamics in a Murine Model of Obesity, Weight Loss, and Weight Regain By Brian Francis Zamarron A dissertation submitted in partial fulfillment of the

More information

The Relationship between Dietary Fatty Acids and Inflammatory Genes on the Obese Phenotype and Serum Lipids

The Relationship between Dietary Fatty Acids and Inflammatory Genes on the Obese Phenotype and Serum Lipids Nutrients 2013, 5, 1672-1705; doi:10.3390/nu5051672 Review OPEN ACCESS nutrients ISSN 2072-6643 www.mdpi.com/journal/nutrients The Relationship between Dietary Fatty Acids and Inflammatory Genes on the

More information

MICRORNA-223 REGULATES MACROPHAGE POLARIZATION AND DIET- INDUCED INSULIN RESISTANCE. A Thesis CONG MENG

MICRORNA-223 REGULATES MACROPHAGE POLARIZATION AND DIET- INDUCED INSULIN RESISTANCE. A Thesis CONG MENG MICRORNA-223 REGULATES MACROPHAGE POLARIZATION AND DIET- INDUCED INSULIN RESISTANCE A Thesis by CONG MENG Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the

More information

Protein extraction and western blot analysis Protein extraction was performed as

Protein extraction and western blot analysis Protein extraction was performed as ESM Methods Protein extraction and western blot analysis Protein extraction was performed as previously described [1]. 2 g protein was loaded on SDSPAGE and immunoblotted with antibodies to mouse AKT (1:1,

More information

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity.

Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Supplementary Figure 1 Metabolic ER stress and inflammation in white adipose tissue (WAT) of mice with dietary obesity. Male C57BL/6J mice were fed a normal chow (NC, 10% fat) or a high-fat diet (HFD,

More information

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!

More information

Review Article Adipose Tissue in Obesity-Related Inflammation and Insulin Resistance: Cells, Cytokines, and Chemokines

Review Article Adipose Tissue in Obesity-Related Inflammation and Insulin Resistance: Cells, Cytokines, and Chemokines ISRN Inflammation Volume 2013, Article ID 139239, 12 pages http://dx.doi.org/10.1155/2013/139239 Review Article Adipose Tissue in Obesity-Related Inflammation and Insulin Resistance: Cells, Cytokines,

More information

Targeting Inflammation in Breast Cancer Pathogenesis

Targeting Inflammation in Breast Cancer Pathogenesis Targeting Inflammation in Breast Cancer Pathogenesis Clifford Hudis, M.D. Chief, Breast Cancer Medicine Service Attending Physician, MSKCC Professor of Medicine, Weill Cornell Medical College August 7,

More information

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF

The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong

More information

Obesity Science & Practice ORIGINAL ARTICLE. Summary. Background. Objective. Methods. Results. Conclusion

Obesity Science & Practice ORIGINAL ARTICLE. Summary. Background. Objective. Methods. Results. Conclusion Obesity Science & Practice doi: 10.1002/osp4.47 ORIGINAL ARTICLE Tumor necrosis factor-alpha levels in blood cord is directly correlated with the body weight of mothers E. de Toledo Baldi 1,2, V. C. Dias

More information

FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH

FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH ALETA A SOURCE OF 1,3-BETA GLUCANS Aleta is highly bioavailable, offering a concentration greater than 5% of 1,3-beta glucans. Aleta provides a consistent response

More information

Supporting Information

Supporting Information Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,

More information

Immune Cells in Regional Adipose Tissue Depots: A Pilot Study. Vi Dam. A Thesis. The Department. Exercise Science

Immune Cells in Regional Adipose Tissue Depots: A Pilot Study. Vi Dam. A Thesis. The Department. Exercise Science Effect of Early onset Obesity versus Late onset Obesity on Immune Cells in Regional Adipose Tissue Depots: A Pilot Study Vi Dam A Thesis in The Department of Exercise Science Presented in Partial Fulfillment

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease

Interferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,

More information

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao

More information

Vol. 41 No Journal of Jiangxi Normal University Natural Science Sep. 2017

Vol. 41 No Journal of Jiangxi Normal University Natural Science Sep. 2017 41 5 Vol 41 No 5 2017 9 Journal of Jiangxi Normal University Natural Science Sep 2017 1000-5862 2017 05-0516-05 II 1 2 2 3 1 2* 1 518001 2 518060 3 518020 II ELISA IgE IgG IL-6 TNF-α IFN-γ 5 10 mg kg -

More information

LIPOCALIN 2 DEFICIENCY INFLUENCES TRANSFORMING GROWTH FACTOR-β EFFECT ON INFLAMMATION AND EXTRACELLULAR MATRIX REMODELING IN INGUINAL ADIPOCYTES

LIPOCALIN 2 DEFICIENCY INFLUENCES TRANSFORMING GROWTH FACTOR-β EFFECT ON INFLAMMATION AND EXTRACELLULAR MATRIX REMODELING IN INGUINAL ADIPOCYTES LIPOCALIN 2 DEFICIENCY INFLUENCES TRANSFORMING GROWTH FACTOR-β EFFECT ON INFLAMMATION AND EXTRACELLULAR MATRIX REMODELING IN INGUINAL ADIPOCYTES A THESIS SUBMITTED TO THE FACULTY OF THE UNIVERSITY OF MINNESOTA

More information

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,

Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow

More information

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway

Roger J. Davis. Metabolic Stress Signaling by the JNK Pathway Roger J. Davis Metabolic Stress Signaling by the JNK Pathway Age-adjusted Percentage of U.S. Adults with Diagnosed Diabetes or Obesity Diabetes 1994 2000 2007 Obesity (BMI 30 kg/m 2 )

More information

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein

Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Targeting Adipose Tissue Inflammation to Treat the Underlying Basis of the Metabolic Complications of Obesity

Targeting Adipose Tissue Inflammation to Treat the Underlying Basis of the Metabolic Complications of Obesity Obesity Treatment: Challenges and Opportunities Drewnowski A, Rolls BJ (eds): Obesity Treatment and Prevention: New Directions. Nestlé Nutr Inst Workshop Ser, vol 73, pp 49 60, Nestec Ltd., Vevey/S. Karger

More information

Osteopontin mediates obesity-induced adipose tissue macrophage infiltration and insulin resistance in mice

Osteopontin mediates obesity-induced adipose tissue macrophage infiltration and insulin resistance in mice Research article Osteopontin mediates obesity-induced adipose tissue macrophage infiltration and insulin resistance in mice Takashi Nomiyama, 1 Diego Perez-Tilve, 2 Daisuke Ogawa, 1 Florence Gizard, 1

More information

Pair-fed % inkt cells 0.5. EtOH 0.0

Pair-fed % inkt cells 0.5. EtOH 0.0 MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded

More information

Empower Preventive Medicine. Timothy J. McCormick, DO, MPH 4221 Baymeadows Suite 6 Jacksonville, FL

Empower Preventive Medicine. Timothy J. McCormick, DO, MPH 4221 Baymeadows Suite 6 Jacksonville, FL Empower Preventive Medicine Timothy J. McCormick, DO, MPH 4221 Baymeadows Suite 6 Jacksonville, FL 32217 904-367-4005 Drtim@emprevmed.com Obesity Medicine Old paradigm: Obesity was a matter of willpower,

More information

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC

GENE Forward primer Reverse primer FABP4 CCTTTGTGGGGACCTGGAAA TGACCGGATGACGACCAAGT CD68 AATGTGTCCTTCCCACAAGC GGCAGCAAGAGAGATTGGTC Published in "" which should be cited to refer to this work. mrna extraction and RT-PCR Total RNA from 5 15 mg of crushed white adipose tissue was isolated using the technique described by Chomczynski

More information

Canqiu Yu 1, Jinwei Chen 2, Li Huang 3*

Canqiu Yu 1, Jinwei Chen 2, Li Huang 3* A STUDY ON THE ANTITUMOUR EFFECT OF TOTAL FLAVONOIDS FROM PTERIS MULTIFIDA POIR IN H22 TUMOUR-BEARING MICE 459 Canqiu Yu 1, Jinwei Chen 2, Li Huang 3* 1 Department of General Surgery, The Second Xiangya

More information

Possible roles of adiponectin in inflammatory process of rheumatoid arthritis

Possible roles of adiponectin in inflammatory process of rheumatoid arthritis 193 Mini Review Possible roles of adiponectin in inflammatory process of rheumatoid arthritis Miho Suzuki and Masahiko Mihara Product Research Department, Fuji-Gotemba Research Laboratories, Chugai Pharmaceutical

More information

Supplemental Table I.

Supplemental Table I. Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,

More information

Targeting Adipose Tissue in Rheumatoid Arthritis TARA study HOFFA L SCAPTIPL 0.1013606 0.270906 0.3759505 0.3373511 0.4050987 0.404667 11.6 DISCUSSIONS The study targeted the serum levels of adipokines

More information

Pro-Inflammatory Profile of Extremely Obese Children in a Local Population of Central Punjab, Pakistan

Pro-Inflammatory Profile of Extremely Obese Children in a Local Population of Central Punjab, Pakistan ORIGINAL ARTICLE Pro-Inflammatory Profile of Extremely Obese Children in a Local Population of Central Punjab, Pakistan ROMANA MAQSOOD SHEIKH*, KIRAN BUTT**, HASAN MASOOD KHAN***, M. ARSLAN**** ABSTRACT

More information

Gut Reaction. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD

Gut Reaction. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Gut Reaction Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD Ley, R. et al (2005) PNAS vol. 102 no. 31 Bacterial diversity in the distal gut (ceca) of C57BL6 mice. (A) Phylogenetic tree of

More information

Cornstarch

Cornstarch Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2018 Supplementary data : Supplementary Table 1: Diet composition (g/kg) on the basis of the

More information

Sunitinib, an orally available receptor tyrosine kinase inhibitor, induces monocytic

Sunitinib, an orally available receptor tyrosine kinase inhibitor, induces monocytic Sunitinib, an orally available receptor tyrosine kinase inhibitor, induces monocytic differentiation of acute myeogenouse leukemia cells that is enhanced by 1,25-dihydroxyviatmin D 3. To the Editor: Sunitinib,

More information

pplementary Figur Supplementary Figure 1. a.

pplementary Figur Supplementary Figure 1. a. pplementary Figur Supplementary Figure 1. a. Quantification by RT-qPCR of YFV-17D and YFV-17D pol- (+) RNA in the supernatant of cultured Huh7.5 cells following viral RNA electroporation of respective

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2211 a! mir-143! b! mir-103/107! let-7a! mir-144! mir-122a! mir-126-3p! mir-194! mir-27a! mir-30c! Figure S1 Northern blot analysis of mir-143 expression dependent on feeding conditions.

More information

TITLE: Adipose Estrogen and Increased Breast Cancer Risk in Obesity: Regulation by Leptin and Insulin

TITLE: Adipose Estrogen and Increased Breast Cancer Risk in Obesity: Regulation by Leptin and Insulin AD Award Number: W81XWH-05-1-0497 TITLE: Adipose Estrogen and Increased Breast Cancer Risk in Obesity: Regulation by Leptin and Insulin PRINCIPAL INVESTIGATOR: Fahumiya Samad CONTRACTING ORGANIZATION:

More information

Subject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119

Subject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119 Acarbose, diabetes prevention trials 32, 33, 40 42 Accelerator hypothesis accelerators beta cell autoimmunity 140, 141, 147, 150, 151 insulin resistance 140, 142 144, 150 obesity 145 148 diabetes risk

More information

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial

Suppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade

More information

High sensitive C-reactive protein, an independent and early novel inflammatory marker in healthy obese women.

High sensitive C-reactive protein, an independent and early novel inflammatory marker in healthy obese women. Biomedical Research 01; 3 (1): 73-77 High sensitive C-reactive protein, an independent and early novel inflammatory marker in healthy obese women. Nirmitha Dev and Sara Rani Marcus Department of Biochemistry,

More information

ankylosing spondylitis Department of Clinical Immunology, Xijing Hospital, The Fourth Military

ankylosing spondylitis Department of Clinical Immunology, Xijing Hospital, The Fourth Military Functional defects in CD4 + CD25 high FoxP3 + regulatory cells in ankylosing spondylitis Huifang Guo 1, 2, 3, Ming Zheng 1, 2, 3, Kui Zhang 1, 3, Fengfan Yang 1, 3, Xin Zhang 1, 3, Qing Han 1, 3, Zhi-Nan

More information

Serum cytokine levels in control and tumor-bearing male and female mice at day 15.

Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Supplementary Table 1. Serum cytokine levels in control and tumor-bearing male and female mice at day 15. Male Female Cytokine Control C-26 Control C-26 IL-1β 2.0 ± 0.8 9.6 ± 1.5* 1.8 ± 0.2 6.8 ± 1.4*

More information

Health benefits of mango supplementation as it relates to weight loss, body composition, and inflammation: a pilot study

Health benefits of mango supplementation as it relates to weight loss, body composition, and inflammation: a pilot study Title of Study: Health benefits of mango supplementation as it relates to weight loss, body composition, and inflammation: a pilot study Principal Investigator: Dr. Edralin A. Lucas Nutritional Sciences

More information

ABSTRACT INTRODUCTION

ABSTRACT INTRODUCTION /, 2017, Vol. 8, (No. 19), pp: 31023-31040 Chikusetsu saponin IVa ameliorates high fat diet-induced inflammation in adipose tissue of mice through inhibition of NLRP3 inflammasome activation and NF-κB

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

Adipose tissue dysfunction in obesity. Gijs Goossens, PhD

Adipose tissue dysfunction in obesity. Gijs Goossens, PhD Adipose tissue dysfunction in obesity -The role of adipose tissue oxygenation - Gijs Goossens, PhD NUTRIM School of Nutrition and Translational Research in Metabolism Maastricht University Medical Centre

More information

H1N1 H7N9. Clinical analysis of severe avian influenza H7N9 and severe influenza A H1N1

H1N1 H7N9. Clinical analysis of severe avian influenza H7N9 and severe influenza A H1N1 DOI 10.16047/j.cnki.cn14-1300/r.2018.04.004 2018-05-08 11:56:58 http://kns.cnki.net/kcms/detail/14.1300.r.20180508.1156.008.html 254 Proceeding of Clinical Medicine Apr. 2018 Vol 27 No. 4 J. 2012 13 2

More information

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the

As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the 3 RESULTS As outlined under External contributions (see appendix 7.1), the group of Prof. Gröne at the DKFZ in Heidelberg (Dept. of Cellular and Molecular pathology) contributed to this work by performing

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

Research Article Intermittent High Glucose Exacerbates A-FABP Activation and Inflammatory Response through TLR4-JNK Signaling in THP-1 Cells

Research Article Intermittent High Glucose Exacerbates A-FABP Activation and Inflammatory Response through TLR4-JNK Signaling in THP-1 Cells Journal of Immunology Research, Article ID 1319272, 9 pages https://doi.org/1.1155/218/1319272 Research Article Intermittent High Glucose Exacerbates A-FABP Activation and Inflammatory Response through

More information

Other Health Benefits of Flax

Other Health Benefits of Flax Chapter 7 Other Health Benefits of Flax Previous chapters examined the benefits of flax and its key constituents the lignan secoisolariciresinol diglucoside (SDG), dietary fibre and alpha-linolenic acid

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

More information