Figure S1. Figure S2. Figure S3.
|
|
- Patricia Perry
- 5 years ago
- Views:
Transcription
1 Figure S1. PSA expression in VCaP was not dependent on the residual androgens in hormonedepleted medium. VCaP or LNCaP cells grown in CSS medium or SFM (serum-free medium) were treated with ethanol (-) or 10 nm DHT (+) for 24h and then immunoblotted for PSA and tubulin (loading control). Figure S2. Abiraterone decreased nuclear expression of AR in VCaP cells. VCaP cells grown in CSS medium were treated with 0 or 10 nm DHT with or without 2 M abiraterone and then analyzed by immunofluorescence with an AR antibody. The photos were taken under 63X objective lens of confocal microscope. DAPI was used to stain nucleus. Figure S3. Progesterone induced PSA expression was blocked by abiraterone. VCaP cells grown in CSS medium were treated with 0, 0.1, or 1 nm progesterone with or without 2 M abiraterone and then immunoblotted.
2 Figure S4. Abiraterone suppressed AR activity in recurrent VCaP xenografts. Tissue samples of recurrent VCaP xenogafts were taken from each mouse pre-treatment and post-treatment with abiraterone (0.5 mg/2d for 8 days) and then subjected to immunohistochemistry using PSA, ERG, AR, or Ki67 antibodies. Representative sections from tumor in one mouse pre- and post treatment are shown. 2
3 Figure S5. Tumor growth was decreased by abiraterone. The Ki67 positive cells pre- and post therapy from tumors in each mouse were counted (average of 10 randomly selected high power fields). Figure S6. Androstenedione induced PSA expression was decreased by indomethacin. VCaP cells in CSS were treated with 0, 1, 10, or 100 nm androstenedione with or without 20 M indomethacin for 24h and then immunoblotted. Figure S7. AR activity was restored in the relapsed VCaP tumors. Sequential tumor samples were taken from the same mouse with a VCaP xenograft right before castration (D), 4 days after castration (C), or at relapse (R) and then subjected to RT-PCR to measure mrna of PSA, TMPRSS2, ERG, or AR. 3
4 Figure S8. AKR1C3 expression was increased in the relapsed VCaP tumors. Sequential tumor samples were taken from the same mouse with a VCaP xenograft right before castration (D), 4 days after castration (C), or at relapse (R) and then subjected to immunohistochemistry using AKR1C3 antibody. Figure S9. Indomethacin did not suppress AR mrna in VCaP cells. VCaP cells grown in CSS medium were treated with 0, 20, or 40 M indomethacin for 24h and then subjected to RT-PCR to measure AR expression. 4
5 Figure S10. AKR1C3 inhibitor indomethacin suppressed AR activity in recurrent VCaP xenografts. Sequential tumor samples were taken from the same mouse with a VCaP xenograft at pre-castration, at relapse, or at relapse after treatment with indomethacin (0.25mg/d) for 2 weeks and then subjected to immunohistochemistry using PSA, ERG, AR, or Ki67 antibody. 5
6 Figure S11. Tumor growth was decreased by indomethacin. The Ki67 positive cells were counted (average of 10 randomly selected high power fields). Significant difference pre- and post-indomethacin (Indo) is indicated. Figure S12. VCaP and VCS2 express higher CYP17A1 protein. Immunoblotting was performed on LNCaP, C4-2, VCaP, or VCS2 cells to measure CYP17A1 expression. CYP17A1 antibody was purchased from Abcam. Figure S13. LNCaP and C4-2 cells express higher CYP11A1 protein. Immunoblotting was performed on LNCaP, C4-2, or VCaP cells to measure CYP11A1 expression. CYP11A1 antibody was purchased from Abcam. 6
7 Figure S14. AR regained nuclear staining in the abiraterone-resistant VCaP xenogarft tumor. Tumor samples were taken from the same mouse with a VCaP CRPC xenograft at preabiraterone, or at abiraterone-resistant stages. Immunohistochemistry was performed using AR antibody. Figure S15. CYP17A1 and CYP11A1 expression in metastatic CRPC. Expression of CYP17A1 and CYP11A1 were compared in relapsed VCaP xenograft and 29 CRPC samples assayed by quantitative real time RT-PCR, with 18S RNA amplified as an internal control. 7
8 Figure S16. The sequence of primers that were used for real-time RT-PCR or PCR. 8
ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer
ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer Nupam Mahajan Moffitt Cancer Center Learners Objectives How Androgen Receptor (AR) signaling is accomplished in absence of androgen What are
More informationinjected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body
SUPPLEMENTAL FIGURE LEGENDS Figure S1: Generation of ENZR Xenografts and Cell Lines: (A) 1x10 6 LNCaP cells in matrigel were injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP
More informationERG induces androgen receptor-mediated regulation of SOX9 in prostate cancer
Research article ERG induces androgen receptor-mediated regulation of SOX9 in prostate cancer Changmeng Cai, 1 Hongyun Wang, 1 Housheng Hansen He, 2,3 Sen Chen, 1 Lingfeng He, 1 Fen Ma, 1 Lorelei Mucci,
More informationMonoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance
Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Tanaka H, Kono E, Tran CP, Miyazaki H, Yamashiro J, Shimomura T, Ladan F, Wada R, Huang
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationCastration resistance in human prostate cancer is conferred by a frequently occurring androgen receptor splice variant
Research article Castration resistance in human prostate cancer is conferred by a frequently occurring androgen receptor splice variant Shihua Sun, 1 Cynthia C.T. Sprenger, 1 Robert L. Vessella, 2,3 Kathleen
More informationAP VP DLP H&E. p-akt DLP
A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy
More informationSUPPLEMENTARY FIGURES AND TABLES
SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non
More informationCONTRACTING ORGANIZATION: University of Mississippi Medical Center Jackson, MS 39216
AD Award Number: W81XWH-12-1-0201 TITLE: Role of long non-coding RNAs in prostate cancer PRINCIPAL INVESTIGATOR: Yin-Yuan Mo CONTRACTING ORGANIZATION: University of Mississippi Medical Center Jackson,
More informationTITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer
AD Award Number: TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, PhD CONTRACTING ORGANIZATION: University
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationOvercoming Autophagy to Induce Apoptosis in Castration-Resistant Prostate
AWARD NUMBER: W81XWH-12-1-0529 TITLE: Cancer Overcoming Autophagy to Induce Apoptosis in Castration-Resistant Prostate PRINCIPAL INVESTIGATOR: Christopher Evans, M.D. CONTRACTING ORGANIZATION: University
More informationTITLE: Uncarboxylated Osteocalcin and Gprc6a Axis Produce Intratumoral Androgens in Castration- Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0037 TITLE: Uncarboxylated Osteocalcin and Gprc6a Axis Produce Intratumoral Androgens in Castration- Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Sreenivasa R. Chinni, Ph.D
More informationTITLE: Uncarboxylated Osteocalcin and Gprc6a Axis Produce Intratumoral Androgens in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0037 TITLE: Uncarboxylated Osteocalcin and Gprc6a Axis Produce Intratumoral Androgens in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Sreenivasa R. Chinni, Ph.D
More information(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
More informationSTAMPEDE trial (MRC PR08): Arm J overview. Enzalutamide and abiraterone comparison and trial update
STAMPEDE trial (MRC PR08): Arm J overview Enzalutamide and abiraterone comparison and trial update Arm J Hypotheses and rationale STAMPEDE: Hypothesis Will addition of enzalutamide and abiraterone to standard-of-care
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationNew Treatment Modalities and Clinical Trials for HRPC 계명의대 김천일
New Treatment Modalities and Clinical Trials for HRPC 계명의대 김천일 Castrate-Resistant Prostate Cancer (CRPC) Current standard therapy Androgen receptor (AR) in CRPC New systemic therapies Hormonal therapy
More informationMolecular mechanisms underlying resistance to androgen deprivation therapy in prostate cancer
/, Advance Publications 2016 Molecular mechanisms underlying resistance to androgen deprivation therapy in prostate cancer Kristine M. Wadosky 1 and Shahriar Koochekpour 1,2 1 Department of Cancer Genetics,
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationA first-in-class p300/cbp bromodomain inhibitor for the treatment of prostate cancer and hematologic malignancies
A first-in-class p300/cbp bromodomain inhibitor for the treatment of prostate cancer and hematologic malignancies Neil Pegg, PhD Research Director CellCentric Ltd, Cambridge UK CCS1477 structure removed
More informationUpdates in Prostate Cancer Treatment 2018
Updates in Prostate Cancer Treatment 2018 Mountain States Cancer Conference Elaine T. Lam, MD November 3, 2018 Learning Objectives Understand the difference between hormone sensitive and castration resistant
More informationEffects of Hormonal Withdrawal on Prostate Cancer Progression
Philadelphia College of Osteopathic Medicine DigitalCommons@PCOM PCOM Biomedical Studies Student Scholarship Student Dissertations, Theses and Papers 2016 Effects of Hormonal Withdrawal on Prostate Cancer
More informationCONTRACTING ORGANIZATION: Beth Israel Deaconess Medical Center Boston, MA 02215
AD Award Number: W81XWH-08-1-0414 TITLE: Identification and Targeting of Upstream Tyrosine Kinases Mediating PI3 Kinase Activation in PTEN Deficient Prostate Cancer PRINCIPAL INVESTIGATOR: Steven P. Balk
More informationOutline. Outline. Phillip G. Febbo, MD. Genomic Approaches to Outcome Prediction in Prostate Cancer
Genomic Approaches to Outcome Prediction in Prostate Cancer Phillip G. Febbo, MD Duke Institute for Genome Science and Policy Department of Medicine Department of Molecular Genetics and Microbiology Duke
More informationwww.drpaulmainwaring.com Figure 1 Androgen action Harris W P et al. (2009) Nat Clin Pract Urol doi:10.1038/ncpuro1296 Figure 2 Mechanisms of castration resistance in prostate cancer Harris W P et al. (2009)
More informationTITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,
More informationTITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer
AD Award Number: TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, Ph.D. CONTRACTING ORGANIZATION: The
More informationSupplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or
Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent
More informationSupplementary appendix
Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Teply BA, Wang H, Luber B, et al. Bipolar androgen
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More informationA Forward Look at Options for. In Prostate Cancer
A Forward Look at Options for Prostate Cancer Charles J Ryan, MD Associate Professor of Medicine Helen Diller Family Comprehensive Cancer Center University of California, San Francisco UC 1 SF UC SF Castration
More informationTRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
More informationFigure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h
Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)
More informationAtsushi Mizokami, Eitetsu Koh, Kouji Izumi, Kazutaka Narimoto, Masashi Takeda, Seijiro Honma 1, Jinlu Dai 2, Evan T Keller 2 and Mikio Namiki
Prostate cancer stromal cells and LNCaP cells coordinately activate the androgen receptor through synthesis of testosterone and dihydrotestosterone from dehydroepiandrosterone Atsushi Mizokami, Eitetsu
More informationManagement of Incurable Prostate Cancer in 2014
Management of Incurable Prostate Cancer in 2014 Julie N. Graff, MD, MCR Portland VA Medical Center Assistant Professor of Medicine Knight Cancer Institute, OHSU 2014: Cancer Estimates Stage at Diagnosis
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationSupplemental Table S1
Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected
More informationAndrogen receptor antagonism drives cytochrome P450 17A1 inhibitor efficacy in prostate cancer
Androgen receptor antagonism drives cytochrome P450 17A1 inhibitor efficacy in prostate cancer John D. Norris,, William D. Figg, Donald P. McDonnell J Clin Invest. 2017;127(6):2326-2338. https://doi.org/10.1172/jci87328.
More informationBiologic and Clinical Significance of Androgen Receptor Variants in Castration Resistant Prostate Cancer
Page 1 of 46 Accepted Preprint first posted on 23 May 2014 as Manuscript ERC-13-0470 1 2 3 4 5 6 7 8 9 Biologic and Clinical Significance of Androgen Receptor Variants in Castration Resistant Prostate
More informationCharles B. Huggins. Despite regressions of great magnitude, it is obvious that there are many failures of endocrine therapy to control the disease.
New Concepts in ADT Leonard G. Gomella, MD Chairman, Department of Urology President Society of Urologic Oncology Sidney Kimmel Cancer Center Thomas Jefferson University Hospital Charles B. Huggins Nobel
More informationIκBα mediates prostate cancer cell death induced by combinatorial targeting of the androgen receptor
Carter et al. BMC Cancer (2016) 16:141 DOI 10.1186/s12885-016-2188-2 RESEARCH ARTICLE IκBα mediates prostate cancer cell death induced by combinatorial targeting of the androgen receptor Sarah L. Carter
More informationSupplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
More informationSIMPOSIO. Radioterapia stereotassica e nuovi farmaci nel tumore e della prostata metastatico
SIMPOSIO Radioterapia stereotassica e nuovi farmaci nel tumore e della prostata metastatico Definition of Oligometastatic PCa 1-3 synchronous metastases (bone and/or lymph nodes) 2-5 synchronous metastases
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
More informationSupplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2
Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS
More informationFang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A
A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE
More informationGlucocorticoid Receptor Activity Contributes to Resistance to Androgen-Targeted Therapy in Prostate Cancer
HORM CANC (2014) 5:72 89 DOI 10.1007/s12672-014-0173-2 ORIGINAL PAPER Glucocorticoid Receptor Activity Contributes to Resistance to Androgen-Targeted Therapy in Prostate Cancer Masis Isikbay & Kristen
More informationCells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
More informationSupplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)
Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung
More informationSprouty2 loss-induced IL6 drives castrationresistant prostate cancer through scavenger receptor B1
Research Article Sprouty2 loss-induced IL6 drives castrationresistant prostate cancer through scavenger receptor B1 Rachana Patel 1,*, Janis Fleming 1, Ernest Mui 2, Carolyn Loveridge 2, Peter Repiscak
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationSupplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate
Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate cancer cells. (a) Cell proliferation of BicR cells in
More informationRationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways
Rationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways Brett S Carver, MD Assistant Attending, Department of Surgery/Urology Prostate Cancer Therapeutics: A Changed
More informationSupplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or
Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSupplemental information contains 7 movies and 4 supplemental Figures
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV
More informationClasificación Molecular del Cáncer de Próstata. JM Piulats
Clasificación Molecular del Cáncer de Próstata JM Piulats Introduction The Gleason score is the major method for prostate cancer tissue grading and the most important prognostic factor in this disease.
More informationPCA3 noncoding RNA is involved in the control of prostate-cancer cell survival and modulates androgen receptor signaling
Ferreira et al. BMC Cancer 2012, 12:507 RESEARCH ARTICLE Open Access PCA3 noncoding RNA is involved in the control of prostate-cancer cell survival and modulates androgen receptor signaling Luciana Bueno
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationSupplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated
Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without
More informationGFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin
Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq
More informationSupplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
More informationThe retinoblastoma tumor suppressor controls androgen signaling and human prostate cancer progression
Research article Related Commentary, page 4179 The retinoblastoma tumor suppressor controls androgen signaling and human prostate cancer progression Ankur Sharma, 1 Wen-Shuz Yeow, 1 Adam Ertel, 1 Ilsa
More informationSprouty2 loss induced IL6 drives castration-resistant prostate cancer through scavenger receptor B1
Sprouty2 loss induced IL6 drives castration-resistant prostate cancer through scavenger receptor B1 Rachana Patel, Janis Fleming, Ernest Mui, Carolyn Loveridge, Peter Repiscak, Arnaud Blomme, Victoria
More informationInstitut Gustave Roussy, University of Paris Sud, Villejuif, France. Queen Elizabeth Hospital, Birmingham, United Kingdom
An open-label, phase I/II safety, pharmacokinetic, and proof-of concept study of ODM-201 in patients with progressive metastatic castration-resistant prostate cancer (CRPC) K Fizazi 1, P Bono 2, R J Jones
More informationSupplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi
More informationAndrogen-responsive long noncoding RNA CTBP1-AS promotes prostate cancer
The EMBO Journal (2013) 32, 1665 1680 www.embojournal.org Androgen-responsive long noncoding RNA CTBP1-AS promotes prostate cancer THE EMBO JOURNAL Ken-ichi Takayama 1,2,3, Kuniko Horie-Inoue 3, Shintaro
More informationCellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA
Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization
More informationNF-kB and Androgen Receptor Variant Expression Correlate With Human BPH Progression
NF-kB and Androgen Receptor Variant Expression Correlate With Human BPH Progression David C. Austin, 1 Douglas W. Strand, 2 * Harold L. Love, 2 Omar E. Franco, 3 Alex Jang, 2 Magdalena M. Grabowska, 2
More informationAndrogens and prostate cancer: insights from abiraterone acetate and other novel agents
Androgens and prostate cancer: insights from abiraterone acetate and other novel agents Ian Davis Ludwig Institute for Cancer Research Austin Health, Melbourne, Australia Supported in part by an Australian
More informationSession 4 Chemotherapy for castration refractory prostate cancer First and second- line chemotherapy
Session 4 Chemotherapy for castration refractory prostate cancer First and second- line chemotherapy October- 2015 ESMO 2004 October- 2015 Fyraftensmøde 2 2010 October- 2015 Fyraftensmøde 3 SWOG 9916 OS
More informationCONTRACTING ORGANIZATION: Sloan Kettering Institute for Cancer Research New York, NY 10065
AWARD NUMBER: W81XWH-15-1-0277 TITLE: ERF is a Potential ERK-Modulated Tumor Suppressor in Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Rohit Bose CONTRACTING ORGANIZATION: Sloan Kettering Institute for
More informationDownregulation of angiotensin type 1 receptor and nuclear factor-κb. by sirtuin 1 contributes to renoprotection in unilateral ureteral
Supplementary Information Downregulation of angiotensin type 1 receptor and nuclear factor-κb by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction Shao-Yu Yang 1,2, Shuei-Liong
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
More informationEffec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers
Effec
More informationManagement of Prostate Cancer
Management of Prostate Cancer An ESMO Perspective Alan Horwich Conflicts of Interest Disclosure Alan Horwich I have no personal conflicts of interest relating to prostate cancer. European Incidence and
More informationCase Study: Protein Degradation Approaches at Arvinas
The PROTAC Company Pioneering Protein Degradation as a New Therapeutic Modality Case Study: Protein Degradation Approaches at Arvinas Targeted Protein Degradation Summit October 25, 2018 Ian Taylor, PhD
More informationHormone sensitive prostate cancer To add abiraterone or docetaxel? Dr Lisa Pickering
> Hormone sensitive prostate cancer To add abiraterone or docetaxel? Dr Lisa Pickering Disclosures Institutional Research Support/P.I. Employee Consultant Major Stockholder Speakers Bureau Honoraria Scientific
More informationAdvanced Prostate Cancer
Advanced Prostate Cancer January 13, 2017 Sindu Kanjeekal MD FRCPC Medical Oncology and Hematology Regional Systemic Quality Lead Erie St Clair Adjunct Professor Schulich School of Medicine and University
More informationLessons from in-vivo models of castration-resistant prostate cancer
REVIEW C URRENT OPINION Lessons from in-vivo models of castration-resistant prostate cancer Dong Lin a,b, Peter W. Gout b, and Yuzhuo Wang a,b,c Purpose of review Although the treatment of castration-resistant
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationCONTRACTING ORGANIZATION: Fred Hutchinson Cancer Research Center
AD Award Number: W81XWH-10-1-0771 TITLE: Characterizing and Targeting Androgen Receptor Pathway-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Peter S. Nelson, MD CONTRACTING ORGANIZATION: Fred Hutchinson
More informationAndrogen synthesis inhibitors in the treatment of castration resistant prostate cancer
(2014) 16, 387 400 2014 AJA, SIMM & SJTU. All rights reserved 1008-682X www.asiaandro.com; www.ajandrology.com Prostate Cancer Open Access INVITED REVIEW Androgen synthesis inhibitors in the treatment
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationCONTRACTING ORGANIZATION: University of Michigan Ann Arbor, MI 48109
AD Award Number: W81X-WH-05-1-0105 TITLE: Differential Mechanisms of Androgen Resistance PRINCIPAL INVESTIGATOR: Orla A. O Mahony, Ph.D. CONTRACTING ORGANIZATION: University of Michigan Ann Arbor, MI 48109
More informationPREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
Page 1 09/10/2013 AD Award Number: W81XWH-12-1-0453 TITLE: The cytoplasm translocation of the androgen receptor cofactor p44 as a target for prostate cancer treatment PRINCIPAL INVESTIGATOR: Zhengxin Wang
More informationDiagnostic test Suggested website label Description Hospitals available
Diagnostic test Suggested website label Description Hospitals available Abbott Molecular Inc, PATHVYSION HER-2 DNA Probe Kit (FISH) PathVysion kit A diagnostic tool used to determine whether a particular
More informationFig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.
T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationSocial deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
More informationMII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA
A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10
More informationOmaha, NE PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AWARD NUMBER: W81XWH-13-1-0075 TITLE: LincRNAs and AR Reactivation after Androgen Deprivation in Prostate Cancer Cells PRINCIPAL INVESTIGATOR: Xian-Ming Chen, MD CONTRACTING ORGANIZATION: Creighton University
More informationMANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function
MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen
More informationAnti-Androgen Therapies for Prostate Cancer: A Focused Review
Anti-Androgen Therapies for Prostate Cancer: A Focused Review Nischala Ammannagari, MD, and Saby George, MD, FACP Abstract Among men in the United States, prostate cancer is the most common malignancy
More informationEvaluation of Insulin-like Growth Factor Receptor 1 Inhibition as a Treatment for Prostate Cancer: Preclinical Efficacy and Resistance
University of Miami Scholarly Repository Open Access Dissertations Electronic Theses and Dissertations 2013-12-11 Evaluation of Insulin-like Growth Factor Receptor 1 Inhibition as a Treatment for Prostate
More information