Figure S1. Figure S2. Figure S3.

Size: px
Start display at page:

Download "Figure S1. Figure S2. Figure S3."

Transcription

1 Figure S1. PSA expression in VCaP was not dependent on the residual androgens in hormonedepleted medium. VCaP or LNCaP cells grown in CSS medium or SFM (serum-free medium) were treated with ethanol (-) or 10 nm DHT (+) for 24h and then immunoblotted for PSA and tubulin (loading control). Figure S2. Abiraterone decreased nuclear expression of AR in VCaP cells. VCaP cells grown in CSS medium were treated with 0 or 10 nm DHT with or without 2 M abiraterone and then analyzed by immunofluorescence with an AR antibody. The photos were taken under 63X objective lens of confocal microscope. DAPI was used to stain nucleus. Figure S3. Progesterone induced PSA expression was blocked by abiraterone. VCaP cells grown in CSS medium were treated with 0, 0.1, or 1 nm progesterone with or without 2 M abiraterone and then immunoblotted.

2 Figure S4. Abiraterone suppressed AR activity in recurrent VCaP xenografts. Tissue samples of recurrent VCaP xenogafts were taken from each mouse pre-treatment and post-treatment with abiraterone (0.5 mg/2d for 8 days) and then subjected to immunohistochemistry using PSA, ERG, AR, or Ki67 antibodies. Representative sections from tumor in one mouse pre- and post treatment are shown. 2

3 Figure S5. Tumor growth was decreased by abiraterone. The Ki67 positive cells pre- and post therapy from tumors in each mouse were counted (average of 10 randomly selected high power fields). Figure S6. Androstenedione induced PSA expression was decreased by indomethacin. VCaP cells in CSS were treated with 0, 1, 10, or 100 nm androstenedione with or without 20 M indomethacin for 24h and then immunoblotted. Figure S7. AR activity was restored in the relapsed VCaP tumors. Sequential tumor samples were taken from the same mouse with a VCaP xenograft right before castration (D), 4 days after castration (C), or at relapse (R) and then subjected to RT-PCR to measure mrna of PSA, TMPRSS2, ERG, or AR. 3

4 Figure S8. AKR1C3 expression was increased in the relapsed VCaP tumors. Sequential tumor samples were taken from the same mouse with a VCaP xenograft right before castration (D), 4 days after castration (C), or at relapse (R) and then subjected to immunohistochemistry using AKR1C3 antibody. Figure S9. Indomethacin did not suppress AR mrna in VCaP cells. VCaP cells grown in CSS medium were treated with 0, 20, or 40 M indomethacin for 24h and then subjected to RT-PCR to measure AR expression. 4

5 Figure S10. AKR1C3 inhibitor indomethacin suppressed AR activity in recurrent VCaP xenografts. Sequential tumor samples were taken from the same mouse with a VCaP xenograft at pre-castration, at relapse, or at relapse after treatment with indomethacin (0.25mg/d) for 2 weeks and then subjected to immunohistochemistry using PSA, ERG, AR, or Ki67 antibody. 5

6 Figure S11. Tumor growth was decreased by indomethacin. The Ki67 positive cells were counted (average of 10 randomly selected high power fields). Significant difference pre- and post-indomethacin (Indo) is indicated. Figure S12. VCaP and VCS2 express higher CYP17A1 protein. Immunoblotting was performed on LNCaP, C4-2, VCaP, or VCS2 cells to measure CYP17A1 expression. CYP17A1 antibody was purchased from Abcam. Figure S13. LNCaP and C4-2 cells express higher CYP11A1 protein. Immunoblotting was performed on LNCaP, C4-2, or VCaP cells to measure CYP11A1 expression. CYP11A1 antibody was purchased from Abcam. 6

7 Figure S14. AR regained nuclear staining in the abiraterone-resistant VCaP xenogarft tumor. Tumor samples were taken from the same mouse with a VCaP CRPC xenograft at preabiraterone, or at abiraterone-resistant stages. Immunohistochemistry was performed using AR antibody. Figure S15. CYP17A1 and CYP11A1 expression in metastatic CRPC. Expression of CYP17A1 and CYP11A1 were compared in relapsed VCaP xenograft and 29 CRPC samples assayed by quantitative real time RT-PCR, with 18S RNA amplified as an internal control. 7

8 Figure S16. The sequence of primers that were used for real-time RT-PCR or PCR. 8

ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer

ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer ACK1 Tyrosine Kinases: A Critical Regulator of Prostate Cancer Nupam Mahajan Moffitt Cancer Center Learners Objectives How Androgen Receptor (AR) signaling is accomplished in absence of androgen What are

More information

injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body

injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP SQ) and body SUPPLEMENTAL FIGURE LEGENDS Figure S1: Generation of ENZR Xenografts and Cell Lines: (A) 1x10 6 LNCaP cells in matrigel were injected subcutaneously into flanks of 6-8 week old athymic male nude mice (LNCaP

More information

ERG induces androgen receptor-mediated regulation of SOX9 in prostate cancer

ERG induces androgen receptor-mediated regulation of SOX9 in prostate cancer Research article ERG induces androgen receptor-mediated regulation of SOX9 in prostate cancer Changmeng Cai, 1 Hongyun Wang, 1 Housheng Hansen He, 2,3 Sen Chen, 1 Lingfeng He, 1 Fen Ma, 1 Lorelei Mucci,

More information

Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance

Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Monoclonal antibody targeting of N-cadherin inhibits prostate cancer growth, metastasis and castration resistance Tanaka H, Kono E, Tran CP, Miyazaki H, Yamashiro J, Shimomura T, Ladan F, Wada R, Huang

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Castration resistance in human prostate cancer is conferred by a frequently occurring androgen receptor splice variant

Castration resistance in human prostate cancer is conferred by a frequently occurring androgen receptor splice variant Research article Castration resistance in human prostate cancer is conferred by a frequently occurring androgen receptor splice variant Shihua Sun, 1 Cynthia C.T. Sprenger, 1 Robert L. Vessella, 2,3 Kathleen

More information

AP VP DLP H&E. p-akt DLP

AP VP DLP H&E. p-akt DLP A B AP VP DLP H&E AP AP VP DLP p-akt wild-type prostate PTEN-null prostate Supplementary Fig. 1. Targeted deletion of PTEN in prostate epithelium resulted in HG-PIN in all three lobes. (A) The anatomy

More information

SUPPLEMENTARY FIGURES AND TABLES

SUPPLEMENTARY FIGURES AND TABLES SUPPLEMENTARY FIGURES AND TABLES Supplementary Figure S1: CaSR expression in neuroblastoma models. A. Proteins were isolated from three neuroblastoma cell lines and from the liver metastasis of a MYCN-non

More information

CONTRACTING ORGANIZATION: University of Mississippi Medical Center Jackson, MS 39216

CONTRACTING ORGANIZATION: University of Mississippi Medical Center Jackson, MS 39216 AD Award Number: W81XWH-12-1-0201 TITLE: Role of long non-coding RNAs in prostate cancer PRINCIPAL INVESTIGATOR: Yin-Yuan Mo CONTRACTING ORGANIZATION: University of Mississippi Medical Center Jackson,

More information

TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer

TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer AD Award Number: TITLE: Investigation of the Akt/Pkb Kinase in the Development of Hormone- Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, PhD CONTRACTING ORGANIZATION: University

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Overcoming Autophagy to Induce Apoptosis in Castration-Resistant Prostate

Overcoming Autophagy to Induce Apoptosis in Castration-Resistant Prostate AWARD NUMBER: W81XWH-12-1-0529 TITLE: Cancer Overcoming Autophagy to Induce Apoptosis in Castration-Resistant Prostate PRINCIPAL INVESTIGATOR: Christopher Evans, M.D. CONTRACTING ORGANIZATION: University

More information

TITLE: Uncarboxylated Osteocalcin and Gprc6a Axis Produce Intratumoral Androgens in Castration- Resistant Prostate Cancer

TITLE: Uncarboxylated Osteocalcin and Gprc6a Axis Produce Intratumoral Androgens in Castration- Resistant Prostate Cancer AWARD NUMBER: W81XWH-14-1-0037 TITLE: Uncarboxylated Osteocalcin and Gprc6a Axis Produce Intratumoral Androgens in Castration- Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Sreenivasa R. Chinni, Ph.D

More information

TITLE: Uncarboxylated Osteocalcin and Gprc6a Axis Produce Intratumoral Androgens in Castration-Resistant Prostate Cancer

TITLE: Uncarboxylated Osteocalcin and Gprc6a Axis Produce Intratumoral Androgens in Castration-Resistant Prostate Cancer AWARD NUMBER: W81XWH-14-1-0037 TITLE: Uncarboxylated Osteocalcin and Gprc6a Axis Produce Intratumoral Androgens in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Sreenivasa R. Chinni, Ph.D

More information

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and

More information

STAMPEDE trial (MRC PR08): Arm J overview. Enzalutamide and abiraterone comparison and trial update

STAMPEDE trial (MRC PR08): Arm J overview. Enzalutamide and abiraterone comparison and trial update STAMPEDE trial (MRC PR08): Arm J overview Enzalutamide and abiraterone comparison and trial update Arm J Hypotheses and rationale STAMPEDE: Hypothesis Will addition of enzalutamide and abiraterone to standard-of-care

More information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of

More information

New Treatment Modalities and Clinical Trials for HRPC 계명의대 김천일

New Treatment Modalities and Clinical Trials for HRPC 계명의대 김천일 New Treatment Modalities and Clinical Trials for HRPC 계명의대 김천일 Castrate-Resistant Prostate Cancer (CRPC) Current standard therapy Androgen receptor (AR) in CRPC New systemic therapies Hormonal therapy

More information

Molecular mechanisms underlying resistance to androgen deprivation therapy in prostate cancer

Molecular mechanisms underlying resistance to androgen deprivation therapy in prostate cancer /, Advance Publications 2016 Molecular mechanisms underlying resistance to androgen deprivation therapy in prostate cancer Kristine M. Wadosky 1 and Shahriar Koochekpour 1,2 1 Department of Cancer Genetics,

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

A first-in-class p300/cbp bromodomain inhibitor for the treatment of prostate cancer and hematologic malignancies

A first-in-class p300/cbp bromodomain inhibitor for the treatment of prostate cancer and hematologic malignancies A first-in-class p300/cbp bromodomain inhibitor for the treatment of prostate cancer and hematologic malignancies Neil Pegg, PhD Research Director CellCentric Ltd, Cambridge UK CCS1477 structure removed

More information

Updates in Prostate Cancer Treatment 2018

Updates in Prostate Cancer Treatment 2018 Updates in Prostate Cancer Treatment 2018 Mountain States Cancer Conference Elaine T. Lam, MD November 3, 2018 Learning Objectives Understand the difference between hormone sensitive and castration resistant

More information

Effects of Hormonal Withdrawal on Prostate Cancer Progression

Effects of Hormonal Withdrawal on Prostate Cancer Progression Philadelphia College of Osteopathic Medicine DigitalCommons@PCOM PCOM Biomedical Studies Student Scholarship Student Dissertations, Theses and Papers 2016 Effects of Hormonal Withdrawal on Prostate Cancer

More information

CONTRACTING ORGANIZATION: Beth Israel Deaconess Medical Center Boston, MA 02215

CONTRACTING ORGANIZATION: Beth Israel Deaconess Medical Center Boston, MA 02215 AD Award Number: W81XWH-08-1-0414 TITLE: Identification and Targeting of Upstream Tyrosine Kinases Mediating PI3 Kinase Activation in PTEN Deficient Prostate Cancer PRINCIPAL INVESTIGATOR: Steven P. Balk

More information

Outline. Outline. Phillip G. Febbo, MD. Genomic Approaches to Outcome Prediction in Prostate Cancer

Outline. Outline. Phillip G. Febbo, MD. Genomic Approaches to Outcome Prediction in Prostate Cancer Genomic Approaches to Outcome Prediction in Prostate Cancer Phillip G. Febbo, MD Duke Institute for Genome Science and Policy Department of Medicine Department of Molecular Genetics and Microbiology Duke

More information

www.drpaulmainwaring.com Figure 1 Androgen action Harris W P et al. (2009) Nat Clin Pract Urol doi:10.1038/ncpuro1296 Figure 2 Mechanisms of castration resistance in prostate cancer Harris W P et al. (2009)

More information

TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer

TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,

More information

TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer

TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer AD Award Number: TITLE: Investigation of the Akt/PKB Kinase in the Development of Hormone-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Linda A. degraffenried, Ph.D. CONTRACTING ORGANIZATION: The

More information

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or

Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or Supplementary Figure 1. Characterization of ALDH-positive cell population in MCF-7 cells. (a) Expression level of stem cell markers in MCF-7 cells or ALDH-positive cell population by qpcr. Data represent

More information

Supplementary appendix

Supplementary appendix Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Teply BA, Wang H, Luber B, et al. Bipolar androgen

More information

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from

More information

A Forward Look at Options for. In Prostate Cancer

A Forward Look at Options for. In Prostate Cancer A Forward Look at Options for Prostate Cancer Charles J Ryan, MD Associate Professor of Medicine Helen Diller Family Comprehensive Cancer Center University of California, San Francisco UC 1 SF UC SF Castration

More information

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya

More information

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h

Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)

More information

Atsushi Mizokami, Eitetsu Koh, Kouji Izumi, Kazutaka Narimoto, Masashi Takeda, Seijiro Honma 1, Jinlu Dai 2, Evan T Keller 2 and Mikio Namiki

Atsushi Mizokami, Eitetsu Koh, Kouji Izumi, Kazutaka Narimoto, Masashi Takeda, Seijiro Honma 1, Jinlu Dai 2, Evan T Keller 2 and Mikio Namiki Prostate cancer stromal cells and LNCaP cells coordinately activate the androgen receptor through synthesis of testosterone and dihydrotestosterone from dehydroepiandrosterone Atsushi Mizokami, Eitetsu

More information

Management of Incurable Prostate Cancer in 2014

Management of Incurable Prostate Cancer in 2014 Management of Incurable Prostate Cancer in 2014 Julie N. Graff, MD, MCR Portland VA Medical Center Assistant Professor of Medicine Knight Cancer Institute, OHSU 2014: Cancer Estimates Stage at Diagnosis

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Supplemental Table S1

Supplemental Table S1 Supplemental Table S. Tumorigenicity and metastatic potential of 44SQ cell subpopulations a Tumorigenicity b Average tumor volume (mm ) c Lung metastasis d CD high /4 8. 8/ CD low /4 6./ a Mice were injected

More information

Androgen receptor antagonism drives cytochrome P450 17A1 inhibitor efficacy in prostate cancer

Androgen receptor antagonism drives cytochrome P450 17A1 inhibitor efficacy in prostate cancer Androgen receptor antagonism drives cytochrome P450 17A1 inhibitor efficacy in prostate cancer John D. Norris,, William D. Figg, Donald P. McDonnell J Clin Invest. 2017;127(6):2326-2338. https://doi.org/10.1172/jci87328.

More information

Biologic and Clinical Significance of Androgen Receptor Variants in Castration Resistant Prostate Cancer

Biologic and Clinical Significance of Androgen Receptor Variants in Castration Resistant Prostate Cancer Page 1 of 46 Accepted Preprint first posted on 23 May 2014 as Manuscript ERC-13-0470 1 2 3 4 5 6 7 8 9 Biologic and Clinical Significance of Androgen Receptor Variants in Castration Resistant Prostate

More information

Charles B. Huggins. Despite regressions of great magnitude, it is obvious that there are many failures of endocrine therapy to control the disease.

Charles B. Huggins. Despite regressions of great magnitude, it is obvious that there are many failures of endocrine therapy to control the disease. New Concepts in ADT Leonard G. Gomella, MD Chairman, Department of Urology President Society of Urologic Oncology Sidney Kimmel Cancer Center Thomas Jefferson University Hospital Charles B. Huggins Nobel

More information

IκBα mediates prostate cancer cell death induced by combinatorial targeting of the androgen receptor

IκBα mediates prostate cancer cell death induced by combinatorial targeting of the androgen receptor Carter et al. BMC Cancer (2016) 16:141 DOI 10.1186/s12885-016-2188-2 RESEARCH ARTICLE IκBα mediates prostate cancer cell death induced by combinatorial targeting of the androgen receptor Sarah L. Carter

More information

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)

Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated

More information

SIMPOSIO. Radioterapia stereotassica e nuovi farmaci nel tumore e della prostata metastatico

SIMPOSIO. Radioterapia stereotassica e nuovi farmaci nel tumore e della prostata metastatico SIMPOSIO Radioterapia stereotassica e nuovi farmaci nel tumore e della prostata metastatico Definition of Oligometastatic PCa 1-3 synchronous metastases (bone and/or lymph nodes) 2-5 synchronous metastases

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2

Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 Supplementary Fig. 1: ATM is phosphorylated in HER2 breast cancer cell lines. (A) ATM is phosphorylated in SKBR3 cells depending on ATM and HER2 activity. Upper panel: Representative histograms for FACS

More information

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A

Fang et al. NMuMG. PyVmT unstained Anti-CCR2-PE MDA-MB MCF MCF10A A NMuMG PyVmT 16.5+.5 47.+7.2 Fang et al. unstained Anti-CCR2-PE 4T1 Control 37.6+6.3 56.1+.65 MCF1A 16.1+3. MCF-7 3.1+5.4 MDA-M-231 42.1+5.5 unstained Secondary antibody only Anti-CCR2 SUPPLEMENTAL FIGURE

More information

Glucocorticoid Receptor Activity Contributes to Resistance to Androgen-Targeted Therapy in Prostate Cancer

Glucocorticoid Receptor Activity Contributes to Resistance to Androgen-Targeted Therapy in Prostate Cancer HORM CANC (2014) 5:72 89 DOI 10.1007/s12672-014-0173-2 ORIGINAL PAPER Glucocorticoid Receptor Activity Contributes to Resistance to Androgen-Targeted Therapy in Prostate Cancer Masis Isikbay & Kristen

More information

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained

More information

Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing)

Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) Supplementary Figure 1. Identification of tumorous sphere-forming CSCs and CAF feeder cells. The LEAP (Laser-Enabled Analysis and Processing) platform with laser manipulation to efficiently purify lung

More information

Sprouty2 loss-induced IL6 drives castrationresistant prostate cancer through scavenger receptor B1

Sprouty2 loss-induced IL6 drives castrationresistant prostate cancer through scavenger receptor B1 Research Article Sprouty2 loss-induced IL6 drives castrationresistant prostate cancer through scavenger receptor B1 Rachana Patel 1,*, Janis Fleming 1, Ernest Mui 2, Carolyn Loveridge 2, Peter Repiscak

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate

Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate Supplementary Figure 1. HeliScope CAGE revealed androgen-regulated signaling and differentially regulated promoters in hormone-refractory prostate cancer cells. (a) Cell proliferation of BicR cells in

More information

Rationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways

Rationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways Rationale Design of Combination Therapy in Prostate Cancer: Targeting the AR and PI3K pathways Brett S Carver, MD Assistant Attending, Department of Surgery/Urology Prostate Cancer Therapeutics: A Changed

More information

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or 3xflag-CagA expression vector were wounded using a pipette

More information

T H E J O U R N A L O F C E L L B I O L O G Y

T H E J O U R N A L O F C E L L B I O L O G Y T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Krenn et al., http://www.jcb.org/cgi/content/full/jcb.201110013/dc1 Figure S1. Levels of expressed proteins and demonstration that C-terminal

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Supplemental information contains 7 movies and 4 supplemental Figures

Supplemental information contains 7 movies and 4 supplemental Figures 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV

More information

Clasificación Molecular del Cáncer de Próstata. JM Piulats

Clasificación Molecular del Cáncer de Próstata. JM Piulats Clasificación Molecular del Cáncer de Próstata JM Piulats Introduction The Gleason score is the major method for prostate cancer tissue grading and the most important prognostic factor in this disease.

More information

PCA3 noncoding RNA is involved in the control of prostate-cancer cell survival and modulates androgen receptor signaling

PCA3 noncoding RNA is involved in the control of prostate-cancer cell survival and modulates androgen receptor signaling Ferreira et al. BMC Cancer 2012, 12:507 RESEARCH ARTICLE Open Access PCA3 noncoding RNA is involved in the control of prostate-cancer cell survival and modulates androgen receptor signaling Luciana Bueno

More information

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using

RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.

More information

Plasma exposure levels from individual mice 4 hours post IP administration at the

Plasma exposure levels from individual mice 4 hours post IP administration at the Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent

More information

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated

Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated Supplementary Figure 1 Transcription assay of nine ABA-responsive PP2C genes. Transcription assay of nine ABA-responsive PP2C genes. Total RNA was isolated from 7 day-old seedlings treated with or without

More information

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin

GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin. GFP-LC3 +/+ CLU -/- kda CLU GFP. Actin Supplementary Fig. 1 a CQ treatment ScrB OGX11 MG132 I II AZD5363 I II b GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin ctrl CQ GFP / / GFP / / GFP / / GFP / / GFP GFP Actin Actin rapamycin rapamycincq

More information

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses

Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),

More information

The retinoblastoma tumor suppressor controls androgen signaling and human prostate cancer progression

The retinoblastoma tumor suppressor controls androgen signaling and human prostate cancer progression Research article Related Commentary, page 4179 The retinoblastoma tumor suppressor controls androgen signaling and human prostate cancer progression Ankur Sharma, 1 Wen-Shuz Yeow, 1 Adam Ertel, 1 Ilsa

More information

Sprouty2 loss induced IL6 drives castration-resistant prostate cancer through scavenger receptor B1

Sprouty2 loss induced IL6 drives castration-resistant prostate cancer through scavenger receptor B1 Sprouty2 loss induced IL6 drives castration-resistant prostate cancer through scavenger receptor B1 Rachana Patel, Janis Fleming, Ernest Mui, Carolyn Loveridge, Peter Repiscak, Arnaud Blomme, Victoria

More information

Institut Gustave Roussy, University of Paris Sud, Villejuif, France. Queen Elizabeth Hospital, Birmingham, United Kingdom

Institut Gustave Roussy, University of Paris Sud, Villejuif, France. Queen Elizabeth Hospital, Birmingham, United Kingdom An open-label, phase I/II safety, pharmacokinetic, and proof-of concept study of ODM-201 in patients with progressive metastatic castration-resistant prostate cancer (CRPC) K Fizazi 1, P Bono 2, R J Jones

More information

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC

Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete

More information

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi Masuda et al. Supplementary information for ANGPTL2 increases bone metastasis of breast cancer cells through enhancing CXCR4 signaling Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

More information

Androgen-responsive long noncoding RNA CTBP1-AS promotes prostate cancer

Androgen-responsive long noncoding RNA CTBP1-AS promotes prostate cancer The EMBO Journal (2013) 32, 1665 1680 www.embojournal.org Androgen-responsive long noncoding RNA CTBP1-AS promotes prostate cancer THE EMBO JOURNAL Ken-ichi Takayama 1,2,3, Kuniko Horie-Inoue 3, Shintaro

More information

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA

Cellecta Overview. Started Operations in 2007 Headquarters: Mountain View, CA Cellecta Overview Started Operations in 2007 Headquarters: Mountain View, CA Focus: Development of flexible, scalable, and broadly parallel genetic screening assays to expedite the discovery and characterization

More information

NF-kB and Androgen Receptor Variant Expression Correlate With Human BPH Progression

NF-kB and Androgen Receptor Variant Expression Correlate With Human BPH Progression NF-kB and Androgen Receptor Variant Expression Correlate With Human BPH Progression David C. Austin, 1 Douglas W. Strand, 2 * Harold L. Love, 2 Omar E. Franco, 3 Alex Jang, 2 Magdalena M. Grabowska, 2

More information

Androgens and prostate cancer: insights from abiraterone acetate and other novel agents

Androgens and prostate cancer: insights from abiraterone acetate and other novel agents Androgens and prostate cancer: insights from abiraterone acetate and other novel agents Ian Davis Ludwig Institute for Cancer Research Austin Health, Melbourne, Australia Supported in part by an Australian

More information

Session 4 Chemotherapy for castration refractory prostate cancer First and second- line chemotherapy

Session 4 Chemotherapy for castration refractory prostate cancer First and second- line chemotherapy Session 4 Chemotherapy for castration refractory prostate cancer First and second- line chemotherapy October- 2015 ESMO 2004 October- 2015 Fyraftensmøde 2 2010 October- 2015 Fyraftensmøde 3 SWOG 9916 OS

More information

CONTRACTING ORGANIZATION: Sloan Kettering Institute for Cancer Research New York, NY 10065

CONTRACTING ORGANIZATION: Sloan Kettering Institute for Cancer Research New York, NY 10065 AWARD NUMBER: W81XWH-15-1-0277 TITLE: ERF is a Potential ERK-Modulated Tumor Suppressor in Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Rohit Bose CONTRACTING ORGANIZATION: Sloan Kettering Institute for

More information

Downregulation of angiotensin type 1 receptor and nuclear factor-κb. by sirtuin 1 contributes to renoprotection in unilateral ureteral

Downregulation of angiotensin type 1 receptor and nuclear factor-κb. by sirtuin 1 contributes to renoprotection in unilateral ureteral Supplementary Information Downregulation of angiotensin type 1 receptor and nuclear factor-κb by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction Shao-Yu Yang 1,2, Shuei-Liong

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering

More information

Management of Prostate Cancer

Management of Prostate Cancer Management of Prostate Cancer An ESMO Perspective Alan Horwich Conflicts of Interest Disclosure Alan Horwich I have no personal conflicts of interest relating to prostate cancer. European Incidence and

More information

Case Study: Protein Degradation Approaches at Arvinas

Case Study: Protein Degradation Approaches at Arvinas The PROTAC Company Pioneering Protein Degradation as a New Therapeutic Modality Case Study: Protein Degradation Approaches at Arvinas Targeted Protein Degradation Summit October 25, 2018 Ian Taylor, PhD

More information

Hormone sensitive prostate cancer To add abiraterone or docetaxel? Dr Lisa Pickering

Hormone sensitive prostate cancer To add abiraterone or docetaxel? Dr Lisa Pickering > Hormone sensitive prostate cancer To add abiraterone or docetaxel? Dr Lisa Pickering Disclosures Institutional Research Support/P.I. Employee Consultant Major Stockholder Speakers Bureau Honoraria Scientific

More information

Advanced Prostate Cancer

Advanced Prostate Cancer Advanced Prostate Cancer January 13, 2017 Sindu Kanjeekal MD FRCPC Medical Oncology and Hematology Regional Systemic Quality Lead Erie St Clair Adjunct Professor Schulich School of Medicine and University

More information

Lessons from in-vivo models of castration-resistant prostate cancer

Lessons from in-vivo models of castration-resistant prostate cancer REVIEW C URRENT OPINION Lessons from in-vivo models of castration-resistant prostate cancer Dong Lin a,b, Peter W. Gout b, and Yuzhuo Wang a,b,c Purpose of review Although the treatment of castration-resistant

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

CONTRACTING ORGANIZATION: Fred Hutchinson Cancer Research Center

CONTRACTING ORGANIZATION: Fred Hutchinson Cancer Research Center AD Award Number: W81XWH-10-1-0771 TITLE: Characterizing and Targeting Androgen Receptor Pathway-Independent Prostate Cancer PRINCIPAL INVESTIGATOR: Peter S. Nelson, MD CONTRACTING ORGANIZATION: Fred Hutchinson

More information

Androgen synthesis inhibitors in the treatment of castration resistant prostate cancer

Androgen synthesis inhibitors in the treatment of castration resistant prostate cancer (2014) 16, 387 400 2014 AJA, SIMM & SJTU. All rights reserved 1008-682X www.asiaandro.com; www.ajandrology.com Prostate Cancer Open Access INVITED REVIEW Androgen synthesis inhibitors in the treatment

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang

More information

CONTRACTING ORGANIZATION: University of Michigan Ann Arbor, MI 48109

CONTRACTING ORGANIZATION: University of Michigan Ann Arbor, MI 48109 AD Award Number: W81X-WH-05-1-0105 TITLE: Differential Mechanisms of Androgen Resistance PRINCIPAL INVESTIGATOR: Orla A. O Mahony, Ph.D. CONTRACTING ORGANIZATION: University of Michigan Ann Arbor, MI 48109

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland Page 1 09/10/2013 AD Award Number: W81XWH-12-1-0453 TITLE: The cytoplasm translocation of the androgen receptor cofactor p44 as a target for prostate cancer treatment PRINCIPAL INVESTIGATOR: Zhengxin Wang

More information

Diagnostic test Suggested website label Description Hospitals available

Diagnostic test Suggested website label Description Hospitals available Diagnostic test Suggested website label Description Hospitals available Abbott Molecular Inc, PATHVYSION HER-2 DNA Probe Kit (FISH) PathVysion kit A diagnostic tool used to determine whether a particular

More information

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo.

Fig 1 CD163. CD11b S100A9. Sirius Red. 100μm ** ** CD163. CD11b S100A9 ** Sirius Red (PL) Sirius Red SUM Mo. T47D T47D + o SU-59 Fig SU-59 + o IHC score (-3) IHC score (-2) CD63 3 2 IHC score (-3) CD63 3 ** 2 CDb CDb * * SA9 SA9 ** * 2 IHC score (-4) αsa αsa 4 ** ** 2 Sirius Red μm IHC score (%) Sirius Red 8

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition

Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by

More information

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA

MII. Supplement Figure 1. CapZ β2. Merge. 250ng. 500ng DIC. Merge. Journal of Cell Science Supplementary Material. GFP-CapZ β2 DNA A GV GVBD MI DNA CapZ β2 CapZ β2 Merge B DIC GFP-CapZ β2 Merge CapZ β2-gfp 250ng 500ng Supplement Figure 1. MII A early MI late MI Control RNAi CapZαβ DNA Actin Tubulin B Phalloidin Intensity(A.U.) n=10

More information

Omaha, NE PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

Omaha, NE PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AWARD NUMBER: W81XWH-13-1-0075 TITLE: LincRNAs and AR Reactivation after Androgen Deprivation in Prostate Cancer Cells PRINCIPAL INVESTIGATOR: Xian-Ming Chen, MD CONTRACTING ORGANIZATION: Creighton University

More information

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function

MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function MANUSCRIPT TITLE: Protein kinase C δ signaling is required for dietary prebiotic-induced strengthening of intestinal epithelial barrier function Authors: Richard Y. Wu 1,2, Majd Abdullah 1, Pekka Määttänen

More information

Anti-Androgen Therapies for Prostate Cancer: A Focused Review

Anti-Androgen Therapies for Prostate Cancer: A Focused Review Anti-Androgen Therapies for Prostate Cancer: A Focused Review Nischala Ammannagari, MD, and Saby George, MD, FACP Abstract Among men in the United States, prostate cancer is the most common malignancy

More information

Evaluation of Insulin-like Growth Factor Receptor 1 Inhibition as a Treatment for Prostate Cancer: Preclinical Efficacy and Resistance

Evaluation of Insulin-like Growth Factor Receptor 1 Inhibition as a Treatment for Prostate Cancer: Preclinical Efficacy and Resistance University of Miami Scholarly Repository Open Access Dissertations Electronic Theses and Dissertations 2013-12-11 Evaluation of Insulin-like Growth Factor Receptor 1 Inhibition as a Treatment for Prostate

More information