Novel Insights into Breast Cancer Genetic Variance through RNA Sequencing

RNA sequencing of cancer reveals novel splicing alterations

RNA sequencing of cancer reveals novel splicing alterations Jeyanthy Eswaran, Anelia Horvath, Sucheta Godbole, Sirigiri Divijendra Reddy, Prakriti Mudvari, Kazufumi Ohshiro, Dinesh Cyanam, Sujit Nair,

Supplementary Table 1. Information on the 174 single nucleotide variants identified by whole-exome sequencing

Supplementary Table 1. Information on the 174 single nucleotide s identified by whole-exome sequencing Chr Position Type AF exomes Database 1 10163148 A/G UBE4B missense 0.000326 1534 2 98 1 4.44 Damaging

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE

CHR POS REF OBS ALLELE BUILD CLINICAL_SIGNIFICANCE is_clinical dbsnp MITO GENE chr1 13273 G C heterozygous - - -. - DDX11L1 chr1 949654 A G Homozygous 52 - - rs8997 - ISG15 chr1 1021346 A G heterozygous

Supplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer

Supplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer risk in stage 1 (red) and after removing any SNPs within

Supplementary Figure 1

Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the

Nature Neuroscience: doi: /nn Supplementary Figure 1. Missense damaging predictions as a function of allele frequency

Supplementary Figure 1 Missense damaging predictions as a function of allele frequency Percentage of missense variants classified as damaging by eight different classifiers and a classifier consisting

Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues

Clinical Genetics Leading the way in genetic issues Functional validation in a diagnostic context Robert Hofstra Clinical Genetics Leading the way in genetic issues Future application of exome sequencing

SUPPLEMENTARY INFORMATION. Meta-analyses of genome-wide association studies identify multiple novel loci related to pulmonary function

SUPPLEMENTARY INFORMATION Meta-analyses of genome-wide association studies identify multiple novel loci related to pulmonary function Dana B. Hancock, 1,29 Mark Eijgelsheim, 2,29 Jemma B. Wilk, 3,29 Sina

TP53 mutational profile in CLL : A retrospective study of the FILO group.

TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :

Genome-wide association analyses identify 13 new susceptibility loci for generalized

Supplementary information for: Genome-wide association analyses identify 13 new susceptibility loci for generalized vitiligo Ying Jin 1,2, Stanca A Birlea 1,3, Pamela R Fain 1,2,4, Tracey M Ferrara 1,

indicated in shaded lowercase letters (hg19, Chr2: 217,955, ,957,266).

Legend for Supplementary Figures Figure S1: Sequence of 2q35 encnv. The DNA sequence of the 1,375bp 2q35 encnv is indicated in shaded lowercase letters (hg19, Chr2: 217,955,892-217,957,266). Figure S2:

Downloaded for Anonymous User (n/a) at University of Washington - Seattle - WSC from ClinicalKey.com by Elsevier on March 04, 2019.

Accepted Manuscript The MALT1 locus and Peanut Avoidance in the Risk for Peanut Allergy Alexandra Winters, PhD, Henry T. Bahnson, MPH, Ingo Ruczinski, PhD, Meher P. Boorgula, MS, Claire Malley, MS, Ali

Concurrent Practical Session ACMG Classification

Variant Effect Prediction Training Course 6-8 November 2017 Prague, Czech Republic Concurrent Practical Session ACMG Classification Andreas Laner / Anna Benet-Pagès 1 Content 1. Background... 3 2. Aim

TITLE: - Whole Genome Sequencing of High-Risk Families to Identify New Mutational Mechanisms of Breast Cancer Predisposition

AD Award Number: W81XWH-13-1-0336 TITLE: - Whole Genome Sequencing of High-Risk Families to Identify New Mutational Mechanisms of Breast Cancer Predisposition PRINCIPAL INVESTIGATOR: Mary-Claire King,

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels

Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA

Investigating causality in the association between 25(OH)D and schizophrenia

Investigating causality in the association between 25(OH)D and schizophrenia Amy E. Taylor PhD 1,2,3, Stephen Burgess PhD 1,4, Jennifer J. Ware PhD 1,2,5, Suzanne H. Gage PhD 1,2,3, SUNLIGHT consortium,

Accel-Amplicon Panels

Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation

A genome-wide association study identifies vitiligo

A genome-wide association study identifies vitiligo susceptibility loci at MHC and 6q27 Supplementary Materials Index Supplementary Figure 1 The principal components analysis (PCA) of 2,546 GWAS samples

Supplementary information: Forstner, Hofmann et al.

Supplementary information: Forstner, Hofmann et al., Genome-wide analysis implicates micrornas and their target genes in the development of bipolar disorder Table of contents Supplementary Figure 1: Regional

Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT

GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes

MSI positive MSI negative

Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden

Genomic approach for drug target discovery and validation

Genomic approach for drug target discovery and validation Hong-Hee Won, Ph.D. SAIHST, SKKU wonhh@skku.edu Well-known example of genetic findings triggering drug development Genetics Mendelian randomisation

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK

CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence

Home Brewed Personalized Genomics

Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome

Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP

Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP Frequency Domain Mammals a 3 S/P b Mammals a 3 S/P b

CITATION FILE CONTENT/FORMAT

CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

Rare Variant Burden Tests. Biostatistics 666

Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls

p.arg119gly p.arg119his p.ala179thr c.540+1g>a c.617_633+6del Prediction basis structure

a Missense ATG p.arg119gly p.arg119his p.ala179thr p.ala189val p.gly206trp p.gly206arg p.arg251his p.ala257thr TGA 5 UTR 1 2 3 4 5 6 7 3 UTR Splice Site, Frameshift b Mutation p.gly206trp p.gly4fsx50 c.138+1g>a

Variant Annotation and Functional Prediction

Variant Annotation and Functional Prediction Copyrighted 2018 Isabelle Schrauwen and Suzanne M. Leal This exercise touches on several functionalities of the program ANNOVAR to annotate and interpret candidate

Identification of heritable genetic risk factors for bladder cancer through genome-wide association studies (GWAS)

BCAN 2014 August 9, 2014 Identification of heritable genetic risk factors for bladder cancer through genome-wide association studies (GWAS) Ludmila Prokunina-Olsson, PhD Investigator Laboratory of Translational

SUPPLEMENTARY INFORMATION. Intron retention is a widespread mechanism of tumor suppressor inactivation.

SUPPLEMENTARY INFORMATION Intron retention is a widespread mechanism of tumor suppressor inactivation. Hyunchul Jung 1,2,3, Donghoon Lee 1,4, Jongkeun Lee 1,5, Donghyun Park 2,6, Yeon Jeong Kim 2,6, Woong-Yang

Supplementary information for: A functional variation in BRAP confers risk of myocardial infarction in Asian populations

Supplementary information for: A functional variation in BRAP confers risk of myocardial infarction in Asian populations Kouichi Ozaki 1, Hiroshi Sato 2, Katsumi Inoue 3, Tatsuhiko Tsunoda 4, Yasuhiko

Nature Genetics: doi: /ng Supplementary Figure 1. Alternative splicing events in the 5K panel.

Supplementary Figure 1 Alternative splicing events in the 5K panel. The majority of cryptic splicing occurred by creation of an AG or GT (Type I). While some other mutations increased the usage of a nearby

Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.

Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets

Title: Candidate Gene Association Studies of Anthracycline-induced Cardiotoxicity: A

1 Title Page Title: Candidate Association Studies of Anthracycline-induced Cardiotoxicity: A Systematic Review and Meta-analysis. Authors: Siew Lian Leong 1,2, Nathorn Chaiyakunapruk 1,3,4,5, Shaun Wen

Reporting TP53 gene analysis results in CLL

Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review

Table S2. Baseline characteristics of the Rotterdam Study for interaction analysis

Supplementary data Table S1. List of the primers for the cloning of precursor mir-4707 Table S2. Baseline characteristics of the Rotterdam Study for interaction analysis Table S3. List of the primers for

한국지질동맥경화학회, 부산 BEXCO, 2010 년 4 월 16 일

한국지질동맥경화학회, 부산 BEXCO, 2010 년 4 월 16 일 Dietary intake of folate, vitamin B2, vitamin B6, vitamin B12, genetic polymorphism of related enzymes, and risk of breast cancer: a case-control study in Korea KIM

IPA Advanced Training Course

IPA Advanced Training Course October 2013 Academia sinica Gene (Kuan Wen Chen) IPA Certified Analyst Agenda I. Data Upload and How to Run a Core Analysis II. Functional Interpretation in IPA Hands-on Exercises

Somatic intronic microsatellite loci differentiate glioblastoma from lower-grade gliomas

1 Somatic intronic microsatellite loci differentiate glioblastoma from lower-grade gliomas 2 3 FIGURE S1: Sensitivity & Specificity receiver operator characteristics (ROC) of Signature Cancer-Associated

Supplementary Table 1. Annotated candidate SNV and indels in melanoma tumors. Patient C1 Patient C2 Patient C3 Patient C4 Patient C5 Patient C6 Patient C7 Patient C10 Chr Position Reference Allele Sample

Shashikant Kulkarni, M.S (Medicine)., Ph.D., FACMG Associate Professor of Pathology & Immunology Associate Professor of Pediatrics and Genetics

Shashikant Kulkarni, M.S (Medicine)., Ph.D., FACMG Associate Professor of Pathology & Immunology Associate Professor of Pediatrics and Genetics Director of Cytogenomics and Molecular Pathology Evidence-based

Effects of Obesity Related Genetic Variations on Visceral and Subcutaneous Fat Distribution in a Chinese Population

Effects of Obesity Related Genetic Variations on Visceral and Subcutaneous Fat Distribution in a Chinese Population Tao Wang #, Xiaojing Ma #, Danfeng Peng, Rong Zhang, Xue Sun, Miao Chen, Jing Yan, Shiyun

Supplementary Methods

Supplementary Methods Short Read Preprocessing Reads are preprocessed differently according to how they will be used: detection of the variant in the tumor, discovery of an artifact in the normal or for

Supplemental Table 1. List of genes and mature shrna sequences identified from the shrna screen in BRCA2-mutant PEO1 cells.

Guillemette_Supplemental Table 1 Gene Mature Sequence Gene Mature Sequence ATTCATAGGATGTCAGCAG LOC157193 TATGCGTAAGTAATAAATTGCT TTAGTTCTGTCTTGGAGG LOC152225 CGCATATATGTTCTGACTT ALDH2 CACTTCAGTGTATGCCT

Nutritional Epidemiology in the Genomic Age. Saroja Voruganti, PhD Assistant Professor Department of Nutrition and UNC Nutrition Research Institute

Nutritional Epidemiology in the Genomic Age Saroja Voruganti, PhD Assistant Professor Department of Nutrition and UNC Nutrition Research Institute Learning objectives Types of genetic association approaches

Supplementary Information. PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small

Sato T, et al. Supplementary Information PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small cell lung cancer Teruyuki Sato 1,2, Atsushi Kaneda 1,3,4 *, Shingo Tsuji

Next generation histopathological diagnosis for precision medicine in solid cancers

Next generation histopathological diagnosis for precision medicine in solid cancers from genomics to clinical application Aldo Scarpa ARC-NET Applied Research on Cancer Department of Pathology and Diagnostics

LMM / emerge III Network Reference Sequences October 2016 LMM / emerge III Network Consensus Actionable Gene List *ACMG56 gene

LMM / emerge III Network Consensus Actionable Gene List *ACMG56 gene ACTA2* Exon 02-09 NM_001613.2 DSG2* Exon 01-15 NM_001943.3 ACTC1* Exon 01-06 NM_005159.4 DSP* Exon 01-24 NM_004415.2 APC* Exon 01-15

Genome Summary. Sequencing Coverage: Variation Counts: Known Phenotype Summary: 131 disease or trait variations are found in this genome

Report Date: August 2, 215 Software Annotation Version: 8 Genome Summary Name: Greg Mendel Genome ID: genome_greg_mendel_dad Sequencing Provider: 23andMe Sequencing Type: Genotyping SNP Array Sequencing

A Rare View Of Coding Mutations And Plasma Lipid Levels

Yale University EliScholar A Digital Platform for Scholarly Publishing at Yale Yale Medicine Thesis Digital Library School of Medicine January 2014 A Rare View Of Coding Mutations And Plasma Lipid Levels

Supplementary Figure 1: Classification scheme for non-synonymous and nonsense germline MC1R variants. The common variants with previously established

Supplementary Figure 1: Classification scheme for nonsynonymous and nonsense germline MC1R variants. The common variants with previously established classifications 1 3 are shown. The effect of novel missense

Ct=28.4 WAT 92.6% Hepatic CE (mg/g) P=3.6x10-08 Plasma Cholesterol (mg/dl)

a Control AAV mtm6sf-shrna8 Ct=4.3 Ct=8.4 Ct=8.8 Ct=8.9 Ct=.8 Ct=.5 Relative TM6SF mrna Level P=.5 X -5 b.5 Liver WAT Small intestine Relative TM6SF mrna Level..5 9.6% Control AAV mtm6sf-shrna mtm6sf-shrna6

Germline Testing for Hereditary Cancer with Multigene Panel

Germline Testing for Hereditary Cancer with Multigene Panel Po-Han Lin, MD Department of Medical Genetics National Taiwan University Hospital 2017-04-20 Disclosure No relevant financial relationships with

Genotypes of patients with factor XI deficiency Mutation Location Domain Type Genotype Origin Activity U/dL

Genotypes of patients with factor XI deficiency Mutation Location Domain Type Genotype Origin Activity U/dL Antigen U/dL Expression comments Reference nt-1296g>a Promoter Promoter Regulatory Comp het Nigeria

DYSREGULATION OF WT1 (-KTS) IS ASSOCIATED WITH THE KIDNEY-SPECIFIC EFFECTS OF THE LMX1B R246Q MUTATION

DYSREGULATION OF WT1 (-KTS) IS ASSOCIATED WITH THE KIDNEY-SPECIFIC EFFECTS OF THE LMX1B R246Q MUTATION Gentzon Hall 1,2#, Brandon Lane 1,3#, Megan Chryst-Ladd 1,3, Guanghong Wu 1,3, Jen-Jar Lin 4, XueJun

EIGEN: A SPECTRAL APPROACH TO THE INTEGRATION OF FUNCTIONAL GENOMICS ANNOTATIONS FOR BOTH CODING AND NONCODING SEQUENCE VARIANTS

EIGEN: A SPECTRAL APPROACH TO THE INTEGRATION OF FUNCTIONAL GENOMICS ANNOTATIONS FOR BOTH CODING AND NONCODING SEQUENCE VARIANTS IULIANA IONITA-LAZA 1,7,, KENNETH MCCALLUM 1,7, BIN XU 2, JOSEPH BUXBAUM

Supplementary Figures. Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated. for each lesion type.

Supplementary Figures Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated for each lesion type. a b Supplementary Figure 2. Non-negative matrix factorization-derived

Supplementary Information to

Supplementary Information to Exome sequencing to identify de novo mutations in sporadic ALS trios Alessandra Chesi 1,11, Brett T. Staahl 2, Ana Jovicic 1, Julien Couthouis 1, Maria Fasolino 3, Alya R.

Supplemental Tables and Figures

Supplemental Tables and Figures Post-zygotic de novo changes in glutamate and dopamine pathways may explain discordance of monozygotic twins for schizophrenia Castellani, CA., Melka, MG., Gui, JL., Gallo,

Nature Genetics: doi: /ng Supplementary Figure 1. Somatic coding mutations identified by WES/WGS for 83 ATL cases.

Supplementary Figure 1 Somatic coding mutations identified by WES/WGS for 83 ATL cases. (a) The percentage of targeted bases covered by at least 2, 10, 20 and 30 sequencing reads (top) and average read

Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.

Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;

Transient cold shock enhances zinc-finger nuclease mediated gene disruption

nature methods Transient cold shock enhances zincfinger nuclease mediated gene disruption Yannick Doyon, Vivian M Choi, Danny Xia, Thuy D Vo, Philip D Gregory & Michael C Holmes Supplementary figures and

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

Whole exome sequencing. Information for Patients and Families

Whole exome sequencing Information for Patients and Families The medical genetics laboratories Your health care provider has advised you to have genetic testing on your DNA or your child s DNA. The specific

Supplementary appendix

Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Ahlqvist E, Storm P, Käräjämäki A, et al. Novel

Prevalence and clinical implications of BRCA1/2 germline mutations in Chinese women with breast cancer Yuntao Xie M.D., Ph.D.

Prevalence and clinical implications of BRCA1/2 germline mutations in Chinese women with breast cancer Yuntao Xie M.D., Ph.D. Hereditary Cancer Center, Peking University Cancer Hospital 1 Breast cancer

SUPPLEMENTARY INFORMATION. Rare independent mutations in renal salt handling genes contribute to blood pressure variation

SUPPLEMENTARY INFORMATION Rare independent mutations in renal salt handling genes contribute to blood pressure variation Weizhen Ji, Jia Nee Foo, Brian J. O Roak, Hongyu Zhao, Martin G. Larson, David B.

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Systematic investigation of cancer-associated somatic point mutations in SNP databases HyunChul Jung 1,2, Thomas Bleazard 3, Jongkeun Lee 1 and Dongwan Hong 1 1. Cancer Genomics

2) Cases and controls were genotyped on different platforms. The comparability of the platforms should be discussed.

Reviewers' Comments: Reviewer #1 (Remarks to the Author) The manuscript titled 'Association of variations in HLA-class II and other loci with susceptibility to lung adenocarcinoma with EGFR mutation' evaluated

How will new biomarkers change bladder cancer management? John Kelly Professor of Uro-Oncology UCL

How will new biomarkers change bladder cancer management? John Kelly Professor of Uro-Oncology UCL What do we mean by biomarker? a measurable indicator of the severity or presence of some disease state.

STATISTICAL METHODS IN BIOLOGY

STATISTICAL METHODS IN BIOLOGY JOANNA SZYDA MAGDALENA FRĄSZCZAK INTRODUCTION 1. Statistical methods in biology??? 2. The Biostatistic Group current projects 3. Course contents 4. Contact 5. Literature

Supplementary Online Content

Supplementary Online Content Lyall DM, Celis-Morales C, Ward J, et al. Association of body mass index with cardiometabolic disease in the UK Biobank: a mendelian randomization study. JAMA Cardiol. Published

Nature Genetics: doi: /ng Supplementary Figure 1. Country distribution of GME samples and designation of geographical subregions.

Supplementary Figure 1 Country distribution of GME samples and designation of geographical subregions. GME samples collected across 20 countries and territories from the GME. Pie size corresponds to the

Editorial Type 2 Diabetes and More Gene Panel: A Predictive Genomics Approach for a Polygenic Disease

Cronicon OPEN ACCESS EC DIABETES AND METABOLIC RESEARCH Editorial Type 2 Diabetes and More Gene Panel: A Predictive Genomics Approach for a Polygenic Disease Amr TM Saeb* University Diabetes Center, College

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency

Supplemental Information For: The genetics of splicing in neuroblastoma

Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,

Influence of genetic ancestry and socioeconomic status on type 2 diabetes in the diverse Colombian populations of Chocó and Antioquia

Supplementary Information For: Influence of genetic ancestry and socioeconomic status on type 2 diabetes in the diverse Colombian populations of Chocó and Antioquia Aroon T. Chande 1,2,3, Jessica Rowell

A rare variant in MYH6 confers high risk of sick sinus syndrome. Hilma Hólm ESC Congress 2011 Paris, France

A rare variant in MYH6 confers high risk of sick sinus syndrome Hilma Hólm ESC Congress 2011 Paris, France Disclosures I am an employee of decode genetics, Reykjavik, Iceland. Sick sinus syndrome SSS is

PALB2 c g>c is. VARIANT OF UNCERTAIN SIGNIFICANCE (VUS) CGI s summary of the available evidence is in Appendices A-C.

Consultation sponsor (may not be the patient): First LastName [Patient identity withheld] Date received by CGI: 2 Sept 2017 Variant Fact Checker Report ID: 0000001.5 Date Variant Fact Checker issued: 12

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

Fluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS

APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

A suppressor locus for MODY3-diabetes

A suppressor locus for MODY3-diabetes Miguel A. Garcia-Gonzalez 1,2, Claire Carette 1,3, Alessia Bagattin 1, Magali Chiral 1, Munevver Parla Makinistoglu 1, Serge Garbay 1, Géraldine Prévost 4, Cécile

Nature Genetics: doi: /ng Supplementary Figure 1

Supplementary Figure 1 LD (r 2 ) between the A3AB deletion and all markers in a 400-kb APOBEC3 region in 1000 Genomes Project populations. Populations: CEU, individuals of European ancestry from Utah,

Supplementary Figure 1. A - MSH6 p.val282thrfs*10: Endome. Endome. Colon

Supplementary Figure 1 - MSH6 p.val282hrfs*10: 1780 1785 C C C C C 1 B - MSH6 p.phe1088leufs*5: 1820 1810 Rectal Rectal Gastric C C C C C C Rectal C 2 C - MSH6 p.rg1172lysfs*5: 1745 1740 Ovarian 3 D -

Next generation sequencing of BRCA1 and BRCA2 in breast cancer patients and control subjects

MOLECULAR AND CLINICAL ONCOLOGY 2: 435-439, 2014 Next generation sequencing of BRCA1 and BRCA2 in breast cancer patients and control subjects LUBOMIR BALABANSKI 1*, GEORGI ANTOV 2*, IVANKA DIMOVA 3, SAMUIL

Supplemental Table 1. Components of MDS and AHEI

Supplemental Table 1. Components of MDS and AHEI MDS AHEI Vegetable Fruit SSB & fruit juice Nut Legume Whole grain Fish Red meat MUFA/SAT ratio EPA & DHA PUFA Trans-fat Alcohol Sodium MDS: Mediterranean-style

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm

Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease

The lymphoma-associated NPM-ALK oncogene elicits a p16ink4a/prb-dependent tumor-suppressive pathway. Blood Jun 16;117(24):

DNA Sequencing Publications Standard Sequencing 1 Carro MS et al. DEK Expression is controlled by E2F and deregulated in diverse tumor types. Cell Cycle. 2006 Jun;5(11) 2 Lassandro L et al. The DNA sequence

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS Download slides and package http://odin.mdacc.tmc.edu/~rverhaak/package.zip http://odin.mdacc.tmc.edu/~rverhaak/rna-seqlecture.zip Overview Introduction into the topic

A total of 2,822 Mexican dyslipidemic cases and controls were recruited at INCMNSZ in

Supplemental Material The N342S MYLIP polymorphism is associated with high total cholesterol and increased LDL-receptor degradation in humans by Daphna Weissglas-Volkov et al. Supplementary Methods Mexican

Nature Genetics: doi: /ng Supplementary Figure 1. TCGA data set on HNSCCs reanalyzed in this study.

Supplementary Figure 1 TCGA data set on HNSCCs reanalyzed in this study. Summary of the TCGA dataset on HNSCCs re-analyzed in this study and the respective numbers of samples available within each. Supplementary

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017

Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of

RNA SEQUENCING AND DATA ANALYSIS

RNA SEQUENCING AND DATA ANALYSIS Length of mrna transcripts in the human genome 5,000 5,000 4,000 3,000 2,000 4,000 1,000 0 0 200 400 600 800 3,000 2,000 1,000 0 0 2,000 4,000 6,000 8,000 10,000 Length

Molecular Diagnosis of Genetic Diseases: From 1 Gene to 1000s

ROMA, 23 GIUGNO 2011 Molecular Diagnosis of Genetic Diseases: From 1 Gene to 1000s USSD Lab Genetica Medica Ospedali Riuniti Bergamo The problem What does the clinician/patient want to know?? Diagnosis,