Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors

Size: px
Start display at page:

Download "Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors"

Transcription

1 Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors Seo-Yoon Chang, Jae Min Cho, Yang-Hyeok Jo, Myung-Jun Kim Departments of Physiology, College of Medicine, The Catholic University of Korea

2 INS-1 cell - rat insulinoma cell line - glucose-responsive insulin secretion cf) RINm5F cell: glucose non-responsive due to the lack of GLUT2 Glucagon-like peptide-1 (GLP-1) - from enteroendocrine L-cell of ileum and colon in response to nutrient intake - in addition to glucose-dependent insulinotrophic action, inhibit glucagon secretion, gastric emptying, food intake - insulin biosysnthesis, insulin gene expression - proliferation, survival and growth of beta-cell

3 Proglucagon processing DNA mrna Protein Posttranslational processing cf) GLP-2: growth factor for gut Adapted from Gastroenterology 2007;132:

4 GLP-1 s action in peripheral target tissues Adapted from Cell Metab 2006;3:

5 GLP-1 receptor - coupled to G-protein - widely expressed in pancreatic islets, brain, heart, kidney, and the GI tract - only a single receptor isolated to date Signaling mechanism of GLP-1 receptor activation in beta-cells Adapted from Current Opin Pharmacol 2006; 6:

6 Signaling mechanism of GLP-1 receptor activation in beta-cells Adapted from Pharmacol Ther 2007;113:

7 Short half-life of GLP-1 (several minutes) Adapted from Gastroenterology 2007;132:

8 Exendins - from the venom of lizard Heloderma species; exendin-3 and exendin-4 - these peptides were named exendin since they were isolated from exocrine gland and were shown to have endocrine actions Exendin-4 - a potent agonist of glucagon-like peptide-1 (GLP-1) receptor - similar properties to native GLP-1 - in experimental diabetes model, improve glucose level, insulin secretion, weight loss, and food intake - stimulates islet mass increase and beta-cell proliferation - BYETTA (Amylin and Lilly)

9 Effects of glucagon-like peptide-1 on INS-1 cell proliferation. Adapted from Diabetologia 2004;47: Adapted from Diabetes 2003;52:

10 Despite many reports about the GLP-1 s role in beta-cell proliferation, there was no report about the effect of GLP-1 on cyclin proteins. Cyclin D1 - a major regulator of G1 to S phases progression

11 EX induces cyclin D1 expression in INS-1 cells. Protein RNA Published J Endocrinol 2006;188:

12 GLP-1 receptor expression (A) and specificity (B). GLP1R antagonist: exendin-(9-39) amide GIPR antagonist: GIP-(6-30) from Dr. C M Isale (Georgia University, USA)

13 Effect of ERK1/2 on cyclin D1 expression. Though exendin-4 activates Raf-ERK pathway, there was no direct evidence in the involvement of ERK in exendin-4-induced cyclin D1 induction.

14 Mechanism of hormone action via camp as second messenger

15 Effects of forskolin and H-89 on cyclin D1 protein expression. FK: forskolin, camp increasing agent H89: a PKA antagonist Exendin-4-induced cyclin D1 expression seems to be dependent on intracellular camp concentration.

16 Involvement of CRE site in EX-induced cyclin D1 transcription. pcd1-96mt: mutated CRE site

17 CREB interacts with the putative CRE site of cyclin D1 promoter. mcre: mutated type wcre: wild type pcd1-96/vector: cotransfection of pcd1 and empty vector pcd1-96/creb: cotransfection of pcd1 and CREB expression vector pcd1-96/kcreb: cotransfection of pcd1 and dominant negative vector

18 Enhanced binding activity of phospho-creb to the putative CRE site of the rat cyclin D1 promoter in vivo.

19 Exendin-4 induces cyclin D1 expression via camp-pka signaling-mediated activation of CRE site within cyclin D1 promoter, and the interaction of phospho-creb with CRE site is implicated in both basal and exendin-4-induced cyclin D1 transcription.

20 Scheme of rat cyclin D1 promoter deletion constructs (A) and promoter analysis of cyclin D1 deletion construct (B). Published Diabetologia 2006;49:

21 Characterization of other transcription factors in rat cyclin D1 expression. - Candidate: EGR1 E2F Sp1 Oct1 EGR/Sp1 CRE Luciferase gene EGR1(5 ) EGR1(3 ) EGR1 (early growth response-1) - one of immediate early gene, zinc-finger transcription factor - a upstream regulator of growth, proliferation and differentiation - involved in glucose-induced beta-cell growth

22 The relevance of EGR1 in beta-cell proliferation Differential gene expression between Zucker Fatty rats and Zucker Diabetic Fatty rats: a potential role for the immediate-early gene Egr-1 in regulation of beta cell proliferation. J Mol Endocrinol 2005;35: Activation of serum response factor in the depolarization induction of Egr-1 transcription in pancreatic Islet beta-cells. J Biol Chem 2000;275: Glucose induces early growth response gene (EGR1) expression in pancreatic beta cells. Diabetologia 1999;42: Egr-1 gene transcription and translation is rapidly induced by glucose treatment. Adapted from J Mol Endocrinol 2005;35:13-25

23 Proposed model for the regulation of PDX-1 expression by Egr-1 Adapted from J Biol Chem 2007;282:

24 Interaction of nuclear proteins with putative EGR1 binding sites. Exendin-4 Exendin-4

25 Characterization of the binding activity of 5 putative EGR1 site: Supershift assay (A) and Competition assay (B). wt: wild type EGR1 mut: mutated EGR1

26 Effect of mutation of the 5 putative EGR1 site on the cyclin D1 induction *, P < 0.05 vs. empty vector (pgl3 basic vector) #, P < 0.05 vs. pcd1-827

27 Recruitment of EGR1 to cyclind1 promoter in vivo.

28 Effect of EGR1 on cyclind1 promoter activity. Relative lu uciferase activity pcr3.1 PCR3.1-EGR1 * 0 pcr3.1 pcd1-827 pcr3.1-egr-1

29 Exendin-4 rapidly induces transcription factor EGR-1 and this was bound the 5 EGR-1 binding site of rat cyclin D1 promoter. Through the EGR-1-mediated induction of cyclin D1 transcription, exendin-4 may contribute to beta-cell proliferation.

30 EX-induced EGR1 expression. A EX (min) B EGR1 EGR1 (721 bp) GAPDH (452 bp) 82 kda EX (min) Protein mrna C Fold Induction of EGR protein mrna 0.5 EX (min) Published AJP-Endo & Metab 2007;292:E215-E222

31 Deletion analysis of rat EGR1 promoter. Fold induction p p-324 SRE ETS CRE p-243 p-159 p-124 p-73 p relative luciferase activity (fold induction)

32 Functional significance of proximal and distal CRE in EX-induced EGR1 expression. wild-462 distal CRE proximal CRE Fold induction 2.1 mpcre-462 mdcre wild mpcre-73 # relative luciferase activity (fold induction)

33 Activation of proximal CRE site through binding of phospho-creb on Ser 133 by EX. consensus SP1 A B no competitor consensus CRE wild CRE mutant CRE consensus AP1 EX (min)

34 Activation of proximal CRE site through binding of phospho-creb on Ser 133 by EX. no antibody anti-creb anti-pcreb anti-ap1 anti-sp1 no antibody anti-creb anti-pcreb anti-ap1 anti-sp1 C untreated exendin-4

35 Requirement of CREB phosphorylation on Ser 133 for EX induction of EGR-1 promoter. Vector: cotransfection of EGR-1 promoter and empty vector CREB: cotransfection of EGR-1 promoter and CREB expression vector Ser 133 Ala: cotransfection of EGR-1 promoter and mutant vector KCREB: cotransfection of EGR-1 promoter and dominant negative vector *, P < 0.05 vs. Vector, P < 0.05 vs. CREB

36 For the induction of EGR-1 transcription by exendin-4, the proximal CRE site of EGR-1 promoter is critical and the binding with CREB phosphorylated on Ser 133 is necessary.

37 EX-induced EGR expression via GLP-1 receptor. Fold Induction Fold Induction Egr-1 β-tubulin EX-4 (nm) 82 kda 0.5 Egr-1 β-tubulin CON EX-4 EX-4+ EX-4+ GLPA GIPA 82 kda, P<0.05 vs. untreated control value, P<0.05 vs. 1 nm, P<0.05 vs. untreated control value Published J Cell Biochem 2008;104:

38 H-89 and PD inhibit EX-induced Egr-1 protein expression. A Fold Induction CON EX-4 FK PD H89 H89+ H89+ PD+ EX-4 FK EX-4 B Egr-1 28S 18S H89+ H89+ PD+ CON EX-4 FK PD H89 EX-4 FK EX-4 Egr-1 β-tubulin 82 kda, P<0.05 vs. CON, P<0.05 vs. EX-4

39 The involvement of camp and ERK in EX-induced Egr-1 expression. C1 PKA (nm) C2 ERK1 (nm) Scr Scr PKA Erk1 44 kda 42 kda EX-4 Scr PKA EX-4 Scr ERK Egr-1 82 kda Egr-1 82 kda β-tubulin β-tubulin Fold Induction Fold induction *, P < 0.05 vs. untreated;, P < 0.05 vs. EX-4 in Scr. 0.5 *, P < 0.05 vs. untreated;, P < 0.05 vs. EX-4 in Scr.

40 ccgcggag cctcagctct acgcgcctgg cgccctccct acgcgggcgt -463 ccccgactcc cgcgcgcgtt caggctccgg gttgggaacc aaggaggggg SRE1 agggtgggtg cgccgacccg gaaacaccat ataaggagca ggaaggatcc SRE2 SRE3 cccgccggaa cagaccttat ttgggcagcg ccttatatgg agtggcccaa tatggccctg ccgcttccgg ctctgggagg aggggcgaac gggggttggg gcgggggcaa gctgggaact ccaggagcct agcccgggag gccactgccg ctgttccaat actaggcttt ccaggagcct gagcgctcag ggtgccggag CRE ccggtcgcag ggtggaagcg cccaccgctc ttggatggga ggtcttcacg SRE4 YY-1 tcactccggg tcctcccggt cggtccttcc atattagggc ttcctgcttc SRE5 CRE ccatatatgg ccatgtacgt cacggcggag gcgggcccgt gctgtttcag +1 acccttgaaa tagaggccga ttcggggagt cgcgagagat cccagcgcgc +26 agaacttgg

41 Transcription factor: regulate transcription (activator or repressor) Zinc finger protein Adapted from Nucleic Acids Res 1994;22:

42 Identification of SRE clusters implicated in transcriptional regulation of rat Egr-1 gene by EX. A pegr-462 dsres CRE psres CRE +1 Fold induction 2.09 pegr-324 * 1.76 pegr-462 p * 1.72, P<0.05 vs. control of pegr-462, P<0.05 vs. control of pegr-324 and pegr-p462 p pegr-324 p * CON EX , P<0.05 vs. EX-4-treated pegr-462, P<0.05 vs. EX-4-treated pegr-324 p and pegr-462 p B relative luciferase activity relative luciferase activity (fold induction) psg5 psg5-yy1 0.0 pegr-124 pegr-46

43 Gel mobility shift assay of SRE site on rat Egr-1 promoter. From -113, 5 -cggtccttccatattagggcttcctgc-3 A1 EX-4 (min) A2 EX-4 (min) A3 Com Com SRF SP1 Rela ative density (S SRF/SP1) EX-4 (min)

44 Gel mobility shift assay of SRE site on rat Egr-1 promoter. B C Competitor WT MT CONS YY1 Ab SRF p-srf Elk YY1 Sp1

45 EX-4-induced Egr-1 expression appears to be largely dependent on camp/pka signaling pathway in β-cells. The interaction of both SRF and phospho-srf with SRE site of the Egr-1 promoter may be implicated in both basal and EX-4-induced Egr-1 transcription.

46 Exendin-4 increased cyclin D1 expression via activation of CRE site and EGR1 binding site within cyclin D1 promoter in INS-1 beta-cells. Exendin-4 increased EGR1 expression via interaction of 1) CREB to proximal CRE site and 2) SRF to SRE site of EGR1 promoter. Exendin-4 serves as a growth factor regulating beta-cell proliferation.

47 Lab Member Prof. Yang-Hyeok Jo Postdoc. Jung-Hoon Kang (NIH) Assistant Seo-Yoon Chang Student Jae Min Cho In collaboration with Assist. Prof. In-Kyung Jeong (Dept. of Internal Medicine, Kyung Hee Univ.) Assist. Prof. Seung Hyun Ko (Dept. of Internal Medicine, Catholic Univ.) Gyeong Ryul Ryu, Ph. D. (Dept. of Internal Medicine, Catholic Univ.) Human cyclin D1 pomoter: Dr. O. Tetsu and Dr. F. McCormick (Univ. of Calif.-San Francisco) pcmv-erk1: Dr. P. E. Shaw (Univ. of Nottingham, UK) Mutant CREB(Ser 133 Ala) and KCREB: Dr. R.H.Goodman (Oregon Health and Science Univ.) Financial support Korea Science and Engineering Foundation (R ) Korean Diabetes Association (BAYER, 2005)

48

Defects in glucose utilization & GLP-1

Defects in glucose utilization & GLP-1 Defects in glucose utilization & GLP-1 Song, Dae-Kyu Department of Physiology & Chronic Disease Research Center Keimyung University School of Medicine 2800 dalgubeol-daero, Dalseo-gu, Daegu, 704-701, Korea

More information

NIH Public Access Author Manuscript Diabetologia. Author manuscript; available in PMC 2014 February 01.

NIH Public Access Author Manuscript Diabetologia. Author manuscript; available in PMC 2014 February 01. NIH Public Access Author Manuscript Published in final edited form as: Diabetologia. 2013 February ; 56(2): 231 233. doi:10.1007/s00125-012-2788-6. Lipotoxicity impairs incretin signalling V. Poitout 1,2

More information

Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D.

Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. College of Pharmacy, Yonsei University Contents High-throughput screening (HTS) HTS assays for identification

More information

Megan Lawless. Journal Club. January 20 th, 2011

Megan Lawless. Journal Club. January 20 th, 2011 Megan Lawless Journal Club January 20 th, 2011 Gut-expressed gustducin and taste receptors regulate secretion of glucagon-like peptide-1 Proceedings of the National Academy of Sciences September 2007 Abstract

More information

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***

GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna *** a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure

More information

Scope. History. History. Incretins. Incretin-based Therapy and DPP-4 Inhibitors

Scope. History. History. Incretins. Incretin-based Therapy and DPP-4 Inhibitors Plasma Glucose (mg/dl) Plasma Insulin (pmol/l) Incretin-based Therapy and Inhibitors Scope Mechanism of action ผศ.ดร.นพ.ว ระเดช พ ศประเสร ฐ สาขาว ชาโภชนว ทยาคล น ก ภาคว ชาอาย รศาสตร คณะแพทยศาสตร มหาว ทยาล

More information

Chief of Endocrinology East Orange General Hospital

Chief of Endocrinology East Orange General Hospital Targeting the Incretins System: Can it Improve Our Ability to Treat Type 2 Diabetes? Darshi Sunderam, MD Darshi Sunderam, MD Chief of Endocrinology East Orange General Hospital Age-adjusted Percentage

More information

Div. of Endocrinology and Metabolism Konyang University, School of Medicine. Byung-Joon Kim M.D., Ph.D.

Div. of Endocrinology and Metabolism Konyang University, School of Medicine. Byung-Joon Kim M.D., Ph.D. Diabetes and Thyroid Center Div. of Endocrinology and Metabolism Konyang University, School of Medicine Byung-Joon Kim M.D., Ph.D. Background Incretin effect and GLP 1 Receptor in L cells TGR5 receptor

More information

/05/$15.00/0 Molecular Endocrinology 19(5): Copyright 2005 by The Endocrine Society doi: /me

/05/$15.00/0 Molecular Endocrinology 19(5): Copyright 2005 by The Endocrine Society doi: /me 0888-8809/05/$15.00/0 Molecular Endocrinology 19(5):1343 1360 Printed in U.S.A. Copyright 2005 by The Endocrine Society doi: 10.1210/me.2003-0493 Elevated Glucose Attenuates Human Insulin Gene Promoter

More information

ENERGY FROM INGESTED NUTREINTS MAY BE USED IMMEDIATELY OR STORED

ENERGY FROM INGESTED NUTREINTS MAY BE USED IMMEDIATELY OR STORED QUIZ/TEST REVIEW NOTES SECTION 1 SHORT TERM METABOLISM [METABOLISM] Learning Objectives: Identify primary energy stores of the body Differentiate the metabolic processes of the fed and fasted states Explain

More information

Gut hormones KHATTAB

Gut hormones KHATTAB Gut hormones PROF:ABD ALHAFIZ HASSAN KHATTAB Gut as an endocrine gland The talk will cover the following : Historical background. Why this subject is chosen. Gastro-intestinal hormones and their function.

More information

Type 2 DM in Adolescents: Use of GLP-1 RA. Objectives. Scope of Problem: Obesity. Background. Pathophysiology of T2DM

Type 2 DM in Adolescents: Use of GLP-1 RA. Objectives. Scope of Problem: Obesity. Background. Pathophysiology of T2DM Type 2 DM in Adolescents: Use of GLP-1 RA Objectives Identify patients in the pediatric population with T2DM that would potentially benefit from the use of GLP-1 RA Discuss changes in glycemic outcomes

More information

22 Emerging Therapies for

22 Emerging Therapies for 22 Emerging Therapies for Treatment of Type 2 Diabetes Siddharth N Shah Abstract: The prevalence of Diabetes is progressively increasing world-wide and the growth of the disease in our country is phenomenal.

More information

EAT TO LIVE: THE ROLE OF THE PANCREAS. Felicia V. Nowak, M.D., Ph.D. Ohio University COM 22 January, 2008

EAT TO LIVE: THE ROLE OF THE PANCREAS. Felicia V. Nowak, M.D., Ph.D. Ohio University COM 22 January, 2008 EAT TO LIVE: THE ROLE OF THE PANCREAS Felicia V. Nowak, M.D., Ph.D. Ohio University COM 22 January, 2008 THE ROLE OF THE PANCREAS Exocrine pancreas Endocrine pancreas THE ROLE OF THE PANCREAS EXOCRINE

More information

Principles of Genetics and Molecular Biology

Principles of Genetics and Molecular Biology Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a

More information

Intracellular signalling cascades associated with TRP channels

Intracellular signalling cascades associated with TRP channels Gerald Thiel Intracellular signalling cascades associated with TRP channels Current state of investigations and potential applications Saarland University, Germany Campus Saarbrücken Department of Medical

More information

Practical Strategies for the Clinical Use of Incretin Mimetics CME/CE. CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010

Practical Strategies for the Clinical Use of Incretin Mimetics CME/CE. CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010 Practical Strategies for the Clinical Use of Incretin Mimetics CME/CE Robert R. Henry, MD Authors and Disclosures CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010 Introduction Type 2 diabetes

More information

/06/$15.00/0 Molecular Endocrinology 20(9): Copyright 2006 by The Endocrine Society doi: /me

/06/$15.00/0 Molecular Endocrinology 20(9): Copyright 2006 by The Endocrine Society doi: /me 0888-8809/06/$15.00/0 Molecular Endocrinology 20(9):2062 2079 Printed in U.S.A. Copyright 2006 by The Endocrine Society doi: 10.1210/me.2005-0316 Androgens, Progestins, and Glucocorticoids Induce Follicle-Stimulating

More information

Discussion & Conclusion

Discussion & Conclusion Discussion & Conclusion 7. Discussion DPP-4 inhibitors augment the effects of incretin hormones by prolonging their half-life and represent a new therapeutic approach for the treatment of type 2 diabetes

More information

Result of screening and surveillance colonoscopy in young Korean adults < 50 years

Result of screening and surveillance colonoscopy in young Korean adults < 50 years SEP 25, 2017 Result of screening and surveillance colonoscopy in young Korean adults < 50 years Jae Myung Cha, MD. PhD. Department of Internal Medicine, Kyung Hee University Hospital at Gang Dong, Kyung

More information

GLUCAGON LIKE PEPTIDE (GLP) 1 AGONISTS FOR THE TREATMENT OF TYPE 2 DIABETES, WEIGHT CONTROL AND CARDIOVASCULAR PROTECTION.

GLUCAGON LIKE PEPTIDE (GLP) 1 AGONISTS FOR THE TREATMENT OF TYPE 2 DIABETES, WEIGHT CONTROL AND CARDIOVASCULAR PROTECTION. GLUCAGON LIKE PEPTIDE (GLP) 1 AGONISTS FOR THE TREATMENT OF TYPE 2 DIABETES, WEIGHT CONTROL AND CARDIOVASCULAR PROTECTION. Patricia Garnica MS, ANP-BC, CDE, CDTC Inpatient Diabetes Nurse Practitioner North

More information

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.

Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2. Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets

More information

The Mediterranean Diet: HOW and WHY It Works So Well for T2DM

The Mediterranean Diet: HOW and WHY It Works So Well for T2DM The Mediterranean Diet: HOW and WHY It Works So Well for T2DM Susan L. Barlow, RD, CDE. Objectives 1. Discuss the effects of meal size on GLP-1 concentrations. 2. Compare and contrast the specific effects

More information

New and Emerging Therapies for Type 2 DM

New and Emerging Therapies for Type 2 DM Dale Clayton MHSc, MD, FRCPC Dalhousie University/Capital Health April 28, 2011 New and Emerging Therapies for Type 2 DM The science of today, is the technology of tomorrow. Edward Teller American Physicist

More information

The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans

The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans Young Min Cho, MD, PhD Division of Endocrinology and Metabolism Seoul National University College of Medicine Plasma glucose

More information

Endocrine Notes Mrs. Laux AP Biology I. Endocrine System consists of endocrine glands (ductless), cells, tissues secrete hormones

Endocrine Notes Mrs. Laux AP Biology I. Endocrine System consists of endocrine glands (ductless), cells, tissues secrete hormones I. Endocrine System consists of endocrine glands (ductless), cells, tissues secrete hormones regulates metabolism, fluid balance, growth, reproduction A. Hormones 1. chemical signals-cell to cell communication

More information

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ

Supplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

Hormones. Prof. Dr. Volker Haucke Institut für Chemie-Biochemie Takustrasse 6

Hormones. Prof. Dr. Volker Haucke Institut für Chemie-Biochemie Takustrasse 6 Hormones Prof. Dr. Volker Haucke Institut für Chemie-Biochemie Takustrasse 6 Tel. 030-8385-6920 (Sekret.) 030-8385-6922 (direkt) e-mail: vhaucke@chemie.fu-berlin.de http://userpage.chemie.fu-berlin.de/biochemie/aghaucke/teaching.html

More information

GLP-1 agonists. Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK

GLP-1 agonists. Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK GLP-1 agonists Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK What do GLP-1 agonists do? Physiology of postprandial glucose regulation Meal ❶ ❷ Insulin Rising plasma

More information

Niki Prakoura. Calreticulin upregulation in renal fibrosis

Niki Prakoura. Calreticulin upregulation in renal fibrosis Calreticulin upregulation in renal fibrosis Niki Prakoura Section of Histology, Center of Basic Research, Biomedical Research Foundation of the Academy of Athens, Athens, Greece EuroKUP meeting, Madrid,

More information

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences. Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental

More information

Treating Type 2 Diabetes with Bariatric Surgery. Goal of Treating T2DM. Remission of T2DM with Bariatric

Treating Type 2 Diabetes with Bariatric Surgery. Goal of Treating T2DM. Remission of T2DM with Bariatric Treating Type 2 Diabetes with Bariatric Surgery Number (in Millions) of Persons with Diagnosed Diabetes, United States, 198 25 The number of Americans with diabetes increased from 5.6 to 15.8 million Guilherme

More information

ELSEVIER: UNCORRECTED PROOF

ELSEVIER: UNCORRECTED PROOF Glucagon Gene Expression DANIEL J. DRUCKER University of Toronto I. PROGLUCAGON GENE STRUCTURE AND POSTTRANSLATIONAL PROGLUCAGON PROCESSING II. PROGLUCAGON GENE EXPRESSION IN THE PANCREAS III. PROGLUCAGON

More information

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle

FH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF

More information

18. PANCREATIC FUNCTION AND METABOLISM. Pancreatic secretions ISLETS OF LANGERHANS. Insulin

18. PANCREATIC FUNCTION AND METABOLISM. Pancreatic secretions ISLETS OF LANGERHANS. Insulin 18. PANCREATIC FUNCTION AND METABOLISM ISLETS OF LANGERHANS Some pancreatic functions have already been discussed in the digestion section. In this one, the emphasis will be placed on the endocrine function

More information

CB2-mediated immunoregulation in Inflammatory Bowel Disease. David Ziring, MD Clinical Instructor, UCLA Div of Peds GI

CB2-mediated immunoregulation in Inflammatory Bowel Disease. David Ziring, MD Clinical Instructor, UCLA Div of Peds GI CB2-mediated immunoregulation in Inflammatory Bowel Disease David Ziring, MD Clinical Instructor, UCLA Div of Peds GI Overview Why study cannabinoid signaling in intestinal immunoregulation? G_i2 -/- mice

More information

Neuroprotective properties of GLP-1 - a brief overview. Michael Gejl Jensen, MD Dept. Of Pharmacology, AU

Neuroprotective properties of GLP-1 - a brief overview. Michael Gejl Jensen, MD Dept. Of Pharmacology, AU Neuroprotective properties of GLP-1 - a brief overview Michael Gejl Jensen, MD Dept. Of Pharmacology, AU mg@farm.au.dk Agenda Glucagon-like peptide (GLP-1) GLP-1 and neuronal activity GLP-1 in disease-specific

More information

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase

Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez

More information

Supplementary Information

Supplementary Information Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,

More information

Effect of macronutrients and mixed meals on incretin hormone secretion and islet cell function

Effect of macronutrients and mixed meals on incretin hormone secretion and islet cell function Effect of macronutrients and mixed meals on incretin hormone secretion and islet cell function Background. Following meal ingestion, several hormones are released from the gastrointestinal tract. Some

More information

Egr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators

Egr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators /, 2017, Vol. 8, (No. 53), pp: 91425-91444 Egr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators Roni Sarkar 1 and Subhash C. Verma 1 1 Department of Microbiology

More information

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)

Predictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h) Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d

More information

Deregulation of CREB Signaling Pathway Induced by Chronic Hyperglycemia Downregulates NeuroD Transcription

Deregulation of CREB Signaling Pathway Induced by Chronic Hyperglycemia Downregulates NeuroD Transcription Deregulation of CREB Signaling Pathway Induced by Chronic Hyperglycemia Downregulates NeuroD Transcription In-Su Cho 1,3,4, Miyoung Jung 2, Ki-Sun Kwon 7, Eunpyo Moon 2, Jang-Hyeon Cho 8, Kun-Ho Yoon 9,

More information

Bariatric Surgery MM /11/2001. HMO; PPO; QUEST 05/01/2012 Section: Surgery Place(s) of Service: Outpatient; Inpatient

Bariatric Surgery MM /11/2001. HMO; PPO; QUEST 05/01/2012 Section: Surgery Place(s) of Service: Outpatient; Inpatient Bariatric Surgery Policy Number: Original Effective Date: MM.06.003 09/11/2001 Line(s) of Business: Current Effective Date: HMO; PPO; QUEST 05/01/2012 Section: Surgery Place(s) of Service: Outpatient;

More information

Roux-and-Y Gastric Bypass and its Metabolic Effects

Roux-and-Y Gastric Bypass and its Metabolic Effects Roux-and-Y Gastric Bypass and its Metabolic Effects Nicola Di Lorenzo President elect of SICOb Italian Society for Bariatric Surgery and Metabolic Diseases Dept. of General Surgery-Università di Roma Tor

More information

Cellular Signaling Pathways. Signaling Overview

Cellular Signaling Pathways. Signaling Overview Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the

More information

Data Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621

Data Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Data Sheet NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Background The nuclear factor of activator T cells (NFAT) family of transcription factors plays an important role in immune response. T

More information

Hormonal regulation of. Physiology Department Medical School, University of Sumatera Utara

Hormonal regulation of. Physiology Department Medical School, University of Sumatera Utara Hormonal regulation of nutrient metabolism Physiology Department Medical School, University of Sumatera Utara Homeostasis & Controls Successful compensation Homeostasis reestablished Failure to compensate

More information

Cells and Tissues 3PART C. PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College

Cells and Tissues 3PART C. PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College Cells and Tissues 3PART C Protein Synthesis Gene DNA segment that carries a blueprint for building

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information

/05/$15.00/0 Molecular Endocrinology 19(10): Copyright 2005 by The Endocrine Society doi: /me

/05/$15.00/0 Molecular Endocrinology 19(10): Copyright 2005 by The Endocrine Society doi: /me 0888-8809/05/$15.00/0 Molecular Endocrinology 19(10):2610 2623 Printed in U.S.A. Copyright 2005 by The Endocrine Society doi: 10.1210/me.2005-0047 Activin Regulates Luteinizing Hormone -Subunit Gene Expression

More information

Cell Signaling part 2

Cell Signaling part 2 15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,

More information

My Journey in Endocrinology. Samuel Cataland M.D

My Journey in Endocrinology. Samuel Cataland M.D My Journey in Endocrinology Samuel Cataland M.D. 1968-2015 Drs Berson M.D. Yalow phd Insulin Radioimmunoassay Nobel Prize Physiology or Medicine 1977 Rosalyn Yalow: Radioimmunoassay Technology Andrew Schally

More information

Improving Diabetes Research: Moving Beyond Animal Models. Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D.

Improving Diabetes Research: Moving Beyond Animal Models. Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D. Improving Diabetes Research: Moving Beyond Animal Models Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D. July 19, 2014 From Bench-to-Bedside Sulfonylurea Biguanide Dipeptidyl peptidase-4 inhibitor Glucagon-like

More information

Lecture 15. Signal Transduction Pathways - Introduction

Lecture 15. Signal Transduction Pathways - Introduction Lecture 15 Signal Transduction Pathways - Introduction So far.. Regulation of mrna synthesis Regulation of rrna synthesis Regulation of trna & 5S rrna synthesis Regulation of gene expression by signals

More information

Management of Type 2 Diabetes

Management of Type 2 Diabetes Management of Type 2 Diabetes Pathophysiology Insulin resistance and relative insulin deficiency/ defective secretion Not immune mediated No evidence of β cell destruction Increased risk with age, obesity

More information

PANCREATIC BETA CELLS PRODUCE AND SECRETE

PANCREATIC BETA CELLS PRODUCE AND SECRETE 15 March, 2018 PANCREATIC BETA CELLS PRODUCE AND SECRETE Document Filetype: PDF 374.06 KB 0 PANCREATIC BETA CELLS PRODUCE AND SECRETE Among the oldest and cheapest drugs for diabetes are the drugs that

More information

NUTRIENT DIGESTION & ABSORPTION

NUTRIENT DIGESTION & ABSORPTION NUTRIENT DIGESTION & ABSORPTION NUTR 2050: Nutrition for Nursing Professionals Mrs. Deborah A. Hutcheon, MS, RD, LD Lesson Objectives At the end of the lesson, the student will be able to: 1. Differentiate

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

Receptor mediated Signal Transduction

Receptor mediated Signal Transduction Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third

More information

Novel Physiological Role of Caveolin-1 in Aging and Aging-related Diseases. Sang Chul Park Gachon University Lee Gil Ya Cancer and Diabetes Institute

Novel Physiological Role of Caveolin-1 in Aging and Aging-related Diseases. Sang Chul Park Gachon University Lee Gil Ya Cancer and Diabetes Institute Novel Physiological Role of Caveolin-1 in Aging and Aging-related Diseases Sang Chul Park Gachon University Lee Gil Ya Cancer and Diabetes Institute Primarily I asked questions on biological issues on

More information

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null

More information

Hormonal Regulations Of Glucose Metabolism & DM

Hormonal Regulations Of Glucose Metabolism & DM Hormonal Regulations Of Glucose Metabolism & DM What Hormones Regulate Metabolism? What Hormones Regulate Metabolism? Insulin Glucagon Thyroid hormones Cortisol Epinephrine Most regulation occurs in order

More information

GLP 1 agonists Winning the Losing Battle. Dr Bernard SAMIA. KCS Congress: Impact through collaboration

GLP 1 agonists Winning the Losing Battle. Dr Bernard SAMIA. KCS Congress: Impact through collaboration GLP 1 agonists Winning the Losing Battle Dr Bernard SAMIA KCS Congress: Impact through collaboration CONTACT: Tel. +254 735 833 803 Email: kcardiacs@gmail.com Web: www.kenyacardiacs.org Disclosures I have

More information

Oat beta glucan: Multiple roles in the gut. A.R. Mackie, B.H. Bajka, B. Kirkhus

Oat beta glucan: Multiple roles in the gut. A.R. Mackie, B.H. Bajka, B. Kirkhus Oat beta glucan: Multiple roles in the gut A.R. Mackie, B.H. Bajka, B. Kirkhus Introduction Food is consumed Food resides in the stomach Chyme is gradually emptied into the duodenum Can oat beta glucan

More information

The Effects of Exenatide on the Autoimmune Development of Diabetes. A Senior Honors Thesis

The Effects of Exenatide on the Autoimmune Development of Diabetes. A Senior Honors Thesis The Effects of Exenatide on the Autoimmune Development of Diabetes A Senior Honors Thesis Presented in Partial Fulfillment of the Requirements for Graduation with Distinction in Microbiology in the Undergraduate

More information

GLP-1. GLP-1 is produced by the L-cells of the gut after food intake in two biologically active forms It is rapidly degraded by DPP-4.

GLP-1. GLP-1 is produced by the L-cells of the gut after food intake in two biologically active forms It is rapidly degraded by DPP-4. GLP-1 GLP-1 is produced by the L-cells of the gut after food intake in two biologically active forms It is rapidly degraded by DPP-4 Food intake éinsulin Gut églucose uptake Pancreas Beta cells Alpha cells

More information

Generating Mouse Models of Pancreatic Cancer

Generating Mouse Models of Pancreatic Cancer Generating Mouse Models of Pancreatic Cancer Aom Isbell http://www2.massgeneral.org/cancerresourceroom/types/gi/index.asp Spring/Summer 1, 2012 Alexandros Tzatsos, MD PhD Bardeesy Lab: Goals and Objectives

More information

Control of Glucose Metabolism

Control of Glucose Metabolism Glucose Metabolism Control of Glucose Metabolism The pancreas is both an exocrine and endocrine gland. It secretes digestive enzymes into the duodenum (exocrine) and 3 specific hormones into the bloodstream

More information

History of Investigation

History of Investigation Acini - Pancreatic juice (1º) (2º) Secretions- neuronal and hormonal mechanisms 1) Secretin - bicarbonate rich 2) Cholecystokinin - enzyme rich Islets of Langerhans (contain 4 cell types) Alpha cells (α)-

More information

a b c Physical appearance of mice Lean mass Adipocyte size d e f

a b c Physical appearance of mice Lean mass Adipocyte size d e f LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte

More information

Gene expression in insulin resistance

Gene expression in insulin resistance Gene expression in insulin resistance Name: Jules Jacobs Date: 4-7-2017 Supervisors: - Mirella Kalafati MSc - Dr. Lars Eijssen Department of Bioinformatics BACKGROUND Obesity Defined as: BMI > 30 kg/m

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular

More information

Insulin Resistance. Biol 405 Molecular Medicine

Insulin Resistance. Biol 405 Molecular Medicine Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent

More information

Hormones. BIT 230 Walsh Chapter 8

Hormones. BIT 230 Walsh Chapter 8 Hormones BIT 230 Walsh Chapter 8 Hormones Regulatory molecules Affect all areas of metabolism Endocrine- hormones travel via the bloodstream to its target cell: true hormone Modern definition- any regulatory

More information

Preceptorship at the Yonsei Cancer Center Gastric Cancer Team. Date : July, 2018 Place: Yonsei Cancer Center, Seoul, Korea

Preceptorship at the Yonsei Cancer Center Gastric Cancer Team. Date : July, 2018 Place: Yonsei Cancer Center, Seoul, Korea Preceptorship at the Yonsei Cancer Center Gastric Cancer Team Date : July, 2018 Place: Yonsei Cancer Center, Seoul, Korea 1 I. Main Topics: - Gastric cancer II. Delegates: Medical oncologists, radiation

More information

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours

Final Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal

More information

Incretins: Their physiology and application in the treatment of diabetes mellitus

Incretins: Their physiology and application in the treatment of diabetes mellitus DIABETES/METABOLISM RESEARCH AND REVIEWS Diabetes Metab Res Rev 2014; 30: 354 371. Published online in Wiley Online Library (wileyonlinelibrary.com).2501 REVIEW ARTICLE Incretins: Their physiology and

More information

Injectable GLP 1 therapy: weight loss effects seen in obesity with and without diabetes

Injectable GLP 1 therapy: weight loss effects seen in obesity with and without diabetes Injectable GLP 1 therapy: weight loss effects seen in obesity with and without diabetes Dr Masud Haq Consultant Lead in Diabetes & Endocrinology Maidstone & Tunbridge Wells NHS Trust & The London Preventative

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5 Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,

More information

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona.

Gene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene therapy: State of the art Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene Therapy: First Steps Type 1 diabetes: An islet disease Alpha cell Beta cell Pancreatic

More information

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells

INTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Galina Chipitsyna, Qiaoke Gong, Chance F. Gray et al. Endocrinology,

More information

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular

More information

2013 W. H. Freeman and Company. 12 Signal Transduction

2013 W. H. Freeman and Company. 12 Signal Transduction 2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure

More information

Pramlintide & Weight. Diane M Karl MD. The Endocrine Clinic & Oregon Health & Science University Portland, Oregon

Pramlintide & Weight. Diane M Karl MD. The Endocrine Clinic & Oregon Health & Science University Portland, Oregon Pramlintide & Weight Diane M Karl MD The Endocrine Clinic & Oregon Health & Science University Portland, Oregon Conflict of Interest Speakers Bureau: Amylin Pharmaceuticals Consultant: sanofi-aventis Grant

More information

Growth Hormone, Somatostatin, and Prolactin 1 & 2 Mohammed Y. Kalimi, Ph.D.

Growth Hormone, Somatostatin, and Prolactin 1 & 2 Mohammed Y. Kalimi, Ph.D. Growth Hormone, Somatostatin, and Prolactin 1 & 2 Mohammed Y. Kalimi, Ph.D. I. Growth Hormone (somatotropin): Growth hormone (GH) is a 191 amino acid single chain polypeptide (MW 22,000 daltons). Growth

More information

Regulation of cell function by intracellular signaling

Regulation of cell function by intracellular signaling Regulation of cell function by intracellular signaling Objectives: Regulation principle Allosteric and covalent mechanisms, Popular second messengers, Protein kinases, Kinase cascade and interaction. regulation

More information

New Drug Development for Hepatic Insulin Resistance

New Drug Development for Hepatic Insulin Resistance New Drug Development for Hepatic Insulin Resistance Innovative Drug Research Center for Metabolic and Inflammatory Disease College of Pharmacy Sang Geon Kim AMPK as an energy sensor, (A novel drug target

More information

Neurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction. Laura Gunter

Neurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction. Laura Gunter Neurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction Laura Gunter The Brain as the Regulatory Center for Appetite The brain is the integration center

More information

For more information about how to cite these materials visit

For more information about how to cite these materials visit Author: John Williams, M.D., Ph.D., 2009 License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution Non-commercial Share Alike 3.0 License: http://creativecommons.org/licenses/by-nc-sa/3.0/

More information

Supplementary Material

Supplementary Material Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor

More information

Sweetness and Glycaemic Regulation. (A focus on gut related and physiological aspects) John McLaughlin Manchester University

Sweetness and Glycaemic Regulation. (A focus on gut related and physiological aspects) John McLaughlin Manchester University Sweetness and Glycaemic Regulation (A focus on gut related and physiological aspects) John McLaughlin Manchester University Disclosures No personal conflicts of interest Funding from BBSRC, including Cargill

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4

More information

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged

glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,

More information

HORMONES AND CELL SIGNALLING

HORMONES AND CELL SIGNALLING HORMONES AND CELL SIGNALLING TYPES OF CELL JUNCTIONS CHEMICAL SIGNALS AND MODES OF ACTION Endocrine system produces chemical messages = hormones that are transported from endocrine gland to target cell

More information

Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes

Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes University of British Columbia Departments of Surgery and Cellular & Physiological Sciences Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes 2016 International Conference

More information

GLP-1 Receptor Agonists and SGLT-2 Inhibitors. Debbie Hicks

GLP-1 Receptor Agonists and SGLT-2 Inhibitors. Debbie Hicks GLP-1 Receptor Agonists and SGLT-2 Inhibitors Debbie Hicks Prescribing and Adverse Event reporting information is available at this meeting from the AstraZeneca representative The views expressed by the

More information