Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors
|
|
- Kristina Doyle
- 5 years ago
- Views:
Transcription
1 Exendin-4-mediated cell proliferation in beta-cells: focusing on the transcription factors Seo-Yoon Chang, Jae Min Cho, Yang-Hyeok Jo, Myung-Jun Kim Departments of Physiology, College of Medicine, The Catholic University of Korea
2 INS-1 cell - rat insulinoma cell line - glucose-responsive insulin secretion cf) RINm5F cell: glucose non-responsive due to the lack of GLUT2 Glucagon-like peptide-1 (GLP-1) - from enteroendocrine L-cell of ileum and colon in response to nutrient intake - in addition to glucose-dependent insulinotrophic action, inhibit glucagon secretion, gastric emptying, food intake - insulin biosysnthesis, insulin gene expression - proliferation, survival and growth of beta-cell
3 Proglucagon processing DNA mrna Protein Posttranslational processing cf) GLP-2: growth factor for gut Adapted from Gastroenterology 2007;132:
4 GLP-1 s action in peripheral target tissues Adapted from Cell Metab 2006;3:
5 GLP-1 receptor - coupled to G-protein - widely expressed in pancreatic islets, brain, heart, kidney, and the GI tract - only a single receptor isolated to date Signaling mechanism of GLP-1 receptor activation in beta-cells Adapted from Current Opin Pharmacol 2006; 6:
6 Signaling mechanism of GLP-1 receptor activation in beta-cells Adapted from Pharmacol Ther 2007;113:
7 Short half-life of GLP-1 (several minutes) Adapted from Gastroenterology 2007;132:
8 Exendins - from the venom of lizard Heloderma species; exendin-3 and exendin-4 - these peptides were named exendin since they were isolated from exocrine gland and were shown to have endocrine actions Exendin-4 - a potent agonist of glucagon-like peptide-1 (GLP-1) receptor - similar properties to native GLP-1 - in experimental diabetes model, improve glucose level, insulin secretion, weight loss, and food intake - stimulates islet mass increase and beta-cell proliferation - BYETTA (Amylin and Lilly)
9 Effects of glucagon-like peptide-1 on INS-1 cell proliferation. Adapted from Diabetologia 2004;47: Adapted from Diabetes 2003;52:
10 Despite many reports about the GLP-1 s role in beta-cell proliferation, there was no report about the effect of GLP-1 on cyclin proteins. Cyclin D1 - a major regulator of G1 to S phases progression
11 EX induces cyclin D1 expression in INS-1 cells. Protein RNA Published J Endocrinol 2006;188:
12 GLP-1 receptor expression (A) and specificity (B). GLP1R antagonist: exendin-(9-39) amide GIPR antagonist: GIP-(6-30) from Dr. C M Isale (Georgia University, USA)
13 Effect of ERK1/2 on cyclin D1 expression. Though exendin-4 activates Raf-ERK pathway, there was no direct evidence in the involvement of ERK in exendin-4-induced cyclin D1 induction.
14 Mechanism of hormone action via camp as second messenger
15 Effects of forskolin and H-89 on cyclin D1 protein expression. FK: forskolin, camp increasing agent H89: a PKA antagonist Exendin-4-induced cyclin D1 expression seems to be dependent on intracellular camp concentration.
16 Involvement of CRE site in EX-induced cyclin D1 transcription. pcd1-96mt: mutated CRE site
17 CREB interacts with the putative CRE site of cyclin D1 promoter. mcre: mutated type wcre: wild type pcd1-96/vector: cotransfection of pcd1 and empty vector pcd1-96/creb: cotransfection of pcd1 and CREB expression vector pcd1-96/kcreb: cotransfection of pcd1 and dominant negative vector
18 Enhanced binding activity of phospho-creb to the putative CRE site of the rat cyclin D1 promoter in vivo.
19 Exendin-4 induces cyclin D1 expression via camp-pka signaling-mediated activation of CRE site within cyclin D1 promoter, and the interaction of phospho-creb with CRE site is implicated in both basal and exendin-4-induced cyclin D1 transcription.
20 Scheme of rat cyclin D1 promoter deletion constructs (A) and promoter analysis of cyclin D1 deletion construct (B). Published Diabetologia 2006;49:
21 Characterization of other transcription factors in rat cyclin D1 expression. - Candidate: EGR1 E2F Sp1 Oct1 EGR/Sp1 CRE Luciferase gene EGR1(5 ) EGR1(3 ) EGR1 (early growth response-1) - one of immediate early gene, zinc-finger transcription factor - a upstream regulator of growth, proliferation and differentiation - involved in glucose-induced beta-cell growth
22 The relevance of EGR1 in beta-cell proliferation Differential gene expression between Zucker Fatty rats and Zucker Diabetic Fatty rats: a potential role for the immediate-early gene Egr-1 in regulation of beta cell proliferation. J Mol Endocrinol 2005;35: Activation of serum response factor in the depolarization induction of Egr-1 transcription in pancreatic Islet beta-cells. J Biol Chem 2000;275: Glucose induces early growth response gene (EGR1) expression in pancreatic beta cells. Diabetologia 1999;42: Egr-1 gene transcription and translation is rapidly induced by glucose treatment. Adapted from J Mol Endocrinol 2005;35:13-25
23 Proposed model for the regulation of PDX-1 expression by Egr-1 Adapted from J Biol Chem 2007;282:
24 Interaction of nuclear proteins with putative EGR1 binding sites. Exendin-4 Exendin-4
25 Characterization of the binding activity of 5 putative EGR1 site: Supershift assay (A) and Competition assay (B). wt: wild type EGR1 mut: mutated EGR1
26 Effect of mutation of the 5 putative EGR1 site on the cyclin D1 induction *, P < 0.05 vs. empty vector (pgl3 basic vector) #, P < 0.05 vs. pcd1-827
27 Recruitment of EGR1 to cyclind1 promoter in vivo.
28 Effect of EGR1 on cyclind1 promoter activity. Relative lu uciferase activity pcr3.1 PCR3.1-EGR1 * 0 pcr3.1 pcd1-827 pcr3.1-egr-1
29 Exendin-4 rapidly induces transcription factor EGR-1 and this was bound the 5 EGR-1 binding site of rat cyclin D1 promoter. Through the EGR-1-mediated induction of cyclin D1 transcription, exendin-4 may contribute to beta-cell proliferation.
30 EX-induced EGR1 expression. A EX (min) B EGR1 EGR1 (721 bp) GAPDH (452 bp) 82 kda EX (min) Protein mrna C Fold Induction of EGR protein mrna 0.5 EX (min) Published AJP-Endo & Metab 2007;292:E215-E222
31 Deletion analysis of rat EGR1 promoter. Fold induction p p-324 SRE ETS CRE p-243 p-159 p-124 p-73 p relative luciferase activity (fold induction)
32 Functional significance of proximal and distal CRE in EX-induced EGR1 expression. wild-462 distal CRE proximal CRE Fold induction 2.1 mpcre-462 mdcre wild mpcre-73 # relative luciferase activity (fold induction)
33 Activation of proximal CRE site through binding of phospho-creb on Ser 133 by EX. consensus SP1 A B no competitor consensus CRE wild CRE mutant CRE consensus AP1 EX (min)
34 Activation of proximal CRE site through binding of phospho-creb on Ser 133 by EX. no antibody anti-creb anti-pcreb anti-ap1 anti-sp1 no antibody anti-creb anti-pcreb anti-ap1 anti-sp1 C untreated exendin-4
35 Requirement of CREB phosphorylation on Ser 133 for EX induction of EGR-1 promoter. Vector: cotransfection of EGR-1 promoter and empty vector CREB: cotransfection of EGR-1 promoter and CREB expression vector Ser 133 Ala: cotransfection of EGR-1 promoter and mutant vector KCREB: cotransfection of EGR-1 promoter and dominant negative vector *, P < 0.05 vs. Vector, P < 0.05 vs. CREB
36 For the induction of EGR-1 transcription by exendin-4, the proximal CRE site of EGR-1 promoter is critical and the binding with CREB phosphorylated on Ser 133 is necessary.
37 EX-induced EGR expression via GLP-1 receptor. Fold Induction Fold Induction Egr-1 β-tubulin EX-4 (nm) 82 kda 0.5 Egr-1 β-tubulin CON EX-4 EX-4+ EX-4+ GLPA GIPA 82 kda, P<0.05 vs. untreated control value, P<0.05 vs. 1 nm, P<0.05 vs. untreated control value Published J Cell Biochem 2008;104:
38 H-89 and PD inhibit EX-induced Egr-1 protein expression. A Fold Induction CON EX-4 FK PD H89 H89+ H89+ PD+ EX-4 FK EX-4 B Egr-1 28S 18S H89+ H89+ PD+ CON EX-4 FK PD H89 EX-4 FK EX-4 Egr-1 β-tubulin 82 kda, P<0.05 vs. CON, P<0.05 vs. EX-4
39 The involvement of camp and ERK in EX-induced Egr-1 expression. C1 PKA (nm) C2 ERK1 (nm) Scr Scr PKA Erk1 44 kda 42 kda EX-4 Scr PKA EX-4 Scr ERK Egr-1 82 kda Egr-1 82 kda β-tubulin β-tubulin Fold Induction Fold induction *, P < 0.05 vs. untreated;, P < 0.05 vs. EX-4 in Scr. 0.5 *, P < 0.05 vs. untreated;, P < 0.05 vs. EX-4 in Scr.
40 ccgcggag cctcagctct acgcgcctgg cgccctccct acgcgggcgt -463 ccccgactcc cgcgcgcgtt caggctccgg gttgggaacc aaggaggggg SRE1 agggtgggtg cgccgacccg gaaacaccat ataaggagca ggaaggatcc SRE2 SRE3 cccgccggaa cagaccttat ttgggcagcg ccttatatgg agtggcccaa tatggccctg ccgcttccgg ctctgggagg aggggcgaac gggggttggg gcgggggcaa gctgggaact ccaggagcct agcccgggag gccactgccg ctgttccaat actaggcttt ccaggagcct gagcgctcag ggtgccggag CRE ccggtcgcag ggtggaagcg cccaccgctc ttggatggga ggtcttcacg SRE4 YY-1 tcactccggg tcctcccggt cggtccttcc atattagggc ttcctgcttc SRE5 CRE ccatatatgg ccatgtacgt cacggcggag gcgggcccgt gctgtttcag +1 acccttgaaa tagaggccga ttcggggagt cgcgagagat cccagcgcgc +26 agaacttgg
41 Transcription factor: regulate transcription (activator or repressor) Zinc finger protein Adapted from Nucleic Acids Res 1994;22:
42 Identification of SRE clusters implicated in transcriptional regulation of rat Egr-1 gene by EX. A pegr-462 dsres CRE psres CRE +1 Fold induction 2.09 pegr-324 * 1.76 pegr-462 p * 1.72, P<0.05 vs. control of pegr-462, P<0.05 vs. control of pegr-324 and pegr-p462 p pegr-324 p * CON EX , P<0.05 vs. EX-4-treated pegr-462, P<0.05 vs. EX-4-treated pegr-324 p and pegr-462 p B relative luciferase activity relative luciferase activity (fold induction) psg5 psg5-yy1 0.0 pegr-124 pegr-46
43 Gel mobility shift assay of SRE site on rat Egr-1 promoter. From -113, 5 -cggtccttccatattagggcttcctgc-3 A1 EX-4 (min) A2 EX-4 (min) A3 Com Com SRF SP1 Rela ative density (S SRF/SP1) EX-4 (min)
44 Gel mobility shift assay of SRE site on rat Egr-1 promoter. B C Competitor WT MT CONS YY1 Ab SRF p-srf Elk YY1 Sp1
45 EX-4-induced Egr-1 expression appears to be largely dependent on camp/pka signaling pathway in β-cells. The interaction of both SRF and phospho-srf with SRE site of the Egr-1 promoter may be implicated in both basal and EX-4-induced Egr-1 transcription.
46 Exendin-4 increased cyclin D1 expression via activation of CRE site and EGR1 binding site within cyclin D1 promoter in INS-1 beta-cells. Exendin-4 increased EGR1 expression via interaction of 1) CREB to proximal CRE site and 2) SRF to SRE site of EGR1 promoter. Exendin-4 serves as a growth factor regulating beta-cell proliferation.
47 Lab Member Prof. Yang-Hyeok Jo Postdoc. Jung-Hoon Kang (NIH) Assistant Seo-Yoon Chang Student Jae Min Cho In collaboration with Assist. Prof. In-Kyung Jeong (Dept. of Internal Medicine, Kyung Hee Univ.) Assist. Prof. Seung Hyun Ko (Dept. of Internal Medicine, Catholic Univ.) Gyeong Ryul Ryu, Ph. D. (Dept. of Internal Medicine, Catholic Univ.) Human cyclin D1 pomoter: Dr. O. Tetsu and Dr. F. McCormick (Univ. of Calif.-San Francisco) pcmv-erk1: Dr. P. E. Shaw (Univ. of Nottingham, UK) Mutant CREB(Ser 133 Ala) and KCREB: Dr. R.H.Goodman (Oregon Health and Science Univ.) Financial support Korea Science and Engineering Foundation (R ) Korean Diabetes Association (BAYER, 2005)
48
Defects in glucose utilization & GLP-1
Defects in glucose utilization & GLP-1 Song, Dae-Kyu Department of Physiology & Chronic Disease Research Center Keimyung University School of Medicine 2800 dalgubeol-daero, Dalseo-gu, Daegu, 704-701, Korea
More informationNIH Public Access Author Manuscript Diabetologia. Author manuscript; available in PMC 2014 February 01.
NIH Public Access Author Manuscript Published in final edited form as: Diabetologia. 2013 February ; 56(2): 231 233. doi:10.1007/s00125-012-2788-6. Lipotoxicity impairs incretin signalling V. Poitout 1,2
More informationIdentification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D.
Identification of GLP1R agonists using a novel high throughput screening assay Wan Namkung, Ph.D. College of Pharmacy, Yonsei University Contents High-throughput screening (HTS) HTS assays for identification
More informationMegan Lawless. Journal Club. January 20 th, 2011
Megan Lawless Journal Club January 20 th, 2011 Gut-expressed gustducin and taste receptors regulate secretion of glucagon-like peptide-1 Proceedings of the National Academy of Sciences September 2007 Abstract
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationScope. History. History. Incretins. Incretin-based Therapy and DPP-4 Inhibitors
Plasma Glucose (mg/dl) Plasma Insulin (pmol/l) Incretin-based Therapy and Inhibitors Scope Mechanism of action ผศ.ดร.นพ.ว ระเดช พ ศประเสร ฐ สาขาว ชาโภชนว ทยาคล น ก ภาคว ชาอาย รศาสตร คณะแพทยศาสตร มหาว ทยาล
More informationChief of Endocrinology East Orange General Hospital
Targeting the Incretins System: Can it Improve Our Ability to Treat Type 2 Diabetes? Darshi Sunderam, MD Darshi Sunderam, MD Chief of Endocrinology East Orange General Hospital Age-adjusted Percentage
More informationDiv. of Endocrinology and Metabolism Konyang University, School of Medicine. Byung-Joon Kim M.D., Ph.D.
Diabetes and Thyroid Center Div. of Endocrinology and Metabolism Konyang University, School of Medicine Byung-Joon Kim M.D., Ph.D. Background Incretin effect and GLP 1 Receptor in L cells TGR5 receptor
More information/05/$15.00/0 Molecular Endocrinology 19(5): Copyright 2005 by The Endocrine Society doi: /me
0888-8809/05/$15.00/0 Molecular Endocrinology 19(5):1343 1360 Printed in U.S.A. Copyright 2005 by The Endocrine Society doi: 10.1210/me.2003-0493 Elevated Glucose Attenuates Human Insulin Gene Promoter
More informationENERGY FROM INGESTED NUTREINTS MAY BE USED IMMEDIATELY OR STORED
QUIZ/TEST REVIEW NOTES SECTION 1 SHORT TERM METABOLISM [METABOLISM] Learning Objectives: Identify primary energy stores of the body Differentiate the metabolic processes of the fed and fasted states Explain
More informationGut hormones KHATTAB
Gut hormones PROF:ABD ALHAFIZ HASSAN KHATTAB Gut as an endocrine gland The talk will cover the following : Historical background. Why this subject is chosen. Gastro-intestinal hormones and their function.
More informationType 2 DM in Adolescents: Use of GLP-1 RA. Objectives. Scope of Problem: Obesity. Background. Pathophysiology of T2DM
Type 2 DM in Adolescents: Use of GLP-1 RA Objectives Identify patients in the pediatric population with T2DM that would potentially benefit from the use of GLP-1 RA Discuss changes in glycemic outcomes
More information22 Emerging Therapies for
22 Emerging Therapies for Treatment of Type 2 Diabetes Siddharth N Shah Abstract: The prevalence of Diabetes is progressively increasing world-wide and the growth of the disease in our country is phenomenal.
More informationEAT TO LIVE: THE ROLE OF THE PANCREAS. Felicia V. Nowak, M.D., Ph.D. Ohio University COM 22 January, 2008
EAT TO LIVE: THE ROLE OF THE PANCREAS Felicia V. Nowak, M.D., Ph.D. Ohio University COM 22 January, 2008 THE ROLE OF THE PANCREAS Exocrine pancreas Endocrine pancreas THE ROLE OF THE PANCREAS EXOCRINE
More informationPrinciples of Genetics and Molecular Biology
Cell signaling Dr. Diala Abu-Hassan, DDS, PhD School of Medicine Dr.abuhassand@gmail.com Principles of Genetics and Molecular Biology www.cs.montana.edu Modes of cell signaling Direct interaction of a
More informationIntracellular signalling cascades associated with TRP channels
Gerald Thiel Intracellular signalling cascades associated with TRP channels Current state of investigations and potential applications Saarland University, Germany Campus Saarbrücken Department of Medical
More informationPractical Strategies for the Clinical Use of Incretin Mimetics CME/CE. CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010
Practical Strategies for the Clinical Use of Incretin Mimetics CME/CE Robert R. Henry, MD Authors and Disclosures CME/CE Released: 09/15/2009; Valid for credit through 09/15/2010 Introduction Type 2 diabetes
More information/06/$15.00/0 Molecular Endocrinology 20(9): Copyright 2006 by The Endocrine Society doi: /me
0888-8809/06/$15.00/0 Molecular Endocrinology 20(9):2062 2079 Printed in U.S.A. Copyright 2006 by The Endocrine Society doi: 10.1210/me.2005-0316 Androgens, Progestins, and Glucocorticoids Induce Follicle-Stimulating
More informationDiscussion & Conclusion
Discussion & Conclusion 7. Discussion DPP-4 inhibitors augment the effects of incretin hormones by prolonging their half-life and represent a new therapeutic approach for the treatment of type 2 diabetes
More informationResult of screening and surveillance colonoscopy in young Korean adults < 50 years
SEP 25, 2017 Result of screening and surveillance colonoscopy in young Korean adults < 50 years Jae Myung Cha, MD. PhD. Department of Internal Medicine, Kyung Hee University Hospital at Gang Dong, Kyung
More informationGLUCAGON LIKE PEPTIDE (GLP) 1 AGONISTS FOR THE TREATMENT OF TYPE 2 DIABETES, WEIGHT CONTROL AND CARDIOVASCULAR PROTECTION.
GLUCAGON LIKE PEPTIDE (GLP) 1 AGONISTS FOR THE TREATMENT OF TYPE 2 DIABETES, WEIGHT CONTROL AND CARDIOVASCULAR PROTECTION. Patricia Garnica MS, ANP-BC, CDE, CDTC Inpatient Diabetes Nurse Practitioner North
More informationFigure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
More informationThe Mediterranean Diet: HOW and WHY It Works So Well for T2DM
The Mediterranean Diet: HOW and WHY It Works So Well for T2DM Susan L. Barlow, RD, CDE. Objectives 1. Discuss the effects of meal size on GLP-1 concentrations. 2. Compare and contrast the specific effects
More informationNew and Emerging Therapies for Type 2 DM
Dale Clayton MHSc, MD, FRCPC Dalhousie University/Capital Health April 28, 2011 New and Emerging Therapies for Type 2 DM The science of today, is the technology of tomorrow. Edward Teller American Physicist
More informationThe enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans
The enteroinsular axis in the pathogenesis of prediabetes and diabetes in humans Young Min Cho, MD, PhD Division of Endocrinology and Metabolism Seoul National University College of Medicine Plasma glucose
More informationEndocrine Notes Mrs. Laux AP Biology I. Endocrine System consists of endocrine glands (ductless), cells, tissues secrete hormones
I. Endocrine System consists of endocrine glands (ductless), cells, tissues secrete hormones regulates metabolism, fluid balance, growth, reproduction A. Hormones 1. chemical signals-cell to cell communication
More informationSupplementary Figures. T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ
Supplementary Figures T Cell Factor-1 initiates T helper 2 fate by inducing GATA-3 and repressing Interferon-γ Qing Yu, Archna Sharma, Sun Young Oh, Hyung-Geun Moon, M. Zulfiquer Hossain, Theresa M. Salay,
More informationSupplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
More informationHormones. Prof. Dr. Volker Haucke Institut für Chemie-Biochemie Takustrasse 6
Hormones Prof. Dr. Volker Haucke Institut für Chemie-Biochemie Takustrasse 6 Tel. 030-8385-6920 (Sekret.) 030-8385-6922 (direkt) e-mail: vhaucke@chemie.fu-berlin.de http://userpage.chemie.fu-berlin.de/biochemie/aghaucke/teaching.html
More informationGLP-1 agonists. Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK
GLP-1 agonists Ian Gallen Consultant Community Diabetologist Royal Berkshire Hospital Reading UK What do GLP-1 agonists do? Physiology of postprandial glucose regulation Meal ❶ ❷ Insulin Rising plasma
More informationNiki Prakoura. Calreticulin upregulation in renal fibrosis
Calreticulin upregulation in renal fibrosis Niki Prakoura Section of Histology, Center of Basic Research, Biomedical Research Foundation of the Academy of Athens, Athens, Greece EuroKUP meeting, Madrid,
More informationSUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.
Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental
More informationTreating Type 2 Diabetes with Bariatric Surgery. Goal of Treating T2DM. Remission of T2DM with Bariatric
Treating Type 2 Diabetes with Bariatric Surgery Number (in Millions) of Persons with Diagnosed Diabetes, United States, 198 25 The number of Americans with diabetes increased from 5.6 to 15.8 million Guilherme
More informationELSEVIER: UNCORRECTED PROOF
Glucagon Gene Expression DANIEL J. DRUCKER University of Toronto I. PROGLUCAGON GENE STRUCTURE AND POSTTRANSLATIONAL PROGLUCAGON PROCESSING II. PROGLUCAGON GENE EXPRESSION IN THE PANCREAS III. PROGLUCAGON
More informationFH- FH+ DM. 52 Volunteers. Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ACADSB MYSM1. Mouse Skeletal Muscle
A 52 Volunteers B 6 5 4 3 2 FH- FH+ DM 1 Oral & IV Glucose Tolerance Test Hyperinsulinemic Euglycemic Clamp in Non-DM Subjects ZYX EGR2 NR4A1 SRF target TPM1 ACADSB MYSM1 Non SRF target FH- FH+ DM2 C SRF
More information18. PANCREATIC FUNCTION AND METABOLISM. Pancreatic secretions ISLETS OF LANGERHANS. Insulin
18. PANCREATIC FUNCTION AND METABOLISM ISLETS OF LANGERHANS Some pancreatic functions have already been discussed in the digestion section. In this one, the emphasis will be placed on the endocrine function
More informationCB2-mediated immunoregulation in Inflammatory Bowel Disease. David Ziring, MD Clinical Instructor, UCLA Div of Peds GI
CB2-mediated immunoregulation in Inflammatory Bowel Disease David Ziring, MD Clinical Instructor, UCLA Div of Peds GI Overview Why study cannabinoid signaling in intestinal immunoregulation? G_i2 -/- mice
More informationNeuroprotective properties of GLP-1 - a brief overview. Michael Gejl Jensen, MD Dept. Of Pharmacology, AU
Neuroprotective properties of GLP-1 - a brief overview Michael Gejl Jensen, MD Dept. Of Pharmacology, AU mg@farm.au.dk Agenda Glucagon-like peptide (GLP-1) GLP-1 and neuronal activity GLP-1 in disease-specific
More informationSupplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationEffect of macronutrients and mixed meals on incretin hormone secretion and islet cell function
Effect of macronutrients and mixed meals on incretin hormone secretion and islet cell function Background. Following meal ingestion, several hormones are released from the gastrointestinal tract. Some
More informationEgr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators
/, 2017, Vol. 8, (No. 53), pp: 91425-91444 Egr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators Roni Sarkar 1 and Subhash C. Verma 1 1 Department of Microbiology
More informationPredictive PP1Ca binding region in BIG3 : 1,228 1,232aa (-KAVSF-) HEK293T cells *** *** *** KPL-3C cells - E E2 treatment time (h)
Relative expression ERE-luciferase activity activity (pmole/min) activity (pmole/min) activity (pmole/min) activity (pmole/min) MCF-7 KPL-3C ZR--1 BT-474 T47D HCC15 KPL-1 HBC4 activity (pmole/min) a d
More informationDeregulation of CREB Signaling Pathway Induced by Chronic Hyperglycemia Downregulates NeuroD Transcription
Deregulation of CREB Signaling Pathway Induced by Chronic Hyperglycemia Downregulates NeuroD Transcription In-Su Cho 1,3,4, Miyoung Jung 2, Ki-Sun Kwon 7, Eunpyo Moon 2, Jang-Hyeon Cho 8, Kun-Ho Yoon 9,
More informationBariatric Surgery MM /11/2001. HMO; PPO; QUEST 05/01/2012 Section: Surgery Place(s) of Service: Outpatient; Inpatient
Bariatric Surgery Policy Number: Original Effective Date: MM.06.003 09/11/2001 Line(s) of Business: Current Effective Date: HMO; PPO; QUEST 05/01/2012 Section: Surgery Place(s) of Service: Outpatient;
More informationRoux-and-Y Gastric Bypass and its Metabolic Effects
Roux-and-Y Gastric Bypass and its Metabolic Effects Nicola Di Lorenzo President elect of SICOb Italian Society for Bariatric Surgery and Metabolic Diseases Dept. of General Surgery-Università di Roma Tor
More informationCellular Signaling Pathways. Signaling Overview
Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the
More informationData Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621
Data Sheet NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Background The nuclear factor of activator T cells (NFAT) family of transcription factors plays an important role in immune response. T
More informationHormonal regulation of. Physiology Department Medical School, University of Sumatera Utara
Hormonal regulation of nutrient metabolism Physiology Department Medical School, University of Sumatera Utara Homeostasis & Controls Successful compensation Homeostasis reestablished Failure to compensate
More informationCells and Tissues 3PART C. PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College
PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College Cells and Tissues 3PART C Protein Synthesis Gene DNA segment that carries a blueprint for building
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More information/05/$15.00/0 Molecular Endocrinology 19(10): Copyright 2005 by The Endocrine Society doi: /me
0888-8809/05/$15.00/0 Molecular Endocrinology 19(10):2610 2623 Printed in U.S.A. Copyright 2005 by The Endocrine Society doi: 10.1210/me.2005-0047 Activin Regulates Luteinizing Hormone -Subunit Gene Expression
More informationCell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
More informationMy Journey in Endocrinology. Samuel Cataland M.D
My Journey in Endocrinology Samuel Cataland M.D. 1968-2015 Drs Berson M.D. Yalow phd Insulin Radioimmunoassay Nobel Prize Physiology or Medicine 1977 Rosalyn Yalow: Radioimmunoassay Technology Andrew Schally
More informationImproving Diabetes Research: Moving Beyond Animal Models. Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D.
Improving Diabetes Research: Moving Beyond Animal Models Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D. July 19, 2014 From Bench-to-Bedside Sulfonylurea Biguanide Dipeptidyl peptidase-4 inhibitor Glucagon-like
More informationLecture 15. Signal Transduction Pathways - Introduction
Lecture 15 Signal Transduction Pathways - Introduction So far.. Regulation of mrna synthesis Regulation of rrna synthesis Regulation of trna & 5S rrna synthesis Regulation of gene expression by signals
More informationManagement of Type 2 Diabetes
Management of Type 2 Diabetes Pathophysiology Insulin resistance and relative insulin deficiency/ defective secretion Not immune mediated No evidence of β cell destruction Increased risk with age, obesity
More informationPANCREATIC BETA CELLS PRODUCE AND SECRETE
15 March, 2018 PANCREATIC BETA CELLS PRODUCE AND SECRETE Document Filetype: PDF 374.06 KB 0 PANCREATIC BETA CELLS PRODUCE AND SECRETE Among the oldest and cheapest drugs for diabetes are the drugs that
More informationNUTRIENT DIGESTION & ABSORPTION
NUTRIENT DIGESTION & ABSORPTION NUTR 2050: Nutrition for Nursing Professionals Mrs. Deborah A. Hutcheon, MS, RD, LD Lesson Objectives At the end of the lesson, the student will be able to: 1. Differentiate
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationReceptor mediated Signal Transduction
Receptor mediated Signal Transduction G-protein-linked receptors adenylyl cyclase camp PKA Organization of receptor protein-tyrosine kinases From G.M. Cooper, The Cell. A molecular approach, 2004, third
More informationNovel Physiological Role of Caveolin-1 in Aging and Aging-related Diseases. Sang Chul Park Gachon University Lee Gil Ya Cancer and Diabetes Institute
Novel Physiological Role of Caveolin-1 in Aging and Aging-related Diseases Sang Chul Park Gachon University Lee Gil Ya Cancer and Diabetes Institute Primarily I asked questions on biological issues on
More informationSupplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
More informationHormonal Regulations Of Glucose Metabolism & DM
Hormonal Regulations Of Glucose Metabolism & DM What Hormones Regulate Metabolism? What Hormones Regulate Metabolism? Insulin Glucagon Thyroid hormones Cortisol Epinephrine Most regulation occurs in order
More informationGLP 1 agonists Winning the Losing Battle. Dr Bernard SAMIA. KCS Congress: Impact through collaboration
GLP 1 agonists Winning the Losing Battle Dr Bernard SAMIA KCS Congress: Impact through collaboration CONTACT: Tel. +254 735 833 803 Email: kcardiacs@gmail.com Web: www.kenyacardiacs.org Disclosures I have
More informationOat beta glucan: Multiple roles in the gut. A.R. Mackie, B.H. Bajka, B. Kirkhus
Oat beta glucan: Multiple roles in the gut A.R. Mackie, B.H. Bajka, B. Kirkhus Introduction Food is consumed Food resides in the stomach Chyme is gradually emptied into the duodenum Can oat beta glucan
More informationThe Effects of Exenatide on the Autoimmune Development of Diabetes. A Senior Honors Thesis
The Effects of Exenatide on the Autoimmune Development of Diabetes A Senior Honors Thesis Presented in Partial Fulfillment of the Requirements for Graduation with Distinction in Microbiology in the Undergraduate
More informationGLP-1. GLP-1 is produced by the L-cells of the gut after food intake in two biologically active forms It is rapidly degraded by DPP-4.
GLP-1 GLP-1 is produced by the L-cells of the gut after food intake in two biologically active forms It is rapidly degraded by DPP-4 Food intake éinsulin Gut églucose uptake Pancreas Beta cells Alpha cells
More informationGenerating Mouse Models of Pancreatic Cancer
Generating Mouse Models of Pancreatic Cancer Aom Isbell http://www2.massgeneral.org/cancerresourceroom/types/gi/index.asp Spring/Summer 1, 2012 Alexandros Tzatsos, MD PhD Bardeesy Lab: Goals and Objectives
More informationControl of Glucose Metabolism
Glucose Metabolism Control of Glucose Metabolism The pancreas is both an exocrine and endocrine gland. It secretes digestive enzymes into the duodenum (exocrine) and 3 specific hormones into the bloodstream
More informationHistory of Investigation
Acini - Pancreatic juice (1º) (2º) Secretions- neuronal and hormonal mechanisms 1) Secretin - bicarbonate rich 2) Cholecystokinin - enzyme rich Islets of Langerhans (contain 4 cell types) Alpha cells (α)-
More informationa b c Physical appearance of mice Lean mass Adipocyte size d e f
LFD HFD LFD HFD Area under curve (GTT) HFD-VSL#3 LFD HFD Area under curve (ITT) HFD-VSL#3 Liver TG content (% l) HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD-VSL#3 LFD HFD HFD + VSL#3 Lean mass (gm) Mean adipocyte
More informationGene expression in insulin resistance
Gene expression in insulin resistance Name: Jules Jacobs Date: 4-7-2017 Supervisors: - Mirella Kalafati MSc - Dr. Lars Eijssen Department of Bioinformatics BACKGROUND Obesity Defined as: BMI > 30 kg/m
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature89 IFN- (ng ml ) 5 4 3 1 Splenocytes NS IFN- (ng ml ) 6 4 Lymph node cells NS Nfkbiz / Nfkbiz / Nfkbiz / Nfkbiz / IL- (ng ml ) 3 1 Splenocytes IL- (ng ml ) 1 8 6 4 *** ** Lymph node cells
More informationSupplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More informationHormones. BIT 230 Walsh Chapter 8
Hormones BIT 230 Walsh Chapter 8 Hormones Regulatory molecules Affect all areas of metabolism Endocrine- hormones travel via the bloodstream to its target cell: true hormone Modern definition- any regulatory
More informationPreceptorship at the Yonsei Cancer Center Gastric Cancer Team. Date : July, 2018 Place: Yonsei Cancer Center, Seoul, Korea
Preceptorship at the Yonsei Cancer Center Gastric Cancer Team Date : July, 2018 Place: Yonsei Cancer Center, Seoul, Korea 1 I. Main Topics: - Gastric cancer II. Delegates: Medical oncologists, radiation
More informationFinal Review Sessions. 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office Hours
Final Review Sessions 3/16 (FRI) 126 Wellman (4-6 6 pm) 3/19 (MON) 1309 Surge 3 (4-6 6 pm) Office ours 3/14 (WED) 9:30 11:30 am (Rebecca) 3/16 (FRI) 9-11 am (Abel) Final ESSENTIALS Posted Lecture 20 ormonal
More informationIncretins: Their physiology and application in the treatment of diabetes mellitus
DIABETES/METABOLISM RESEARCH AND REVIEWS Diabetes Metab Res Rev 2014; 30: 354 371. Published online in Wiley Online Library (wileyonlinelibrary.com).2501 REVIEW ARTICLE Incretins: Their physiology and
More informationInjectable GLP 1 therapy: weight loss effects seen in obesity with and without diabetes
Injectable GLP 1 therapy: weight loss effects seen in obesity with and without diabetes Dr Masud Haq Consultant Lead in Diabetes & Endocrinology Maidstone & Tunbridge Wells NHS Trust & The London Preventative
More informationSupplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress
Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,
More informationSupplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5
Supplementary Information Induction of p53-independent apoptosis by ectopic expression of in human liposarcomas Dhong Hyun Lee 1, *, Charles Forscher 1, Dolores Di Vizio 2, 3, and H. Phillip Koeffler 1,
More informationGene therapy: State of the art. Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona.
Gene therapy: State of the art Ramon Gomis MD, PhD, MAE. Hospital Clínic. IDIBAPS. University of Barcelona. Gene Therapy: First Steps Type 1 diabetes: An islet disease Alpha cell Beta cell Pancreatic
More informationINTRODUCTION. Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells
Induction of Monocyte Chemoattractant Protein-1 (MCP-1) Expression by Angiotensin II (AngII) in the Pancreatic Islets and Beta Cells Galina Chipitsyna, Qiaoke Gong, Chance F. Gray et al. Endocrinology,
More informationSupplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
More information2013 W. H. Freeman and Company. 12 Signal Transduction
2013 W. H. Freeman and Company 12 Signal Transduction CHAPTER 12 Signal Transduction Key topics: General features of signal transduction Structure and function of G protein coupled receptors Structure
More informationPramlintide & Weight. Diane M Karl MD. The Endocrine Clinic & Oregon Health & Science University Portland, Oregon
Pramlintide & Weight Diane M Karl MD The Endocrine Clinic & Oregon Health & Science University Portland, Oregon Conflict of Interest Speakers Bureau: Amylin Pharmaceuticals Consultant: sanofi-aventis Grant
More informationGrowth Hormone, Somatostatin, and Prolactin 1 & 2 Mohammed Y. Kalimi, Ph.D.
Growth Hormone, Somatostatin, and Prolactin 1 & 2 Mohammed Y. Kalimi, Ph.D. I. Growth Hormone (somatotropin): Growth hormone (GH) is a 191 amino acid single chain polypeptide (MW 22,000 daltons). Growth
More informationRegulation of cell function by intracellular signaling
Regulation of cell function by intracellular signaling Objectives: Regulation principle Allosteric and covalent mechanisms, Popular second messengers, Protein kinases, Kinase cascade and interaction. regulation
More informationNew Drug Development for Hepatic Insulin Resistance
New Drug Development for Hepatic Insulin Resistance Innovative Drug Research Center for Metabolic and Inflammatory Disease College of Pharmacy Sang Geon Kim AMPK as an energy sensor, (A novel drug target
More informationNeurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction. Laura Gunter
Neurophysiology of the Regulation of Food Intake and the Common Reward Pathways of Obesity and Addiction Laura Gunter The Brain as the Regulatory Center for Appetite The brain is the integration center
More informationFor more information about how to cite these materials visit
Author: John Williams, M.D., Ph.D., 2009 License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution Non-commercial Share Alike 3.0 License: http://creativecommons.org/licenses/by-nc-sa/3.0/
More informationSupplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
More informationSweetness and Glycaemic Regulation. (A focus on gut related and physiological aspects) John McLaughlin Manchester University
Sweetness and Glycaemic Regulation (A focus on gut related and physiological aspects) John McLaughlin Manchester University Disclosures No personal conflicts of interest Funding from BBSRC, including Cargill
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationglucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
More informationHORMONES AND CELL SIGNALLING
HORMONES AND CELL SIGNALLING TYPES OF CELL JUNCTIONS CHEMICAL SIGNALS AND MODES OF ACTION Endocrine system produces chemical messages = hormones that are transported from endocrine gland to target cell
More informationMaking Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes
University of British Columbia Departments of Surgery and Cellular & Physiological Sciences Making Mature Human Islet Cells from Stem Cells to Model Disease and Treat Diabetes 2016 International Conference
More informationGLP-1 Receptor Agonists and SGLT-2 Inhibitors. Debbie Hicks
GLP-1 Receptor Agonists and SGLT-2 Inhibitors Debbie Hicks Prescribing and Adverse Event reporting information is available at this meeting from the AstraZeneca representative The views expressed by the
More information