/05/$15.00/0 Molecular Endocrinology 19(5): Copyright 2005 by The Endocrine Society doi: /me

Transcription

1 /05/$15.00/0 Molecular Endocrinology 19(5): Printed in U.S.A. Copyright 2005 by The Endocrine Society doi: /me Elevated Glucose Attenuates Human Insulin Gene Promoter Activity in INS-1 Pancreatic -Cells via Reduced Nuclear Factor Binding to the A5/Core and Z Element Maria F. Pino,* Diana Z. Ye,* Katrina D. Linning, Christopher D. Green, Barton Wicksteed, Vincent Poitout, and L. Karl Olson Departments of Physiology (M.F.P., K.D.L., L.K.O.), Pharmacology (D.Z.Y.), and Biochemistry and Molecular Biology (C.D.G.), Michigan State University, East Lansing, Michigan 48824; Pacific Northwest Research Institute (B.W., V.P.), Seattle, Washington 98122; and Department of Medicine (V.P.), University of Washington, Seattle, Washington Chronic exposure of pancreatic -cells to elevated glucose reduces insulin gene promoter activity, and this is associated with diminished binding of two -cell-enriched transcription factors, Pdx-1 and MafA. In this study using INS-1 -cells, overexpression of MafA, but not Pdx-1, was able to restore expression of a human insulin reporter gene ( 327 to 30 bp) suppressed by elevated glucose. At issue, however, was that MafA also markedly stimulated an insulin reporter gene ( 230 to 30 bp) that was only marginally suppressed by glucose, suggesting that glucose-mediated suppression of the insulin promoter involved elements upstream of 230. Using serial truncations and minienhancer constructs of the human insulin promoter, the majority of glucose suppression was localized to regulatory elements between 327 and 261. Nuclear extracts from INS-1 cells exposed to elevated glucose had reduced binding activities to the A5/core ( 319 to 307), and to a GLUCOSE EXERTS A number of positive effects on pancreatic -cells, including stimulation of insulin secretion, insulin gene transcription and translation, and cell growth, that contribute to the tight control of glucose homeostasis. Chronic hyperglycemia, however, can negatively impact -cell function, in part, by altering -cell gene expression (1, 2) and survival (3) through a process called glucose toxicity. One of the hallmarks of glucose toxicity is a reduction in insulin gene expression (1, 2, 4 12) that results from decreased insulin promoter activity (4 6, 13, 14). In First Published Online January 13, 2005 * M.F.P. and D.Z.Y. contributed equally to this work. Abbreviations: CAT, Chloramphenicol acetyltransferase; C/EBP, CAAT/enhancer binding protein ; CMV, cytomegalovirus; FBS, fetal bovine serum; NRE, negative regulatory element; Pdx-1, pancreatic duodenal homeobox factor 1; SV40, simian virus 40. Molecular Endocrinology is published monthly by The Endocrine Society ( the foremost professional society serving the endocrine community. palindrome ( 284 to 267) and an E box ( 273 to 257, E3) contained within the Z element. The A5/ core binding complex was determined to contain MafA, Pdx-1, and an A2-like binding factor. Two minienhancer constructs containing the A5/core were suppressed by glucose and strongly activated by MafA. Glucose-mediated suppression of the Z minienhancer was not attenuated by overexpression of MafA or Pdx-1. Site-directed mutation of the A5/core, palindrome, and E3 elements attenuated glucose-mediated suppression. These data indicate that glucose suppression of human insulin promoter activity in INS-1 cells involves reduced binding of MafA to the A5/core. Changes in nuclear factor binding to the Z element, which functions as a strong activator element in primary islets and a negative regulatory element in simian virus 40 or T antigen transformed -cell lines, also participate in glucose suppression of insulin promoter activity. (Molecular Endocrinology 19: , 2005) vitro and in vivo studies have shown that prolonged elevations of glucose reduce the expression and/or binding of -cell-enriched transcription factors including the pancreatic duodenal homeobox factor 1 (Pdx-1) (1, 6 12, 14, 15) and the C1 activator [also known as RIPE3b1/MafA (16, 17)] (5, 6, 13, 18), and increased expression of CAAT/enhancer binding protein (C/EBP ) (8, 19) and c-myc (11, 20). Because Pdx-1 plays a critical role in pancreas development (21 23) and maintenance of -cell function by regulating the expression of -cell-enriched genes, including insulin, glucose transporter 2, and glucokinase (24 27), a loss of Pdx-1 expression and/or binding is predicted to markedly affect pancreatic -cell phenotype and function. We have previously reported that exposure of the highly differentiated rat insulinoma cell line, INS-1, to elevated glucose concentrations suppressed insulin promoter activity and mrna levels within 24 h (6). The suppression of insulin promoter activity was associated with a reduction in the binding activities of both 1343

2 1344 Mol Endocrinol, May 2005, 19(5): Pino et al. Glucose-Suppressed Insulin Promoter Activity Pdx-1 and C1 activator. It is shown herein that overexpression of Pdx-1 in INS-1 cells was insufficient to prevent glucose suppression of insulin promoter activity. In contrast, MafA overexpression strongly stimulated insulin promoter in cells cultured in both low and high glucose. At issue, however, is that MafA can activate a human insulin reporter gene regulated by sequences from 230 to 30 that is only marginally suppressed by elevated glucose. This observation prompted us to assess whether other sequences proximal to the 230 insulin promoter were involved in glucose suppression of insulin gene transcription. Serial truncation analysis of a human insulin reporter gene demonstrated that the majority of glucose-mediated suppression of insulin promoter activity maps to regulatory elements between 327 and 261, significantly upstream from the well-characterized A3 and A1 elements, and C1 element that serve as binding sites for Pdx-1 and MafA, respectively. Previous studies have shown that this region of the human insulin promoter contains the Z element ( 292 to 243) that functions both as a strong glucose-responsive transcriptional enhancer in primary islet cells (28, 29) and as a negative regulatory element (NRE) in simian virus 40 (SV40) or T antigen immortalized -cell lines and non- -cells (29 31). This region also contains the A5 element, which resembles a consensus Pdx-1 binding site, and the highly conserved enhancer core sequence (32), which binds a nuclear factor complex enriched in -cells (33). Because of the complexity of interactions in this region of the human insulin promoter, we have employed a number of human insulin minienhancers (five copies of a regulatory region in tandem) and a series of mutations in the human insulin promoter to map elements involved in glucose suppression of the insulin promoter. Finally, we have investigated glucose-mediated changes in binding activities to these upstream regulatory elements. RESULTS Glucose Regulates Insulin Promoter Activity in a Biphasic Manner in INS-1 Cells and Isolated Rat Islets Previous studies have shown that exposure of INS-1 cells to 16.7 mm glucose for h leads to marked suppression of insulin promoter activity (6). To assess the glucose dependency of this effect, INS-1 cells were transiently transfected with an insulin chloramphenicol acetyltransferase (CAT) reporter gene [INS( 327)CAT] in which CAT gene expression is regulated by 327 to 30 of the human insulin promoter (4). Several key regulatory elements have been identified in this promoter region including the A1 ( 82 to 77 bp) and A3 ( 215 to 210 bp), C1 ( 124 to 116 bp), and E1 ( 237 to 229 bp) (reviewed in Ref. 34), which serve as binding sites for -cell-enriched transcription factors including Pdx-1 (35), MafA (16, 17), and BETA2 (36), respectively (Fig. 1A). Additional upstream regulatory elements have been identified including the A5 ( 319 to 313 bp), enhancer core ( 313 to 307 bp), Z ( 292 to 261 bp), and NRE ( 279 to 265 bp) that can bind unidentified -cell-enriched nuclear factors (29, 31, 33). Incubation of the cells in 6 mm glucose for 48 h increased 327 insulin promoter activity fold (P 0.01) compared with cells incubated in 2 mm glucose (Fig. 1B). In contrast, incubation of cells in glucose concentrations greater than 8 mm glucose led to a concentration-dependent reduction in insulin promoter activity. Overall, incubation of INS-1 cells in media containing 16.7 mm glucose led to an % (P 0.005) reduction in insulin promoter activity compared with cells incubated in 4 mm glucose. Reductions in insulin promoter activity were not due to osmotic stress because treatment of INS-1 cells with 4 mm glucose plus 12.7 mm mannitol caused no significant change in insulin promoter activity (data not shown). We have previously reported that incubation of INS-1 cells in 16.7 mm glucose for 48 h also caused a reduction in binding activities of Pdx-1 and the C1 activator [RIPE 3b1/MafA (16, 17)] (6). Because the A1 and A3 elements and the C1 element serve as binding sites for Pdx-1 and MafA, respectively, a more simplified reporter gene regulated by promoter sequences from 230 to 30 [INS( 230)CAT] was examined for glucose-mediated suppression. Deletion of insulin promoter sequences from 327 to 231 led to a large (68%) reduction in expression of INS( 230)CAT when compared with INS( 327)CAT (Fig. 1C). More importantly, deletion of the upstream promoter sequences led to an unexpected reduction in glucose-mediated suppression of insulin promoter activity. It should also be noted that activities of the 230 and 327 promoters were nearly equivalent when cells were incubated in high glucose. Thus, major sites of glucose-mediated suppression must reside in insulin promoter sequences upstream of 230. To assess glucose regulation of insulin promoter activity in primary rat islets, islets were infected with an adenovirus that has the luciferase gene under transcription control of the rat 1 insulin gene promoter sequences 310 to 12 (Ad-RIP1-Luc), or with a control adenovirus encoding for luciferase under the control of the cytomegalovirus (CMV) promoter (Ad-CMV-Luc). Infected islets were cultured for 24 h with increasing glucose concentrations, and luciferase activity was measured. As observed with INS-1 cells, glucose regulated the rat 1 insulin promoter in a biphasic manner (Fig. 1D), with an initial increase up to 16.7 mm and a marked decrease at 22.2 mm glucose.

3 Pino et al. Glucose-Suppressed Insulin Promoter Activity Mol Endocrinol, May 2005, 19(5): Fig. 1. Glucose Regulates Insulin Promoter Activity in a Biphasic Manner in INS-1 Cells and Isolated Rat Islets A, Schematic representation of human insulin promoter sequences from 327 to 75 showing the location of known regulatory elements and some of the identified transcription factors. Binding complexes that contain uncharacterized transcription factors are italicized. Question marks represent unidentified -cell-enriched binding factors. The Z element and NRE contain a palindrome sequence and E box that are labeled Pal and E3, respectively. B, INS-1 cells were transiently transfected with 1 g INS( 327)CAT and incubated in media containing the indicated glucose concentrations. Cells were harvested 48 h after transfection, and CAT activity was assayed. CAT activities are reported as the mean SEM for four independent experiments. C, Glucose repression of the 327 insulin promoter [INS( 327)CAT] vs. the 230 insulin promoter [INS( 230)CAT]. CAT activities are reported as the mean SEM for five independent experiments. *, P 0.05 for CAT expression in cells treated with 4 mm vs mm glucose. D, Rat islets were infected with Ad-RIP1-Luc or Ad-CMV-Luc and incubated in media containing the indicated glucose concentrations. Cells were harvested 24 h after glucose treatment, and luciferase activity was assayed. Results are expressed as the ratio of Ad-RIP1-Luc to Ad-CMV-Luc activity. NFAT, Nuclear factor of activated T cells; USF, upstream stimulatory factor; CRE, camp response element; CREB, CRE-binding protein; CREM, CRE modulator; NFY, nuclear factor Y; HEB, HeLa E-box-binding factor.

4 1346 Mol Endocrinol, May 2005, 19(5): Pino et al. Glucose-Suppressed Insulin Promoter Activity MafA, but not Pdx-1, Increases Insulin Promoter Activity in INS-1 Cells Cultured in Elevated Glucose Concentrations Pdx-1 or MafA were overexpressed in INS-1 cells to test their relative abilities to attenuate glucosemediated suppression of insulin promoter activity. Increased expression of Pdx-1 in cells treated with elevated glucose was unable to restore activity of the 327 insulin promoter [INS( 327)CAT] (Fig. 2A). In contrast, increased expression of MafA strongly activated the 327 insulin promoter under identical culture conditions (Fig. 2B). MafA also strongly activated the 230 insulin promoter [INS( 230)CAT] (Fig. 2C), whereas Pdx-1 remained completely ineffective (data not shown). These results can be interpreted in two ways: either that loss of MafA, but not Pdx-1, accounts for loss of insulin promoter activity, or that MafA increases insulin promoter activity as a whole and thus overrides the inhibition by glucose without representing a mechanism of action of glucose per se. This latter possibility is supported by the observation that the 230 insulin promoter was not suppressed by elevated glucose to the level seen for the 327 insulin promoter (Fig. 1C). Upstream Regulatory Elements Play a Major Role in Glucose-Mediated Repression of Insulin Promoter Activity To determine upstream elements involved in glucose repression of insulin promoter activity, a series truncated insulin reporter genes were constructed (Fig. 1A). Incubation of INS-1 cells in 16.7 mm glucose for 48 h led to a % suppression of INS( 327)CAT expression compared with cells incubated in 4 mm glucose (Fig. 3). Deletion of promoter sequences from 327 to 292 [INS( 292)CAT], which removes the A5/core, caused a 2-fold increase in CAT expression in both 4 and 16.7 mm glucose compared with INS( 327)CAT. Removal of these sequences also decreased glucose-mediated suppression of promoter activity to %. Deletion of promoter sequences from 327 to 279 [INS( 279)CAT], which removes the A5/core element and destroys a palindrome sequence contained in the Z minienhancer (29) and NRE (30, 31), further reduced the ability of 16.7 mm glucose to suppress insulin promoter ( %). Removal of promoter sequences from 327 to 261 [INS( 261)CAT], which deletes the A5/core element, palindrome element, and the E3 element contained in the NRE and Z minienhancer, did not further reduce the ability of 16.7 mm glucose to suppress insulin promoter activity. Overall, these data indicate that regulatory elements contained between 327 and 261 are involved in glucose-mediated suppression of the insulin promoter activity. Fig. 2. MafA, but Not Pdx-1, Increases Insulin Promoter Activity in INS-1 Cells Cultured in Elevated Glucose Concentrations INS-1 cells were transiently transfected with 1 g INS( 327)CAT or INS( 230)CAT and the indicated amounts of pcr3.1-cmv-pdx-1 or pcr3.1-cmv-mafa expression plasmids. Equivalent amounts of expression plasmid (0.5 g) was transfected per well by the addition of pcr3.1-cmv containing no insert. Cells were then incubated for 48 h in 4 or 16.7 mm glucose, after which CAT activity was assayed. A, Effect of Pdx-1 overexpression on INS( 327)CAT expression. Data are mean SEM for four independent experiments. B, Effect of MafA overexpression on INS( 327)CAT expression. C, Effect of MafA overexpression on INS( 230)CAT expression. Data for panels B and C are mean SEM for three independent experiments.

5 Pino et al. Glucose-Suppressed Insulin Promoter Activity Mol Endocrinol, May 2005, 19(5): Fig. 3. Upstream Regulatory Elements Play a Major Role in Glucose Repression of Insulin Promoter Activity INS-1 cells were transiently transfected with 1 g of INS( 327)CAT, INS( 292)CAT, INS( 279)CAT, INS( 261)CAT, INS( 250)CAT, or INS( 230)CAT and incubated in 4.0 mm or 16.7 mm glucose. Cells were harvested 48 h after transfection, and CAT activity was assayed. CAT activities are reported as the means SEM for 10 experiments. *, P 0.05 for CAT expression in cells treated with 4.0 mm vs mm glucose. See Fig. 1A for identification of regulatory elements removed in truncated promoters. Biphasic Regulation of Insulin Promoter Activity by Glucose Involves Sequences Contained within the Z Minienhancer of the Human Insulin Promoter Sander et al. (29) previously characterized glucose regulation of distal human insulin promoter sequences from 341 to 243 by use of multimerized (five copies) minienhancers linked to the 85 bp minimal promoter from the rat insulin 1 gene promoter. The distal human insulin promoter was divided into X ( 342 to 293), Y ( 317 to 268), and Z ( 292 to 243) minienhancers (Fig. 4A). The X and Y minienhancers both contain the A5 element ( 319 to 313) and enhancer core element ( 313 to 307), whereas the Y minienhancer also contains a palindrome sequence ( 284 to 279) (29). The Z minienhancer also contains the palindrome sequence ( 284 to 279) and two E box-like sequences separated by 4 bp ( 273 to 258) that we have termed the E3a and E3b. The Z minienhancer was further divided into the Za ( 292 to 262) and Zb ( 274 to 246) minienhancers. The Za minienhancer contains the palindrome sequence ( 284 to 279) and the E3a ( 273 to 268), whereas the Zb minienhancer contains the E3a and E3b ( 273 to 258). To further characterize regions of the distal insulin promoter that are involved in glucose suppression of insulin promoter activity, INS-1 cells were transfected with the various minienhancers and incubated for 48 h in increasing glucose concentrations. The 85 to 1 rat insulin 1 promoter was found to be slightly glucose responsive in INS-1 cells such that there was a fold (P 0.02) increase in CAT expression in cells incubated in 16.7 mm glucose when compared with 2 mm glucose (Fig. 4B). The Z minienhancer was shown to be extremely active in INS-1 cells (Fig. 4C) as reported for fetal and adult rat islets (29). As observed for INS( 327)CAT, incubation of INS-1 cells in 6 mm glucose increased Z minienhancer activity fold (P 0.001) compared with cells incubated in 2 mm glucose. Moreover, incubation of INS-1 cells in media containing 16.7 mm glucose led to a % (P 0.003) reduction in Z minienhancer activity compared with cells incubated in 4 mm glucose. In an attempt to further delineate potential regions within the Z minienhancer that participate in glucose repression of insulin promoter, INS-1 cells were transfected with the Za or Zb minienhancers. Expression of the Za and Zb minienhancers was markedly lower than the Z minienhancer (data not shown). Nevertheless, both the Za and Zb minienhancers exhibited a biphasic response to glucose such that an approximately 4-fold increase in expression was observed in 6 mm glucose, and a strong suppression was observed in 16.7 mm glucose (Table 1). These data suggest that the E3a element contained within both the Za and Zb minienhancers may mediate, in part, glucose activation and suppres-

6 1348 Mol Endocrinol, May 2005, 19(5): Pino et al. Glucose-Suppressed Insulin Promoter Activity Fig. 4. Biphasic Regulation of Insulin Promoter Activity by Glucose Involves Sequences Contained within the X and Z Minienhancers of the Human Insulin Promoter A, Schematic representation of insulin promoter elements from 340 to 210 bp. Minienhancers used in multimerized reporter genes as well as electrophoretic mobility shift probes are indicated. INS-1 cells were transiently transfected with CAT reporter genes containing five tandem copies of the Z (panel C) or X (panel D) minienhancer linked to the 85 bp minimal rat l insulin promoter. Cells were also transiently transfected with a CAT reporter gene regulated by the 85 bp minimal rat 1 insulin promoter (pfoxcat2) as a control (panel B). Cells were then cultured for 48 h in the indicated glucose concentrations, after which cells were harvested and CAT activity was assayed. CAT activity is expressed relative to expression of pfoxcat2 in cells cultured in 2.0 mm glucose. Values are the mean SEM of three independent experiments. sion of the insulin promoter. Alternatively, both the Za and Zb minienhancers may contain independent elements that are glucose responsive. In addition to the Z minienhancers, glucose regulation of the FF minienhancer was assessed in INS-1 cells. This minienhancer is under transcriptional regu-

7 Pino et al. Glucose-Suppressed Insulin Promoter Activity Mol Endocrinol, May 2005, 19(5): Table 1. Biphasic Regulation of Insulin Promoter Activity Also Involves Sequences Contained within the Y, Za, and Zb Minienhancers of the Human Insulin Gene Promoter Fold Response Reporter Gene 2.0 mm Glucose 4.0 mm Glucose 6.0 mm Glucose 16.7 mm Glucose Y minienhancer a a b Za minienhancer a a b Zb minienhancer a a b FF minienhancer a,b INS-1 cells were transfected with 85ripCAT reporter genes containing five tandem copies of the Y, Za, Zb, or FF minienhancer. Cells were then incubated in the indicated glucose concentrations for 48 h, after which CAT activity was assayed. CAT activity is expressed relative to activity in cells cultured in 2.0 mm glucose. For the Y, Za, and Zb minienhancers, values are the mean SEM of four experiments. For the FF minienhancer, values are the mean SEM of three experiments. a P 0.03 for CAT expression in cells treated with 2.0 mm vs. higher glucose concentrations. b P 0.03 for CAT expression in cells treated with 4.0 mm vs mm glucose. lation of five copies of the rat insulin 1 gene FAR-FLAT elements (37) and the minimal promoter of the rat insulin 1 gene. Importantly, the FAR-FLAT elements are comparable to the human E2-A3 elements that lay outside of the region that primarily accounts for glucose suppression (Fig. 1A). In INS-1 cells, increasing glucose concentrations led to increased expression of the FF minienhancer and, unlike the Z minienhancers, was not suppressed at 16.7 mm glucose (Table 1). These data strongly demonstrate that glucose suppression of the Z minienhancers is a function of the minienhancer sequences and not a generalized effect. Because Pdx-1 is a primary regulator of the FF minienhancer activity through its interaction at the FLAT region (A3 and A4 elements), this result supports the likelihood that glucose-mediated reductions in Pdx-1 binding activity do not account for loss of promoter activity. To test for glucose effects on nuclear factor DNA binding activity to elements located in the Z minienhancer, nuclear extracts were made from INS-1 cells grown for 48 h in 4 or 16.7 mm glucose. Because the palindrome sequences ( 284 to 279) and the E3a and E3b ( 273 to 258) are potential regulatory sites within the Z minienhancer, nuclear factor binding activity to a probe termed Zd ( 289 to 253; Fig. 4A) was examined by EMSA. As shown in Fig. 5A, four specific DNA-protein complexes were observed in cells incubated in either 4 or 16.7 mm glucose. Binding activity of the fastest migrating complex (Zd1) was consistently reduced in cells cultured in 16.7 mm glucose (Fig. 5A; compare lanes 2 and 3). In contrast, binding activity of the second fastest migrating complex (Zd2) was consistently induced in cells cultured in 16.7 mm glucose. Competition analysis showed that the slowest migrating complex (Zd4) was effectively competed for by the Za probe ( 292 to 263; Fig. 5A, lanes 10 and 11) that contains the palindrome and E3a element (Fig. 4A). The Zpal probe ( 289 to 268), however, was not capable of competing for any of the complexes by itself (Fig. 5A, lanes 6 and 7). Competition analysis showed that the E3 probe ( 278 to 253; Fig. 5A, lanes 8 and 9) could effectively compete for all the Zd binding complexes. The binding activities were not competed by the rat E1 probe (Fig. 5A, lanes 12 and 13). DNA-protein complexes similar to that observed for the Zd probe were also observed with an E3 probe ( 278 to 253)(Fig. 5B). Competition analysis showed that all E3 binding complexes were readily competed by unlabeled E3 probe. When the E3a and E3b sequences were mutated, the E3 probe no longer competed for the binding complexes. Because the Za minienhancer was markedly suppressed in elevated glucose concentrations (Table 1) and this minienhancer lacks the E3b element, it was important to determine whether there were any glucose-induced changes in binding activity to the Za minienhancer. As shown in Fig. 5C, three specific DNA-protein complexes were observed in nuclear extracts derived from cells incubated in 4 or 16.7 mm glucose. Complex Za2 was markedly reduced in nuclear extracts from cells incubated in 16.7 mm glucose (Fig. 5C, lanes 2 and 3). In contrast, complex Za3 was slightly induced. Mutation of bp 271 (T to G), which changes the third base pair of the E3a element, does not affect binding of the three DNA-protein complexes (Fig. 5C, lanes 4 and 5). In contrast, mutation of bp 273 (C to G), which changes the first base pair of the E3a element, led to loss of binding of both the Za1 and Za2 complexes (Fig. 5C, lanes 6 and 7). Mutation of bp 283 (C to A) and 282 (T to G) contained in the palindrome led to a complete loss in binding of all DNA-protein complexes (Fig. 5C, lanes 8 and 9). Overall, these data suggest that both the palindrome and E3a and E3b elements bind nuclear factors that are glucose sensitive. The X Minienhancer Also Contains Promoter Sequences Involved in Biphasic Regulation of Insulin Promoter Activity by Glucose Deletion of insulin promoter sequences from 327 to 292 led to a marked reduction in glucose-mediated suppression of insulin promoter activity (Fig. 3). This region of the insulin promoter contains the A5 element ( 319 to 313) (32), enhancer core element ( 313 to 307) (33, 38), and an E box-like element ( 300 to 295) that we have termed the E4. To determine the effect of glucose on this general region, INS-1 cells

8 1350 Mol Endocrinol, May 2005, 19(5): Pino et al. Glucose-Suppressed Insulin Promoter Activity Fig. 5. Elevated Glucose Concentrations Diminish Binding of Nuclear Proteins to the E3 Element Contained within the Z Minienhancer Nuclear extracts were isolated from INS-1 cells incubated for 48 h in 4.0 or 16.7 mm glucose and tested by EMSA for their ability to bind to DNA probes containing putative regulatory elements found within the Z minienhancer. A, EMSA of 32 P-labeled Zd probe. Competition with 100-fold molar excess of unlabeled Zd probe (lanes 4 and 5), Zpal probe (lanes 6 and 7), E3 probe (lanes 8 and 9), Za probe (lanes 10 and 11), and rat insulin E1 probe (lanes 12 and 13). B, EMSA of 32 P-labeled E3 probe. Competition with 100-fold molar excess of unlabeled E3 probe (lanes 4 and 5) and mutant E3 probe (me3, lanes 6 and 7). C, EMSA of 32 P-labeled Za probe (lanes 2 and 3) and 32 P-labeled Za probes containing mutations at 271 (lanes 4 and 5), 273 (lanes 6 and 7), or 282 and 283 (lanes 8 and 9). EMSA probe sequences and corresponding insulin promoter elements are indicated in Table 3 and Fig. 4A, respectively. Data shown are representative gels of a minimum of three independent experiments. FP, Free probe. were transfected with the X minienhancer reporter gene ( 342 to 292) and incubated for 48 h in increasing glucose concentrations. X minienhancer activity in INS-1 cells was magnitudes lower than that observed for Z minienhancer activity (Fig. 4, C and D) as previously observed in fetal rat islets (29). Incubation of INS-1 cells in 6 mm glucose led to a fold (P 0.01) increase in X minienhancer activity

9 Pino et al. Glucose-Suppressed Insulin Promoter Activity Mol Endocrinol, May 2005, 19(5): compared with cells cultured in 2 mm glucose (Fig. 4D). In contrast, incubation of cells in 16.7 mm glucose led to a % (P 0.01) decrease compared with cells cultured in 4 mm glucose. The Y minienhancer that contains the A5/core, E4, the palindrome, and the E3a elements also demonstrated biphasic regulation by glucose (Table 1). Because the A5, enhancer core element, and E4 are potential regulatory sites within the X and Y minienhancers, nuclear factor binding activity to these elements was examined by EMSA. As shown in Fig. 6A, a single slow migrating glucose-sensitive complex bound the A5/core ( 323 to 304) probe. This complex was readily competed by excess unlabeled A5/ Fig. 6. The A5/Core Binds a Glucose-Sensitive Complex that Contains Pdx-1 Nuclear extracts were isolated from INS-1 cells incubated for 48 h in 4.0 or 16.7 mm glucose and tested by EMSA for their ability to bind the A5/core. A, EMSA using 32 P-labeled A5/core ( 323/ 304). Competition with 100-fold excess of unlabeled A5/core (lanes 4 and 5) or mutated A5/core (ma5/core; lanes 6 and 7) probes. B, EMSA of 32 P-labeled A5/core probe. Competition with 100-fold excess unlabeled A5 (lanes 4 and 5), A1 (lanes 6 and 7), or A3 (lanes 8 and 9) probes. Panel E, EMSA using 32 P-labeled A5/core (left gel) or A3(right gel) probes. Anti-Pdx1 antibodies were added to lanes 4, 5, 9, and 10. EMSA probe sequences and corresponding insulin promoter elements are indicated in Table 3 and Fig. 4A, respectively. Data shown are representative gels of a minimum of three independent experiments. FP, Free probe.

10 1352 Mol Endocrinol, May 2005, 19(5): Pino et al. Glucose-Suppressed Insulin Promoter Activity core probe (Fig. 6A, lanes 4 and 5). A probe containing three mutations within the overlapping sequences of the A5 element and enhancer core element (CTAAT- GTG to CTACGTTG) was shown to be ineffective for competition (Fig. 6A, lanes 6 and7), thus indicating that this glucose-sensitive complex directly binds the A5 and enhancer core elements. Because the A5 element looks like a Pdx-1 binding site (TCTAATG) and Pdx-1 binding activity has been shown to be glucose sensitive in INS-1 cells (6), it was necessary to determine whether the glucose-sensitive binding complex contained Pdx-1. As shown in Fig. 6B, the glucosesensitive complex was completely competed by unlabeled A5/core probe. In contrast, 100-fold excess of unlabeled A1 or A3 probe, which contain characterized Pdx-1 binding sites, only weakly reduced binding of the glucose-sensitive complex (Fig. 6B, lanes 6 9). Addition of anti-n-terminal Pdx-1 antibodies decreased the mobility of the glucose-sensitive complex (Fig. 6C, lanes 4 and 5) that recognized the A5/core and decreased the mobility of the Pdx-1 complex that recognizes the human A3 element (Fig. 6C, lanes 9 and 10). Binding of the glucose-sensitive complex to the A5/core was not disrupted by the addition of Nkx6.1, Pax6, Isl-1, BMAL1, or p300 antibodies (data not shown). The supershift data demonstrated that the glucose-sensitive complex that recognizes the A5/ core contains Pdx-1. Interestingly, this glucose-sensitive complex migrates as a larger Pdx-1 complex than observed on the A3 (Fig. 6C) and A1 elements (data not shown). Moreover, the inability of this large complex to be competed for by the A3 and A1 elements suggest that this complex has higher affinity for the A5/core and that the enhancer core sequence stabilizes this interaction. The E4 element contained within the Xa probe bound a specific protein complex that was not glucose responsive (data not shown). MafA and, to a Limited Extent, Pdx-1 Stimulate X and Y Minienhancer Activities The similarity between the A5/core element and other characterized Pdx-1 binding sites suggests that the loss of Pdx-1 binding to the A5/core element accounts for glucose-mediated suppression of Table 2. Regulation of X, Y, and Z Minienhancers by MafA or Pdx-1 Minienhancer 4mM gluc Control 16.7 mm gluc Control 4mM gluc Pdx-1 both the X and Y minienhancers. Thus, the ability of Pdx-1 or MafA to restore X, Y, or Z minienhancer activity was tested. Overexpression of Pdx-1 led to marked suppression of Z minienhancer activity (Table 2). Pdx-1 overexpression also reduced the X and Y minienhancer activity in cells cultured in 4 mm glucose. In cells incubated in 16.7 mm glucose, Pdx-1 increased X minienhancer activity 1.7-fold when compared with cells cultured in 4 mm glucose. As with Pdx-1, overexpression of MafA led to marked suppression of Z minienhancer activity. In contrast, overexpression of MafA led to a strong activation of both the X and Y minienhancers in cells treated with 4 mm glucose, and this was further induced by 16.7 mm glucose. This result was surprising because there are no recognizable MafA consensus sequences [TGCTGAC(G)TCAGCA (39)] found in either the X or Y minienhancers. The similarity in responses between the X and Y minienhancers, however, leaves the possibility that MafA regulates these two minienhancers through a common site such as the A5/core element or E4 element. MafA Interacts with the A5/Core Element Gel mobility shift assays were used to determine whether the glucose-sensitive complex that interacts with the A5/core element contains MafA. Exposure of INS-1 cells to elevated glucose led to the loss of binding activity to the A5/core probe (Fig. 7, A and B; lanes 2 and 3). The glucose-sensitive binding activity was effectively competed for with a 100-fold excess of unlabeled A2-C1 probe (Fig. 7A, lanes 4 and 5). MafA antibodies consistently decreased the mobility of the glucose-sensitive complex; however, due to the size of the complex, it was not always effectively resolved by EMSA (Fig. 7B, lanes 4 and 5). MafA antibodies were also shown to effectively supershift the glucosesensitive complex that recognizes the A2-C1 probe (Fig. 7B, lanes 9 and 10). These data indicate that the large glucose-sensitive binding complex that recognizes the A5/core contains MafA. Surprisingly, the glucose-sensitive binding complex was also effectively competed by an unlabeled probe containing a mutated C1 element (A2-mC1) that disrupts the MafA Fold Response 16.7 mm gluc Pdx-1 4mM gluc MafA 16.7 mm gluc MafA X a a a a Y a a a a Z a a a a INS-1 cells were transfected with 85ripCAT reporter genes containing five tandem repeats of the X, Y, or Z minienhancer and 0.25 g of control, Pdx-1, or MafA expression vectors. Cells were then incubated in the indicated glucose concentrations for 48 h, after which CAT activity was assayed. CAT activity is expressed relative to cells cultured in 4 mm glucose. Values are the mean SEM for four experiments. a P 0.03 for CAT expression in cells transfected with control vs. Pdx-1 or MafA expression vectors. gluc, Glucose.

11 Pino et al. Glucose-Suppressed Insulin Promoter Activity Mol Endocrinol, May 2005, 19(5): Fig. 7. The Glucose-Responsive A5/Core Binding Complex Contains MafA Nuclear extracts were isolated from INS-1 cells incubated in 48 h in 4 or 16.7 mm glucose. Panel A, EMSA using 32 P-labeled A5/core probe. Competition using 100-fold excess of unlabeled A2-C1 (lanes 4 and 5), A2 mutated-c1 (A2mC1, lanes 6 and 7), mutated-a2 C1 (ma2c1, lanes 8 and 9), and mutated-a2 mutated-c1 (ma2mc1, lanes 10 and 11) probes. B, EMSA using 32 P-labeled A5/core probe (left) or 32 P-labeled rat insulin gene A2-C1 probe (right). Anti-MafA antibodies were added to lanes 4, 5, 9, and 10. EMSA probe sequences and corresponding insulin promoter elements are indicated in Table 3 and Fig. 4A, respectively. EMSA is a representative gel of three independent experiments. Asterisk indicates glucose-sensitive A5/core binding complex. C1 indicates glucose-sensitive A2C1 binding complex. Unlabeled arrow marks the A2C1 complex supershifted with MafA antibodies. FP, Free probe. binding site (Fig. 7A, lanes 6 and 7). The enhancer core and A2 element do, however, share a common sequence (TGGAAAXTG; see Table 3) suggesting that these elements bind a common factor. Mutation of the A2 element at 122/ 121 (TGGACCCT) was previously shown by Harrington and Sharma (40) to effectively prevent A2 factor binding. Probes containing a mutated A2 element in the context of a wild-type or mutated C1 element (ma2-c1 or ma2-mc1) were tested for the ability to compete for the A5/core binding complex. Addition of 100-fold excess of ma2-c1 or ma2-mc1 probes was unable to compete for the glucose-sensitive binding complex that recognizes the A5/core (Fig. 7A, lanes 8 to 11). Overall, these data suggest that the glucose-sensitive A5/core complex contains Pdx-1, MafA, and an A2 binding factor. Mutation of the A5/Core, Palindrome, and E3 Elements Partially Diminishes Glucose-Mediated Suppression of Insulin Promoter Activity To investigate the involvement of the A5/core, the palindrome, and/or the E3 element in glucose-mediated suppression of the insulin promoter, these elements were mutated separately or in combination in the context of the INS( 323)CAT reporter gene. As previously shown, incubation of INS-1 cells in high glucose concentration led to a 86.6% suppression in INS( 327)CAT expression compared with cells incubated in low glucose (Table 4). Mutation of the palindrome [mzpal( 323)CAT] increased insulin promoter activity but only had a minor affect on glucose-mediated suppression of insulin promoter activity. Combined mutations of the palindrome and A5/core [ma5/ core/zpal( 323)CAT] or E3 [mzpal/e3( 323)CAT] elements led to further reductions in promoter activity and diminished glucose-mediated suppression of promoter activity. Combined mutation of the A5/core, palindrome, and E3 [ma5/core/zpal/e3( 323)CAT] markedly lowered promoter activity and further diminished glucose-mediated suppression of insulin promoter activity. These data support the hypothesis that alterations in binding activities to these elements may be sufficient to account for the large reduction in insulin promoter activity observed in high glucose. DISCUSSION In a number of in vitro and in vivo models, prolonged exposure of pancreatic -cells to hyperglycemia leads to reduced insulin gene expression. Studies employing HIT-T15, TC3, and INS-1 cells have shown that the reduction in insulin gene expression results from

12 1354 Mol Endocrinol, May 2005, 19(5): Pino et al. Glucose-Suppressed Insulin Promoter Activity Table 3. Oligodeoxynucleotide Sequences Used in EMSAs Name 5 -End Base Pair Sequence Za 292 GGCTTTGCTCTCCTGGAGACATTTGCCCCCA Za( 271m) 292 GGCTTTGCTCTCCTGGAGACAGTTGCCCCCA Za( 273m) 292 GGCTTTGCTCTCCTGGAGAGATTTGCCCCCA Za( 282/3m) 292 GGCTTTGCTAGCCTGGAGACATTTGCCCCCA Zd 289 TTTGCTCTCCTGGAGACATTTGCCCCCAGCTGTGAGC Zpal 289 TTTGCTCTCCTGGAGACATTT mzpal 289 TTTGCTAGCCTGGAGACATTT E3 278 GGAGACATTTGCCCCCAGCTGTGAGC me3 278 GGAGAGCGTTGCCCCCAGAGTTGAGC Rat E1 104 TCTGGCCATCTGCTGGATCCT Human E2 249 GACAGGTCTGGCCACCGGGCCCCTGGTTAA Xa 327 TCTCCTGGTCTAATGTGGAAAGTGGCCCAGGTGAGGGCT A5/core 323 CTGGTCTAATGTGGAAAGTG ma5/core 323 CTGGTCTACGTTGGAAAGTG E4 306 GTGGCCCAGGTGAGGGCT A1 94 CCACCCCAGGCCCTAATGGGCCAG A3 230 CCCCTGGTTAAGACTCTAATGACCCGCTGG Rat A2-C1 Rat A2-mC1 Rat ma2-c1 Rat ma2-mc1 reduced insulin promoter activity that occurs with a commensurate reduction in expression and/or binding of Pdx-1 and the C1 activator (5, 6, 13, 15) and increased expression of C/EBP (19). In a similar manner, chronic hyperglycemia induced after partial pancreatectomy in rats reduced insulin gene expression, and this correlated with decreased expression of AGCTTGGAAACTGCAGCTTCAGCCCCTCTGAGCT AGCTTGGAAACTGCAGCTCGAGCCCCTCTGAGCT AGCTTGGACCCTGCAGCTTCAGCCCCTCTGAGCT AGCTTGGACCCTGCAGCTCGAGCCCCTCTGAGCT Bolded and underlined sequences indicate mutated bases. Complementary oligodeoxynucleotide sequences are not shown. Sequences correspond to the human insulin gene except where indicated. Table 4. Mutation of the A5/Core, Z Palindrome, and E3 Elements Partially Attenuate Glucose-Induced Suppression of Insulin Promoter Activity Reporter Gene 4.0 mm Glucose CAT Activity 16.7 mm Glucose % Repression INS( 327)CAT a mzpal a ma5/core/zpal a mzpal/e a ma5/core/zpal/e a INS-1 cells were transfected with INS( 323)CAT reporter genes containing site-directed mutations in the palindrome (mzpal), A5/core and palindrome (ma5/core/pal), palindrome and E3 (mzpal/e3), or A5/core, palindrome, and E3 (ma5/ core/zpal/e3) elements. Cells were then incubated in the indicated glucose concentrations for 48 h, after which CAT activity was assayed. Values are the mean SEM of three experiments. a P 0.04 for CAT expression in cells treated with 4.0 mm vs mm glucose. Pdx-1 (7, 8, 11) and enhanced expression of C/EBP (8) and c-myc (11). Enhanced c-myc expression has also been reported to occur in rats infused with glucose for 1 4 d and in isolated rat islets incubated in elevated glucose for 18 h (20). In Zucker diabetic fatty (fa/fa) rats, a model of chronic hyperglycemia and hyperlipidemia, insulin and Pdx-1 mrna and protein are reduced (8, 9) whereas C/EBP protein and mrna levels are increased (8). Prevention of hyperglycemia or oxidative stress in Zucker diabetic fatty (fa/fa) rats helped to preserve insulin gene expression and Pdx-1 binding activity (9, 10, 41). Although the above studies suggest that prolonged elevations of glucose reduce insulin gene expression, in part, by reducing Pdx-1 levels, no direct correlation has been established. For example, expression of Pdx-1 in INS-1 cells exposed to elevated glucose concentrations did not prevent the reduction in 327 insulin promoter activity. In fact, overexpression of Pdx-1 in INS-1 cells cultured in 4 mm glucose suppressed the 327 insulin promoter activity (data not shown) as previously reported for RIN cells (42). Moreover, expression of Pdx-1 in late-passage HIT-T15 cells, which have markedly reduced insulin promoter activity and Pdx-1 levels, does not restore promoter activity to levels observed in early passages of HIT-T15 cells (18). The possibility that reduced Pdx-1 levels do not account for glucose-mediated suppression in insulin promoter activity is further exemplified by the observation that antisense Pdx-1

13 Pino et al. Glucose-Suppressed Insulin Promoter Activity Mol Endocrinol, May 2005, 19(5): RNA can lower Pdx-1 protein levels in MIN6 or TC1 cells without affecting insulin mrna levels (43). Consistent with this observation, mice containing only one functional allele for Pdx-1 have reduced Pdx-1 protein levels but normal pancreatic insulin content (44). As described above, loss of C1 activator binding is also associated with glucose suppression of insulin promoter activity. Supershift analysis indicated that the C1 activator complex that has reduced binding in INS-1 cells cultured in elevated glucose contains MafA. Overexpression of MafA in INS-1 cells cultured in 16.7 mm glucose increased 327 insulin promoter activity above the level observed in 4 mm glucose. These data can be interpreted in two ways: either loss of MafA binding accounts for loss of insulin promoter activity, or that MafA acting as a strong transcriptional activator overrides the suppression by glucose independent of being the mechanism of action. The latter possibility is supported by the observation that MafA activates a truncated insulin promoter ( 230) that is only modestly repressed by glucose, and that MafA is strongly activated by glucose (16). Nevertheless, in HIT-T15 and TC6 cells chronically exposed to elevated glucose, the timing for loss of insulin promoter activity coincides best with diminished C1 activator and not loss of Pdx-1 binding (5, 18). Moreover, in INS-1 cells, elevated glucose diminishes MafA binding to a greater extent than Pdx-1 binding (6). Truncation analysis of the human insulin gene promoter indicated that the majority of glucose-mediated suppression in INS-1 cells occurs between sequences 327 to 261. Contained within these sequences is a previously described glucose-responsive region (the Z element, 292 to 243) that is extremely active in primary islet cells (28, 29) and serves as an NRE in SV40 or T antigen immortalized cell lines (29 31). Promoter deletions that remove the Z element have been reported to reduce promoter activity in primary islet cells (28), whereas similar deletions increased insulin promoter activity in HIT M2.2.2 cells (30). The Z minienhancer was previously shown to be very active in primary islet cells, but suppressed in SV40 or T antigen immortalized -cell lines (29). Suppression of the Z minienhancer in these immortalized -cell lines appears related to elevated cell proliferation because Z minienhancer activity was also extremely low in proliferating fibroblasts (29). As reported for primary islet cells, we have found that the Z minienhancer was extremely active in INS-1 cells and that deletion of the Z element markedly reduced insulin promoter activity. These data suggest that under low glucose concentrations (2 8 mm) INS-1 cells regulate the human insulin promoter in a manner more similar to primary islet cells than to SV40 or T antigen immortalized -cell lines. Under elevated glucose, the Z minienhancer was suppressed and this may be due, in part, to increased INS-1 cell proliferation (6, 45, 46). Understanding the relationship between -cell proliferation and suppression of the Z minienhancer is important because in vitro expansion of human -cells is generally associated with down-regulated insulin gene expression that can occur without the loss of Pdx-1 (47, 48). Prevention of INS-1 cell proliferation, however, is not sufficient to block glucose-mediated suppression of insulin mrna expression or promoter activity (Ref. 6 and data not shown), strongly suggesting that more than one molecular mechanism is involved. To explore possible mechanisms for glucose-mediated suppression of the Z-minienhancer in INS-1 cells, we characterized potential regulatory sites for changes in binding activity. Within the Z element, we identified two putative regulatory elements, E3 element and a palindrome, that demonstrated altered binding activity in response to elevated glucose. The E3 element is composed of two putative E boxes (CANNTG), E3a and E3b, separated by 4 bp. Gel shift analysis using a probe (Zd) that spanned the E3 element and the palindrome identified four specific binding complexes. Of interest, the Zd1 binding complex was partly reduced, whereas the Zd2 complex was partly increased, in nuclear extracts derived from INS-1 cells cultured in elevated glucose. Similar binding complexes were also observed with a gel shift probe that contained only the E3 element, and competition analysis demonstrated that binding required intact E box sequences. Although the identity of these factors is unknown, we postulate that these changes in binding activity may represent the loss of activator binding and subsequent binding of a transcriptional repressor. Transcriptional repression of the insulin promoter by c-myc or C/EBP has been reported to occur through E boxes such as the insulin promoter E1 element (19, 49). Gel shift analysis of a probe (Za) that spanned the palindrome and the E3a element identified three specific binding complexes of which the Za2 complex was markedly reduced in nuclear extracts derived from INS-1 cells cultured in elevated glucose. We found that binding of the glucose-sensitive complex was abolished when the first base pair ( 273) of the E3a element was mutated. In contrast, binding of the glucose-sensitive complex was preserved when the third base pair ( 271) of the E3a element was mutated. These results are important because the glucoseresponsive Za binding complex identified in rat fetal islet (ZaI) by Sander et al. (29) did not require the base pair located at 271 for binding. Equally important, mutation of bp 271 completely prevented binding of a complex found in TC3 and HIT M2.2.2 cells (29, 31) and eliminated repressor activity present in HIT M2.2.2 cells (31). In contrast, mutation of bp 272 and bp 273 did not prevent repressor binding or activity present in HIT M2.2.2 cells (31). Therefore, our results suggest that the Za2 binding activity present in INS-1 cells is distinct from the Za binding activity or transcriptional repressor found in TC3 or HIT M cells. The relationship between the glucose-responsive Za binding complex identified in INS-1 cells and fetal rat islets is uncertain. Binding of the Za complex in INS-1 cells was completely prevented when se-

14 1356 Mol Endocrinol, May 2005, 19(5): Pino et al. Glucose-Suppressed Insulin Promoter Activity quences within the palindrome ( 283/ 282) were mutated. In contrast, Sander et al. (29) reported that the glucose-responsive Za complex in rat fetal islets (ZaI) was effectively competed by 150-fold excess of a mutated 283/ 282 Za probe. Studies designed to determine the relationship between the Za complexes in INS-1 cells and rat islets are ongoing. Changes in binding activities to both the E3 and palindrome likely contribute to glucose suppression of Z element activity. This is supported by the observation that both the Za minienhancer, which contains the palindrome and E3a, and the Zb minienhancer, which contains the intact E3, are suppressed by elevated glucose. As reported for primary islet cells (29), activities of the Za and Zb minienhancers in INS-1 cells were many magnitudes lower than the activity of the Z minienhancer. These data suggest that the Za minienhancer requires adjacent elements contained within the Zb minienhancer to confer full activity to the Z minienhancer as proposed by Sander et al. (29). This also implies that glucose-mediated changes in binding activity to either the E3 or palindrome could markedly impact synergistic interactions necessary for full Z minienhancer activity. Such synergistic interactions are well documented for the rat insulin 1 promoter in which the E2/A3/A4 minienhancer functions as an independent glucose-regulated transcriptional unit (50, 51). The X and Y minienhancers were also found to be activated by increasing glucose concentrations from 2 8 mm and to be suppressed by higher glucose concentrations. This observation is in contrast to that of Sander et al. (29), who described these minienhancers to be unresponsive to changes in glucose concentration in primary islet cells. Three potential regulatory elements, including the A5, enhancer core, and E4, are common between the X and Y minienhancers. The A5 element is present only in the human insulin gene promoter and overlaps the enhancer core. The enhancer core is highly conserved and shown to bind a -cell-enriched nuclear factor complex (33). We found that binding to the A5/core was markedly reduced in nuclear extracts isolated from INS-1 cells incubated in high glucose concentrations, whereas binding to the E4 element was unaffected by glucose. Because the A5 element contains a sequence similar to the A3 element, a well-defined Pdx-1 binding site (TCTAATG), we predicted that the glucose-responsive binding activity would contain Pdx-1. Surprisingly, we found that the glucose-responsive binding activity migrated much slower than the Pdx-1 complex that forms on either the A3 or A1 elements, and was poorly competed by A3 or A1 elements. The glucose-sensitive complex, however, was determined to contain Pdx-1 by supershift analysis using specific antibodies against Pdx-1. These data suggest that Pdx-1, along with factors that possibly interact with the enhancer core, forms a high-affinity binding complex. Consistent with the observation that Pdx-1 binds the A5 element, overexpression of Pdx-1 led to a small increase in expression of both the X and Y minienhancers in cells cultured in elevated glucose. Overexpression of MafA led to a large glucosedependent activation of both the X and Y minienhancers. This was surprising because we were unable to identify any consensus MafA binding sites [TGCT- GAC(G)TCAGCA (39)] within either minienhancer. The enhancer core element (TGGAAAGTG), however, resembles the A2 element (TGGAAACTG) that, together with the C1 element, serves as the binding site for RIPE3b1 (MafA) (40). Consistent with this observation, the A2 element, independent of the C1, effectively competed for the glucose-sensitive A5/core binding complex. Existence of MafA within the A5/core complex was demonstrated by supershift analysis. Based on these results, we propose that the A5/core binding activity is a large complex comprised of Pdx-1 binding to the A5 element and an A2 binding factor that interacts with the enhancer core. The identity of the A2 binding factor is unknown; however, nuclear factor of activated T cells (NFAT) has been identified in INS-1 and can bind both the A2 and enhancer core (52). The juxtaposition between Pdx-1 and the A2 factor stabilizes the complex and leads to the recruitment of MafA possibly independent of a consensus MafA binding site. Such interactions are supported by the observation that the homeodomain of Pdx-1 can interact with a number of transcription factors including E47/Pan1 and HMG I(Y) (53), whereas the Pdx-1 homeodomain plus adjacent FPWMK peptide interacts with Pbx1 (54). Interactions between Pdx-1 and Pbx1 have been shown to change the specificity of Pdx-1 binding such that Pdx-1 and Pbx1 cooperatively bind to the somatostatin promoter, but not to the A3/A4 elements of the rat 1 insulin promoter (54). The interaction of Pdx-1, A2 factor, and MafA through the A5/core element and its possible involvement in regulation of human insulin promoter activity by glucose warrant further investigation. In conclusion, our data indicate that exposure of INS-1 cells to elevated glucose suppresses human insulin promoter activity primarily through the Z element and A5/core element. The relevance of these observations for primary -cells is indicated by the bell-shaped curve of glucose stimulation of insulin promoter activity in isolated rat islets (Fig. 1D) after 24 h of exposure. This is further exemplified by the large, yet reversible, suppression of insulin promoter activity that occurs when human islets are exposed to elevated glucose concentrations for 4 9 d (14). Understanding how elevated glucose causes these changes in binding activity to occur and proteins involved may provide insights into how elevations in glucose affect gene expression in pancreatic -cells and may provide valuable insight into engineering of -cells that express high levels of insulin that can be positively regulated in a glucose-dependent manner.