Measurement of diastolic and systolic calcium concentration assessed by Fura-2 dye
|
|
|
- Carol Paul
- 5 years ago
- Views:
Transcription
1 SUPPLEMENTARY MATERIALS HDAC inhibition improves the sarcoendoplasmic reticulum Ca 2+ -ATPase activity in cardiac myocytes Viviana Meraviglia, PhD 1, Leonardo Bocchi, PhD2, Roberta Sacchetto, PhD 3, Maria Cristina Florio, PhD 1, Benedetta M. Motta, PhD 1, Corrado Corti, PhD 1, Christian X. Weichenberger, PhD 1, Monia Savi, PhD 2, Yuri D Elia 1, Marcelo D. Rosato-Siri, PhD 1, Silvia Suffredini, PhD 1, Chiara Piubelli, PhD 1, Giulio Pompilio, MD 4, 5, Peter P. Pramstaller, MD 1, Francisco S. Domingues, PhD 1, Donatella Stilli, PhD 2, Alessandra Rossini, PhD 1. SUPPLEMENTARY METHODS Measurement of diastolic and systolic calcium concentration assessed by Fura-2 dye Rat cardiomyocytes were loaded with Fura-2 by incubation of a 1 ml suspension of isolated cardiomyocytes for 10 min at room temperature with 2.0 µm Fura-2-acetoxymethyl ester (Invitrogen) plus Pluronic (0.04%; Sigma-Aldrich). Then, cardiomyocytes were washed twice with low calcium (0.1 mm) solution to remove the remaining Fura-2 and complete the deesterification of intracellular AM ester. The loaded cells were placed in a perfusion chamber on the stage of an inverted microscope (Olympus IX71) and intracellular Ca 2+ transients were measured with contractility recording system (IonOptix LLC, Milton USA) at 0.5 Hz pacing rate (field stimulation). In order to record Ca 2+ transients, cells were excited at 360/380 nm and emission was measured at 510 nm. The ratio of the fluorescence emitted by 360 nm and 380 nm excitation was used as an indicator of intracellular free Ca 2+ (ΔF360/380). The Ionwizard software (IonOptix, USA) was used to capture the changes of Fura-2 fluorescence intensity. Then, the actual intracellular calcium ion concentration was computed by applying in vitro calibration, according with the manufacturer s instructions (ION-Optix).
2 Table S1: List of primers used in mutagenesis experiment SERWT-F AAAGGTACCATGATGGAGAACGCGCACACCAAGACG SERWT-R TTTGGGCCCTTACTCCAGTATTGCAGGTTCCAGGTAG K464Q-F GAAGGGTCTTTCTCAGATAGAACGTGC K464Q-R GGCATTTGCACGTTCTATCTGAGAAAGACC K464R-F GAAGGGTCTTTCTAGAATAGAACGTGC K464R-R GGCATTTGCACGTTCTATTCTAGAAAGACC
3 Figure S1 Figure S1. Representative examples of complete Western Blot panels showing immunoprecipitation experiments of SERCA2 on cardiomyocytes isolated from adult rat hearts after SAHA treatment. (a) The membrane displayed the Western blot with Pan-Ac-K antibody on lysates immunoprecipitated for SERCA2 protein. (b) The same membrane presented above showing the Western Blot with SERCA2 antibody on samples immunoprecipitated SERCA2. The acetylated bands in panel (a) (indicated by red arrows) corresponds to SERCA2 protein (indicated by blue arrows) as showed in panel (b).
4 Figure S2 Figure S2. (a) Mean values±sem of diastolic and systolic intracellular calcium concentration in control cardiomyocytes (CTR), and cardiomyocytes incubated with SAHA 2.5µM (CTR+SAHA). (b) Representative tracings of calcium transient recorded in the two groups of cells.
5 Figure S3
6 Figure S3. Multiple sequence alignment of SERCA2 orthologues. Alignment is shown up to the end of N domain. ADP binding residues marked with ^. Acetylation sites according to PhosphoSitePlus are marked with A. Human SERCA2 acetylation sites are conserved in most mammals. SERCA2 orthologues were collected from Ensembl release 70 ( Analysis was restricted to 1-to-1 orthologues. In addition, 14 orthologue sequences were excluded given extensive regions of unknown sequence, and two sequences were excluded because of problematic alignment. The sequences of human SERCA2a and respective orthologues were aligned with MUSCLE ( there was only a minor manual alignment correction at position 509 in the human sequence.
7 Figure S4 Figure S4. Surface neighborhood of K464. Domains N, P, A and M are represented in different colors, the putative phospholamban binding site (PLB) is in light blue. Residue K464 locates on the side of a cleft connecting domains N, P and M near the phospholamban binding site (PLB). Structure model generated with MODELLER based on template PDB ID: 3B9B chain A representing E2P conformational state.
8
Supporting Information
Supporting Information Muraski et al. 10.1073/pnas.0709135105 SI Text Generation of Transgenic Animals. Pim-WT and Pim-DN cdnas were subcloned NheI/SmaI from pegfp-c1 Pim-1 and pegfp-c1 Pim-DN plasmids
Supplementary Material and Methods
Online Supplement Kockx et al, Secretion of Apolipoprotein E from Macrophages 1 Supplementary Material and Methods Cloning of ApoE-GFP Full-length human apoe3 cdna (pcdna3.1/zeo + -apoe) was kindly provided
Supplemental Material. Methods
1 Supplemental Material Methods Functional Characterization of Isolated Cardiomyocytes (Detailed Methods) Left ventricular myocytes were isolated from adult mice (aged 30-38 weeks) by enzymatic dissociation.
High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart.
High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart. Daniel Aston, Rebecca A. Capel, Kerrie L. Ford, Helen C. Christian,
SUPPLEMENTARY INFORMATION
a c e doi:10.1038/nature10407 b d f Supplementary Figure 1. SERCA2a complex analysis. (a) Two-dimensional SDS-PAGE gels of SERCA2a complexes. A silver-stained SDSPAGE gel is shown, which reveals a 12 kda
Fig. S1. High K+ increases intracellular calcium level.
Fig. S1. High K + increases intracellular calcium level. (A) Neuronal activation measured by calcium imaging using Fura-2. Intracellular calcium levels were continuously monitored by the fura-2 florescence
COMPUTATIONAL MODELING AND NANOTECHNOLOGY FOR INVESTIGATING AND IMPROVING CARDIAC CELL FUNCTION
COMPUTATIONAL MODELING AND NANOTECHNOLOGY FOR INVESTIGATING AND IMPROVING CARDIAC CELL FUNCTION L. T Al-Kury Faculty of Pharmacy and Health Science, Ajman University, P.O.Box 5102, Abu-Dhabi, U.A.E I.
Measuring Cardiac Activity:
icell Cardiomyocytes Application Protocol Measuring Cardiac Activity: Intracellular Calcium Flux Detection on the FLIPR Tetra System Introduction icell Cardiomyocytes are human cardiomyocytes that recapitulate
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
1. A method of selecting a treatment for congestive heart failure, in a subject with heart failure, comprising:
Diagnostic Methods Case Studies Instructions 1. Perform a Purposive Construction (PCon) of the claims: a. Identify the POSITA b. Identify the POSITA s CGK (in case study 2 this information has been specified
Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR
Figure S1. (A) SDS-PAGE separation of GST-fusion proteins purified from E.coli BL21 strain is shown. An equal amount of GST-tag control, LRRK2 LRR and LRRK2 WD40 GST fusion proteins (5 µg) were loaded
TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
Kidney. Heart. Lung. Sirt1. Gapdh. Mouse IgG DAPI. Rabbit IgG DAPI
a e Na V 1.5 Ad-LacZ Ad- 110KD b Scn5a/ (relative to Ad-LacZ) f 150 100 50 0 p = 0.65 Ad-LacZ Ad- c Heart Lung Kidney Spleen 110KD d fl/fl c -/- DAPI 20 µm Na v 1.5 250KD fl/fl Rabbit IgG DAPI fl/fl Mouse
SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name
Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR
LPS LPS P6 - + Supplementary Fig. 1.
P6 LPS - - - + + + - LPS + + - - P6 + Supplementary Fig. 1. Pharmacological inhibition of the JAK/STAT blocks LPS-induced HMGB1 nuclear translocation. RAW 267.4 cells were stimulated with LPS in the absence
Mathematical Model of the Electromechanical Heart Contractile System Regulatory Subsystem Physiological Considerations
Physiol. Res. 50: 425-432, 2001 Mathematical Model of the Electromechanical Heart Contractile System Regulatory Subsystem Physiological Considerations M. MLČEK, J. NEUMANN, O. KITTNAR, V. NOVÁK Institute
Comparison of cardiac excitation contraction coupling in isolated ventricular myocytes between rat and mouse
Comparative Biochemistry and Physiology Part A 133 (2002) 191 198 Comparison of cardiac excitation contraction coupling in isolated ventricular myocytes between rat and mouse Kadon K. Hintz, Faye L. Norby,
UNIVERSITA DEGLI STUDI DI PARMA Dottorato di Ricerca in Fisiopatologia Sistemica XXVIII ciclo
UNIVERSITA DEGLI STUDI DI PARMA Dottorato di Ricerca in Fisiopatologia Sistemica XXVIII ciclo Modulation of Sarco/Endoplasmic Reticulum Ca 2+ - ATPase 2 (SERCA2) function by acetylation following the treatment
Supplementary Figure 1 (Mu) SBP (mmhg) 2 18 16 p (B D) Three views of the final refined 2Fo-Fc electron density map of the Vpr (red)-ung2 (green) interacting region, contoured at 1.4σ.
Supplementary Figure 1 Overall structure of the DDB1 DCAF1 Vpr UNG2 complex. (A) The final refined 2Fo-Fc electron density map, contoured at 1.4σ of Vpr, illustrating well-defined side chains. (B D) Three
SUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human
Fig. S1. Subcellular localization of overexpressed LPP3wt-GFP in COS-7 and HeLa cells. Cos7 (top) and HeLa (bottom) cells expressing for 24 h human LPP3wt-GFP, fixed and stained for GM130 (A) or Golgi97
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2988 Supplementary Figure 1 Kif7 L130P encodes a stable protein that does not localize to cilia tips. (a) Immunoblot with KIF7 antibody in cell lysates of wild-type, Kif7 L130P and Kif7
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis
Supplementary Figure 1. PD-L1 is glycosylated in cancer cells. (a) Western blot analysis of PD-L1 in breast cancer cells. (b) Western blot analysis of PD-L1 in ovarian cancer cells. (c) Western blot analysis
Improved systolic function of rat cardiocytes during heart failure by overexpression of SERCA2a
European Review for Medical and Pharmacological Sciences 2016; 20: 1590-1596 Improved systolic function of rat cardiocytes during heart failure by overexpression of SERCA2a H.-B. GONG, L. WANG, Q. LV,
Regulation of intracellular Na 1 in health and disease: pathophysiological mechanisms and implications for treatment
OPEN ACCESS Review article Regulation of intracellular 1 in health and disease: pathophysiological mechanisms and implications for treatment Raffaele Coppini 1, *, Cecilia Ferrantini 2, Luca Mazzoni 1,
DECLARATION OF CONFLICT OF INTEREST
DECLARATION OF CONFLICT OF INTEREST A potential anti-hypertrophic agent Riham Abouleisa Cardiac hypertrophy is a compensatory response to maintain function during increased stress. A sustained hypertrophic
Supplementary information Common molecular mechanism of amyloid pore formation by Alzheimer s -amyloid peptide and -synuclein
1 Supplementary information Common molecular mechanism of amyloid pore formation by Alzheimer s -amyloid peptide and -synuclein by Coralie Di Scala, Nouara Yahi, Sonia Boutemeur, Alessandra Flores, Léa
Assay Report. Histone Deacetylase (HDAC) Inhibitor Assays Enzymatic Study of Compounds from Client
Assay Report Histone Deacetylase (HDAC) Inhibitor Assays Enzymatic Study of Compounds from Client Page 1 of 27 Client_HDAC _Year Month Day 1 Client_HDAC_Year Month Year HDAC Inhibitor Assays Study Sponsor:
Cardiotoxicity of Hyperamylinemia
Cardiotoxicity of Hyperamylinemia β-cell Dysfunction & Apoptosis Pancreatic β-cell Amylin Oligomers BLOO OD AMYLIN OLIGOMERIZATION HYPERGLYCEMIA Calcium dsreglation dysregulation HYPERAMYLINEMIA HYPERINSULINEMIA
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/6/278/rs11/dc1 Supplementary Materials for In Vivo Phosphoproteomics Analysis Reveals the Cardiac Targets of β-adrenergic Receptor Signaling Alicia Lundby,* Martin
A thallium based screening procedure to identify molecules that modulate the activity of Ca 2+ -activated monovalent cation selective channels.
Supplemental Material A thallium based screening procedure to identify molecules that modulate the activity of Ca 2+ -activated monovalent cation selective channels. Koenraad Philippaert *,1,2,3, Sara
SUPPLEMENTARY INFORMATION
doi:10.1038/nature19102 Supplementary Discussion Benzothiazepine Binding in Ca V Ab Diltiazem and other benzothiazepines inhibit Ca V 1.2 channels in a frequency-dependent manner consistent with pore block
Control GST GST-RAP. α2-mg. 170 kda. b-actin. 42 kda LRP-1
% of max Supplementary Figure 1 Control GST GST-RP 17 kda α2-mg 42 kda b-actin Gate: CD11c+ (DCs) Gate: F4/8+ (Mfs) IgG Cd11cCre + Lrp1 fl/fl LRP-1 Supplementary figure 1. () MDCs were pretreated with
- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
Imaging energy status in live cells with a fluorescent biosensor of the intracellular ATP-to-ADP. ratio
Imaging energy status in live cells with a fluorescent biosensor of the intracellular ATP-to-ADP ratio Mathew Tantama, Juan Ramón Martínez-François, Rebecca Mongeon, Gary Yellen* Department of Neurobiology,
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2
ERK1/2/MAPK pathway-dependent regulation of the telomeric factor TRF2 SUPPLEMENTARY FIGURES AND TABLE Supplementary Figure S1: Conservation of the D domain throughout evolution. Alignment of TRF2 sequences
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Data are contained in multiple tabs in Excel spreadsheets and in CSV files.
Contents Overview Curves Methods Measuring enzymatic activity (figure 2) Enzyme characterisation (Figure S1, S2) Enzyme kinetics (Table 3) Effect of ph on activity (figure 3B) Effect of metals and inhibitors
Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after
Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after photoconversion by using H2B-Dendra2. 4-5 PPs of H2B-Dendra2 BM chimeras were photoconverted and analyzed 7 days (upper panel)
Supplementary Information
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2018 Supplementary Information Spying on Protein Interactions in Living Cells with Reconstituted Scarlet
Ch. 6: Contraction of Skeletal Muscle Physiological Anatomy of Skeletal Muscle
Ch. 6: Contraction of Skeletal Muscle 40% skeletal muscle + 10% smooth and cardiac muscle Ch. 7: Excitation of Skeletal Muscle Ch. 9: Contraction and Excitation of Smooth Muscle Physiological Anatomy of
Supporting Information. Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in. Mouse Rod Cells
Supporting Information Post translational Modifications of Serotonin Type 4 Receptor Heterologously Expressed in Mouse Rod Cells David Salom,, Benlian Wang,, Zhiqian Dong, Wenyu Sun, Pius Padayatti, Steven
Centro de Engenharia Biomédica and 2
Brazilian Na + -Ca 2+ Journal of Medical and Biological Research (2003) 36: 1717-1723 exchange and myocardial relaxation ISSN 0100-879X Short Communication 1717 Inhibition of the sarcoplasmic reticulum
Pressure-calcium relationships in perfused mouse hearts
Pressure-calcium relationships in perfused mouse hearts Guy A. MacGowan, Jonathan A. Kirk, Caroline Evans and Sanjeev G. Shroff AJP - Heart 290:2614-2624, 2006. First published Jan 13, 2006; doi:10.1152/ajpheart.00979.2005
Troponin Mutation Caused Diastolic Dysfunction and Experimental Treatment in Transgenic Mice with Cardiomyopathy
DOI 10.7603/s40782-014-0017-6 GSTF Journal of Advances in Medical Research (JAMR) Vol.1 No.2, October Troponin Mutation Caused Diastolic Dysfunction and Experimental Treatment in Transgenic Mice with Cardiomyopathy
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with
Supplementary Figure 1. Supernatants electrophoresis from CD14+ and dendritic cells. Supernatants were resolved by SDS-PAGE and stained with Coomassie brilliant blue. One µg/ml recombinant human (rh) apo-e
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced to express
Supplementary Figure 1. VapC-mt4 cleaves trna Ala2 in E. coli. Histograms representing the fold change in reads observed in trnas from the analysis of RNAs carrying a 5 -OH ends isolated from cells induced
FIBER TYPES - oxidative metabolism is the main form here - ATPase activity is relatively low
Cardiac Muscle Physiology Special characteristics of cardiac muscle - Branching and interdigitating cells - At their ends, they are connected by INTERCALATED DISCS - The discs are always at the Z-lines
Restricted diffusion of ions regulates cardiac function. Fredrik Swift
Institute for Experimental Medical Research, Ullevål University Hospital Center for Heart Failure Research, University of Oslo Restricted diffusion of ions regulates cardiac function Fredrik Swift Dissertation
Metal swap between Zn 7 metallothionein 3 and amyloid β Cu protects against amyloid β toxicity
Metal swap between Zn 7 metallothionein 3 and amyloid β Cu protects against amyloid β toxicity Supplementary Information Gabriele Meloni 1, Vanessa Sonois 2,3, Tamara Delaine 2, Luc Guilloreau 2, Audrey
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton
Supplementary Figure 1. Overview of steps in the construction of photosynthetic protocellular systems
Supplementary Figure 1 Overview of steps in the construction of photosynthetic protocellular systems (a) The small unilamellar vesicles were made with phospholipids. (b) Three types of small proteoliposomes
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Design of isolated protein and RNC constructs, and homogeneity of purified RNCs. (a) Schematic depicting the design and nomenclature used for all the isolated proteins and RNCs used
were isolated from the freshly drawn blood of healthy donors and ACS patients using the
Supplemental Figure 1. Quality control of CD4 + T-cell purification. CD4 + T cells were isolated from the freshly drawn blood of healthy donors and ACS patients using the RosetteSep CD4 + T Cell Enrichment
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
To determine the effect of over-expression and/or ligand activation of. PPAR / on cell cycle, cell lines were cultured as described above until ~80%
Supplementary Materials and Methods Cell cycle analysis To determine the effect of over-expression and/or ligand activation of PPAR / on cell cycle, cell lines were cultured as described above until ~80%
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11700 Figure 1: RIP3 as a potential Sirt2 interacting protein. Transfected Flag-tagged Sirt2 was immunoprecipitated from cells and eluted from the Sepharose beads using Flag peptide.
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
Nature Neuroscience: doi: /nn.2275
Supplementary Figure S1. The presence of MeCP2 in enriched primary glial cultures from rat or mouse brains is not neuronal. Western blot analysis of protein extracts from (a) rat glial and neuronal cultures.
SDS-Assisted Protein Transport Through Solid-State Nanopores
Supplementary Information for: SDS-Assisted Protein Transport Through Solid-State Nanopores Laura Restrepo-Pérez 1, Shalini John 2, Aleksei Aksimentiev 2 *, Chirlmin Joo 1 *, Cees Dekker 1 * 1 Department
-51mV 30s 3mV. n=14 n=4 p=0.4. Depolarization (mv) 3
Supplementary Figure 1 a optoβ 2 -AR b ChR2-51mV 30s 3mV -50mV 30s 3mV c 4 n=14 n=4 p=0.4 Depolarization (mv) 3 2 1 0 Both optogenetic actuators, optoβ 2 AR and ChR2, were effective in stimulating astrocytes
Tel: ; Fax: ;
Tel.: +98 216 696 9291; Fax: +98 216 696 9291; E-mail: mrasadeghi@pasteur.ac.ir Tel: +98 916 113 7679; Fax: +98 613 333 6380; E-mail: abakhshi_e@ajums.ac.ir A Soluble Chromatin-bound MOI 0 1 5 0 1 5 HDAC2
Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic
Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity,
Declaration of conflict of interest. I have nothing to disclose.
Declaration of conflict of interest I have nothing to disclose. Left Bundle branch block in HF: DO GENETICS MATTER? Silvia Giuliana Priori Cardiovascular Genetics, Langone Medical Center, New York University
Differences in cardiac atrial and ventricular ion channels
Differences in cardiac atrial and ventricular ion channels Norbert Jost, PhD Department of Pharmacology & Pharmacotherapy, University of Szeged Division for Cardiovascular Pharmacology, Hungarian Academy
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures Type of file: MOV Title of file for HTML: Supplementary Movie 1 Description: NLRP3 is moving along
RayBio Annexin V-Cy5 Apoptosis Detection Kit
RayBio Annexin V-Cy5 Apoptosis Detection Kit User Manual Version 1.0 Mar 20, 2014 (Cat#: 68C5-AnnV-S) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll Free)1-888-494-8555 or
TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer
Supplementary Information TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer Yabing Mu, Reshma Sundar, Noopur Thakur, Maria Ekman, Shyam Kumar Gudey, Mariya
Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain.
Supplementary Figures Supplementary Figure 1. Development of the camp biosensor targeted to the SERCA2a microdomain. A B C (A) Schematic representation of the new constructs designed for local camp imaging.
SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
Nature Neuroscience: doi: /nn Supplementary Figure 1. Large-scale calcium imaging in vivo.
Supplementary Figure 1 Large-scale calcium imaging in vivo. (a) Schematic illustration of the in vivo camera imaging set-up for large-scale calcium imaging. (b) High-magnification two-photon image from
Electronic Supporting Information
Modulation of raft domains in a lipid bilayer by boundary-active curcumin Manami Tsukamoto a, Kenichi Kuroda* b, Ayyalusamy Ramamoorthy* c, Kazuma Yasuhara* a Electronic Supporting Information Contents
Cholesterol determination using protein-templated fluorescent gold nanocluster probes
Electronic Supplementary Information for Cholesterol determination using protein-templated fluorescent gold nanocluster probes Xi Chen and Gary A. Baker* Department of Chemistry, University of Missouri-Columbia,
NOX Inhibition Improves β-adrenergic Stimulated Contractility and Intracellular Calcium Handling in the Aged Heart
NOX Inhibition Improves β-adrenergic Stimulated Contractility and Intracellular Calcium Handling in the Aged Heart Álvaro Valdés 1, Guillermo Barrios 1, Nikol Ponce 1, Raul A Dulce 2, and Daniel R González
Supplementary Figure 1 NMR spectra of hydroxy α and β-sanshool isomers. (Top) Hydroxy-α-sanshool (2E,6Z,8E,10E)-2'-
Supplementary Figure 1 NMR spectra of hydroxy α and β-sanshool isomers. (Top) Hydroxy-α-sanshool (2E,6Z,8E,10E)-2'- hydroxyl-n-isobutyl-2,6,8,10-dodeca-tetraenamide) and (bottom) hydroxy-β-sanshool (2E,6E,8E,10E)-2'-hydroxyl-N-isobutyl-
Changes in myocardial excitation-contraction coupling are
Excessive Sarcoplasmic/Endoplasmic Reticulum Ca 2 -ATPase Expression Causes Increased Sarcoplasmic Reticulum Ca 2 Uptake but Decreases Myocyte Shortening Nils Teucher; Juergen Prestle, PhD; Tim Seidler,
Beta-adrenergic stimulation increases the intra-sr Ca termination threshold for spontaneous Ca waves in cardiac myocytes
Beta-adrenergic stimulation increases the intra-sr Ca termination threshold for spontaneous Ca waves in cardiac myocytes Joshua T. Maxwell, Timothy L. Domeier*, and Lothar A. Blatter Department of Molecular
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) (b) (c) (d) (e) (f) (g) .
Supplementary Figure 1. Properties of various IZUMO1 monoclonal antibodies and behavior of SPACA6. (a) The inhibitory effects of new antibodies (Mab17 and Mab18). They were investigated in in vitro fertilization
Nature Biotechnology: doi: /nbt.3828
Supplementary Figure 1 Development of a FRET-based MCS. (a) Linker and MA2 modification are indicated by single letter amino acid code. indicates deletion of amino acids and N or C indicate the terminus
ab Membrane fluidity kit Instructions for Use For the detection of membrane fluidity in cells
ab189819 Membrane fluidity kit Instructions for Use For the detection of membrane fluidity in cells This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated
TECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C
Phospho-Stat3 (ptyr 705 ) and pan-stat3 ELISA Kit for detection of human, mouse, or rat phospho-stat3 (ptyr 705 ) and pan-stat3 in cell and tissue lysates Catalog Number RAB0447 Storage Temperature 20
Depletion of Ca 2 from the sarcoplasmic reticulum of cardiac muscle prompts phosphorylation of phospholamban to stimulate store refilling
Proc. Natl. Acad. Sci. USA Vol. 95, pp. 1484 1489, February 1998 Biochemistry Depletion of Ca 2 from the sarcoplasmic reticulum of cardiac muscle prompts phosphorylation of phospholamban to stimulate store
Supplementary Information
Supplementary Information Targeted Disruption of the EZH2/EED Complex Inhibits EZH2- dependent Cancer Woojin Kim 1,2,3, Gregory H. Bird 2,3,4, Tobias Neff 5, Guoji Guo 1,2,3, Marc A. Kerenyi 1,2,3, Loren
Deep Oscillation EFFECTS ON BLOOD PARAMETERS (EXPERIMENTAL STUDY)
Deep Oscillation EFFECTS ON BLOOD PARAMETERS (EXPERIMENTAL STUDY) I. EFFECTS OF Deep Oscillation ON THE WHOLE BLOOD AND WHITE BLOOD CELL CHEMILUMINESCENCE The stimulation of oxygen radical production by
bio-mof-1 DMASM Wavenumber (cm -1 ) Supplementary Figure S1 FTIR spectra of bio-mof-1, DMASMI, and bio-mof-1 DMASM.
bio-mof-1 Transmittance bio-mof-1 DMASM DMASMI 2000 1500 1000 500 Wavenumber (cm -1 ) Supplementary Figure S1 FTIR spectra of bio-mof-1, DMASMI, and bio-mof-1 DMASM. Intensity (a.u.) bio-mof-1 DMASM as
The cyclooxygenase-2 product prostaglandin E 2 modulates cardiac contractile function in adult rat ventricular cardiomyocytes
Pharmacological Research 49 (2004) 99 103 The cyclooxygenase-2 product prostaglandin E 2 modulates cardiac contractile function in adult rat ventricular cardiomyocytes Aaron L. Klein, Loren E. Wold, Jun
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Chen et al., http://www.jcb.org/cgi/content/full/jcb.201210119/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Lack of fast reversibility of UVR8 dissociation. (A) HEK293T
p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
CREATINE KINASE INHIBITOR IODOACETAMIDE ANTAGONIZES CALCIUM-STIMULATED INOTROPY IN CARDIOMYOCYTES
Clinical and Experimental Pharmacology and Physiology (2009) 36, 141 145 doi: 10.1111/j.1440-1681.2008.05034.x Blackwell Creatine J Ren et al. kinase Publishing and cardiac Asia function CREATINE KINASE
TECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates
Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates Catalog Number RAB0011 Storage Temperature 20 C TECHNICAL BULLETIN Product Description
Nature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
Tyrodes solution in a custom-built imaging chamber as described previously. Images were acquired
Supplemental Material Supplemental Methods Electrical stimulation of CX-G3-labeled hippocampal neurons Following 5 min incubation in 0.5 µm CX-G3 and washes, 18-20 DIV neurons were imaged in normal Tyrodes
Influence of interleukin-2 on Ca2+ handling in rat ventricular myocytes. Cao, CM; Xia, Q; Bruce, IC; Shen, YL; Ye, ZG; Lin, GH; Chen, JZ; Li, GR
Title Influence of interleukin-2 on Ca2+ handling in rat ventricular myocytes Author(s) Cao, CM; Xia, Q; Bruce, IC; Shen, YL; Ye, ZG; Lin, GH; Chen, JZ; Li, GR Citation Journal Of Molecular And Cellular
Gladstone Institutes, University of California (UCSF), San Francisco, USA
Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of