Long noncoding RNA H19 accelerates tenogenic differentiation and promotes tendon healing through targeting mir-29b-3p and activating TGF-b1 signaling

Transcription

1 THE JOURNAL RESEARCH Long noncoding RNA H19 accelerates tenogenic differentiation and promotes tendon healing through targeting mir-29b-3p and activating TGF-b1 signaling Ying-Fei Lu,*,1 Yang Liu,*,1 Wei-Ming Fu, Jia Xu,*, Bin Wang,* Yu-Xin Sun,* Tian-Yi Wu,* Liang-Liang Xu,* Kai-Ming Chan,*,,{ Jin-Fang Zhang,*,,{,2 and Gang Li*,,{,3 *Department of Orthopedics and Traumatology, Prince of Wales Hospital, Lui Che Woo Institute of Innovative Medicine, and { Stem Cells and Regenerative Medicine Laboratory, Li Ka Shing Institute of Health Sciences, Faculty of Medicine, The Chinese University of Hong Kong, Hong Kong, China; School of Pharmaceutical Sciences, Southern Medical University, Guangzhouv, China; and Department of Orthopaedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People s Hospital, Shanghai, China ABSTRACT: Tendon injures are common orthopedic conditions, but tendon development and the pathogenesis of tendon injures, such as tendinopathy, remain largely unknown and have limited the development of clinical therapy. Studies on tenogenic differentiation at the molecular level may help in developing novel therapeutic strategies. As novel regulators, long noncoding RNAs (lncrnas) have been found to have widespread biological functions, and emerging evidence demonstrates that lncrnas may play important regulatory roles in cell differentiation and tissue regeneration. In this study, we found that lncrna H19 stimulated tenogenesis of human tendon-derived stem cells. Stable overexpression of H19 significantly accelerated TGF-b1-induced tenogenic differentiation in vitro and accelerated tendon healing in a mouse tendon defect model. H19 directly targeted mir-29b-3p, which is considered to be a negative regulator of tenogenesis. Furthermore, mir-29b-3p directly suppressed the expression of TGF-b1 and type I collagen, thereby forming a novel regulatory feedback loop between H19 and TGF-b1 to mediate tenogenic differentiation. Our study demonstrated that H19 promotes tenogenic differentiation both in vitro and in vivo by targeting mir-29b-3p and activating TGF-b1 signaling. Regulation of the TGF-b1/H19/miR-29b-3p regulatory loop may be a new strategy for treating tendon injury. Lu, Y.-F., Liu, Y., Fu, W.-M., Xu, J., Wang, B., Sun, Y.-X., Wu, T.-Y., Xu, L.-L, Chan, K.-M., Zhang, J.-F., Li, G. Long noncoding RNA H19 accelerates tenogenic differentiation and promotes tendon healing through targeting mir-29b-3p and activating TGF-b1 signaling. FASEB J. 31, (2017). KEY WORDS: tendon differentiation pathway lncrna mirna As an integral part of the musculoskeletal system, tendons are connective tissues that transmit force from muscle to bone (1). Tendon injures, such as tendon rupture or tendinopathy, are frequent in both sports and the ABBREVIATIONS: cerna, competing endogenous RNA; COL1A1, collagen type I; DCN, decorin; ECM, extracellular matrix; EGR, early growth response; EYA, eyes absent homolog; FBS, fetal bovine serum; FMOD, fibromodulin; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; H&E, hematoxylin and eosin; HEK, human embryonic kidney; LG- DMEM, low-glucose DMEM; lncrna, long noncoding RNA; MKX, Mohawk; MSC, mesenchymal stem cell; qpcr, quantitative PCR; SCX, scleraxis; TDSC, tendon-derived stem cell; TNMD, tenomodulin 1 These authors contributed equally to this work. 2 Correspondence: Room 904, 9/F, Li Ka Shing Institute of Health Sciences, Prince of Wales Hospital, The Chinese University of Hong Kong, Shatin, Hong Kong, China. zhangjf06@cuhk.edu.hk 3 Correspondence: Room 904, 9/F, Li Ka Shing Institute of Health Sciences, Prince of Wales Hospital, The Chinese University of Hong Kong, Shatin, Hong Kong, China. gangli@cuhk.edu.hk doi: /fj R This article includes supplemental data. Please visit to obtain this information. workplace (2). Because of the low metabolic rate, the healing of tendon injures can take 1 yr or even longer (3). To date, clinical therapeutic options are still limited to conservative and surgical treatments, both of which bring considerable pain with a long recovery period (3, 4). Novel therapeutic strategies are needed. The long noncoding RNAs (lncrnas), extensively transcribed from the mammalian genome, have been discovered with many biological functions in recent years (5, 6). They are regarded as important and powerful regulators of various biological activities and disease progression (7, 8). Emerging evidence has shown that lncrnas play important regulatory roles in cell differentiation and tissue regeneration (9 12). However, few lncrnas have been reported to mediate tenogenic differentiation at present. The lncrna H19 is one of the most well-known imprinted genes, located on human chromosome 11. It is transcribed only from the maternally inherited allele (13). Although this gene was discovered more than 20 yr ago, its /17/ FASEB

2 function is not yet fully understood. H19 is abundantly expressed in embryonic tissues of endodermal and mesodermal origin and is repressed after birth in all tissues except skeletal muscle (14, 15). Therefore, H19 has been proposed to be a regulator of differentiation of adult tissues. Recent studies have shown that H19 is an active modulator of musculoskeletal development. It has been demonstrated that H19 promotes osteoblast differentiation of MSCs via the TGF-b1/Smad3/histone deacetylase (HDAC) signaling pathway, and our previous studies also confirmed that H19 activates Wnt/b-catenin, leading to the promotion of osteoblast differentiation (16, 17). H19 has also been reported to mediate myoblast differentiation and skeletal muscle regeneration (18). In the present study, we identified H19 as a novel activator for tenogenic differentiation of tendon-derived stem cells (TDSCs). Reinforced H19 expression accelerated TGF-b1-induced tenogenic differentiation in vitro and promoted healing process in vivo. H19 directly targeted mir-29b-3p, which suppressed tenogenic differentiation by suppressing the expression of TGF-b1 and type I collagen (COL1A1). Therefore, the current study reported a novel regulatory feedback loop of TGF-b1/H19/miR-29b-3p in tenogenic differentiation. MATERIALS AND METHODS Cell culture and induction of tenogenic differentiation Human mesenchymal stem cells (hmscs) and human TDSCs (htdscs) were isolated with the formal consent and approval of the Joint Chinese University of Hong Kong-New Territories Ease Cluster Clinical Research Ethics Committee. The details of isolation and culture of MSCs and TDSCs have been published (17, 19). In brief, hmscs were obtained from a 38-yr-old healthy donor (male), and fresh bone marrow was flushed from the bone cavity and subjected to density gradient centrifugation over Lymphoprep (Axis-Shield, Oslo, Norway), to obtain mononuclear cells. The cells were cultured in a-minimum essential medium, supplemented with 10% fetal bovine serum (FBS) and 1% penicillinstreptomycin (all from Thermo Fisher Scientific, Waltham, MA, USA) at 37 C with 5% CO 2. For the isolation of TDSCs, a piece of tendon was removed from a hamstring graft in a 43-yr-old male patient during anterior cruciate ligament reconstruction surgery. Then, the tendon was chopped into pieces, digested in collagenase type I (COL1A1; 1 mg/ml; Sigma-Aldrich, St. Louis, MO, USA) for2hat37 Cwith5%CO 2,andpassedthrougha70-mm cell strainer (BD Biosciences, Franklin Lakes, NJ, USA) to yield a single-cell suspension. The cells were cultured in low-glucose DMEM (LG-DMEM), containing 10% FBS and 1% penicillinstreptomycin (all from Thermo Fisher Scientific), at 37 C with 5% CO 2. A colony-forming assay was performed, and multilineage differentiation capacities were determined before usage (20). For tenogenic differentiation, the htdscs were incubated with complete LG-DMEM supplemented with 10 ng/ml TGF-b1 (PeproTech, Rocky Hill, NJ, USA). The cells were used at passages 4 6, and the medium was changed every 2 d. Establishment of H19-overexpressing stable cells An H19-overexpressing vector was constructed and ph19 stable htdscs (ph19 cells) were generated with a retrovirus-mediated gene delivery system (17). In brief, 3 mg ph19 vector or the empty vector pbabe was cotransfected with the virus-packaging vector pcl-ampho into human embryonic kidney (HEK)293 cells to produce a retrovirus for infection, and the supernatants containing retrovirus particles were collected by passing through 0.45-mm pore size nitrocellulose membranes (EMD-Millipore, Billerica, MA, USA). The htdscs were infected with retroviral particles in 8 mg/ml hexadimethrine bromide (Sigma-Aldrich), selected by puromycin (Sigma-Aldrich) for ;7 d,andwerecollected for further confirmation by real-time quantitative PCR (qpcr) assays. Cell transfection The mir-29b-3p mimic (59 UAGCACCAUUUGAAAUCAG- UGUU 39) and its negative control (NC, 59 UUCUCCG- AACGUGUCACGUTT 39) and the inhibitor of mir-29b-3p (anti-mir-29b-3p, 59 AACACUGAUUUCAAAUGGUGC- UA 39) and its negative control (anti-nc, 59 CAGUACUUUU- GUGUAGUACAA 39) were synthesized and purchased from GenePharma (Shanghai, China) and were transfected with Lipofectamine 3000 (Thermo Fisher Scientific), according to the manufacturer sprotocol. Total RNA isolation and real-time qpcr Total RNA was extracted by using Trizol reagent (Thermo Fisher Scientific) according to the manufacturer s instructions. After RNA isolation, RNA samples were reverse transcribed by using PrimeScript RT Master Mix (TaKaRa, Tokyo, Japan). The products were then subjected to real-time qpcr analysis, using SYBR Premix Ex Taq II (TaKaRa). The primer sequences are shown in Table 1. All reactions were performed in triplicate. The housekeeping gene RPLP0 was used as the internal control for analyzing H19 gene expression, and GAPDH was used as the internal control for other genes. The data were analyzed by using the 2 2DDCt relative-expression method. Sirius red staining To measure the content of collagen formation, a Sirius red staining assay was performed as reported (19). In brief, htdscs of ph19 and pbabe were cultured in a 12-well plate at 5000 cells/cm 2. At the designated time points, medium was removed, and the cells were washed with PBS, fixed with 4% paraformaldehyde for 10 min, and incubated with Picrosirius red solution with 0.1% Sirius Red F3BA for 1 h at room temperature, followed by a wash with deionized water to elute the staining buffer. Luciferase plasmid construction The pmirglo-h19 luciferase plasmid was constructed according to a published method (17). In brief, the full length of H19 was cloned and inserted into a pmir-glo reporter vector (Promega, Madison, WI, USA) to generate the wild-type (WT) vector, and a site mutation vector was generated with a Site- Directed Mutagenesis Kit (Thermo Fisher Scientific). For COL1A1 and TGF- b1 luciferasereporterconstruction,the 400 bp fragments of the COL1A1 39UTR or TGF-b1 coding region containing the predicted binding site were inserted into the pmir-glo reporter vector to generate the COL1A1-39UTR- Wt or TGF-b1-coding region-wt Luciferase reporter. The binding site mutant vector was then generated by the Site-Directed Mutagenesis kit. H19 MEDIATES TENDON DIFFERENTIATION 955

3 TABLE 1. Primer sequences for real-time qpcr Primer, Gene Forward Reverse H19 GCACCTTGGACATCTGGAGT TTCTTTCCAGCCCTAGCTCA SCX CGAGAACACCCAGCCCAAAC CTGCGAATCGCTGTCTTTCTGTC MKX GAAGGCAACTTTGTCTATCGCA TGATCTCCTTCCAATACGTGTC TNMD TGGGTGGTCCCTCAAGTGAAAGT CTCGACGGCAGTAAATACAACAATA COL1A1 CGATGGATTCCAGTTCGAGTAT CATCGACAGTGACGCTGTAGG EGR1 CTCACTCGCCCACCATGGAC TGCTCACTAGGCCACTGACC DCN TCAATGGACTGAACCAGATGA CCTTGAGGAATGCTGGTGAT EYA1 GGAGATGGTGTAGAAGAAGAACAAG GCCTGCTGGATCTGTCCCTGGT FMOD AGAACCTCTACCTCCAAGGCAATA AAAGCCAAACCAAACCATCAAG TGF-b1 GACTACTACGCCAAGGAGGTCA AGTCAATGTACAGCTGCCGCAC RPLP0 CCGGATATGAGGCAGCAGTT GAAGGCTGTGGTGCTGATGG GAPDH GGTCACCAGGGCTGCTTTTA GGATCTCGCTCCTGGAAGATG Luciferase reporter assays For the luciferase assays, 293T cells were seeded in 24-well plates at a density of cells per well. The luciferase reporter plasmids were cotransfected with mir-29b-3p or anti-mir-29b- 3p mimic. After incubation for 28 h, the cells were harvested. Firefly luciferase activities were measured with a Luciferase Assay System (Promega) and normalized to Renilla luciferase activity, according to the manufacturer s protocol. ELISA of protein concentrations in cell culture supernatants and cell lysates The protein contents of cells of the ph19 and pbabe groups and of htdscs treated with the mir-29b-3p mimic and anti-mir-29b-3p were measured by ELISA (Shanghai LanPai Biotechnology, Shanghai, China). The protein contents of COL1A1 and TGF-b were analyzed, either in the cell culture supernatant or cell lysate, as indicated in Results. For the measurement of protein content in the cell culture supernatant, the total supernatant was collected after transfection with mir-29b-3p or anti-mir-29b-3p for 3 d into TDSCs, followed by centrifugation at 1500 rpm for 10 min at 4 C, and the supernatant was collected and passed through centrifuge filters to purify it (Amicon Ultra; EMD-Millipore). The purified supernatant was used for further ELISAs. The cell lysates were collected by RIPA lysis buffer supplemented with proteinase inhibitor (Sigma-Aldrich). The samples were then analyzed by ELISA, according to the manufacturer s instructions (Shanghai LanPai Biotechnology). The concentration of total protein in each well was measured and served as the internal control. The relative expression level of each protein is showninresults. Western blot analysis Cell lysates were collected into RIPA buffer (Thermo Fisher Scientific) supplemented with proteinase inhibitor (Sigma-Aldrich), (21). The protein was separated by SDS-PAGE (10%) and transferred to PVDF membranes (Bio-Rad, Hercules, CA, USA). After they were blocked with 5% skimmed milk for 1 h, the membranes were probed with the primary antibody to COL1A1 (Southern Biotech, Birmingham, AL, USA) or GAPDH (Santa Cruz Biotechnology, Santa Cruz, CA, USA). The membrane was incubated with horseradish peroxidase (HRP) conjugated donkey anti-goat or donkey anti-rabbit secondary antibodies (all from Santa Cruz Biotechnology) after a wash with Tris-buffered saline containing Tween. The blot was developed with the ECL Western Blot Detection Reagent (GE Healthcare, Little Chalfont, United Kingdom). GAPDH was used as the internal control. Tendon-defect model The tendon-defect model was used on the patellar tendon in 6-wk-old nude mice (n = 8 in each group). To develop the tendon defect, 2 stacked sharp blades were used to remove the central third of the patellar tendon (;0.5 mm in width) from the distal apex of the patella to the insertion of the tibia tuberosity, according to a well-established protocol (22). The H19- overexpressing htdscs (ph19) and htdscs with empty vector (pbabe) were injected locally into the injury site with a total 10 6 cells (diluted in 20 ml PBS) injected at each timepoint: d 7 and 10 after the surgery. At 4 wk after the surgery, all the mice were euthanized, and the patellar tendon and surrounding joints were harvested for further ex vivo examination. All experiments were approved by the Animal Experimentation Ethics Committee of The Chinese University of Hong Kong. Mice were maintained in a temperature-controlled room in a 12 h light dark cycle, with food and water ad libitum, inthe Laboratory Animal Service Center at the Chinese University of Hong Kong. Histology analysis and immunohistochemistry The isolated mouse patellar tendon and surrounding joint were fixed with 10% neutral-buffered formalin overnight. Tissues were decalcified in 10% EDTA for 1 wk, dehydrated, embedded in paraffin, cut into 5-mm-thick sections, and mounted on 3-aminopropyl-triethoxy-saline coated slides (Sigma-Aldrich). The sections were then stained with hematoxylin and eosin (H&E) for histological examination or Masson s trichrome for visualizing collagen fibers, according to an established protocol (23). Stained sections were then examined by light microscopy (Leica Microsystems, Wetzlar, Germany). For immunohistochemistry, the slides were rinsed in xylene to remove the paraffin, followed by rehydration in a graded series of ethanol. For blocking, 1% bovine serum albumin in PBS was applied for 30 min at room temperature. The sections were incubated with anti-decorin (DCN; Santa Cruz Biotechnology), anti-collagen type I (COL1A1; Southern Biotech), and antitenomodulin (TNMD; Abcam, Cambridge, MA, USA) in a moist chamber overnight at 4 C and washed in normal PBS the next day. Donkey anti-goat or donkey anti-rabbit HRP-conjugated secondary antibodies (Santa Cruz Biotechnology) were added for an hour, followed by 3,39-diaminobenzidine tetrahydrochloride 956 Vol. 31 March 2017 The FASEB Journal x LU ET AL.

4 Figure 1. H19 was up-regulated during tenogenic differentiation. A, B) The expression levels of several lncrnas in hmscs (A) and htdscs (B) after treatment with TGF-b1 for 7 d. Error bars = SD. **P, 0.01 vs. control group, by Student s t test. C) The expression pattern of H19 and tenogenic markers, such as SCX, MKX, EGR1, EYA1, TNMD, FMOD, COL1A1, and DCN, during tenogenic differentiation by TGF-b1 induction. Error bars = SD. *P, 0.05, **P, 0.01 vs. control group at the same time, by Student s t test. (Dako, Glostrup, Denmark) in the presence of H 2 O 2. Afterward, the sections were rinsed, counterstained in hematoxylin, dehydrated with graded ethanol and xylene, mounted with DPX Permount (Sigma-Aldrich), and examined by microscope (Leica Microsystems). Data analysis Data are expressed as means 6 SD. Comparison of the 2 groups was performed with the 2-tailed unpaired Student s t tests. All the statistical analyses were performed with SPSS, ver. 22 (IBM, Armonk, NY, USA). Values of P, 0.05 indicated statistical significance. RESULTS H19 was up-regulated during TGF-b1 induced tenogenic differentiation TGF-b1, as a classic inducer, was used to induce tenogenic differentiation of hmscs and htdscs (21, 23). To identify the potential lncrnas that may be involved in this process, we chose 5 previously reported lncrnas and subjected them to real-time qpcr analysis to determine their expression during tenogenic differentiation: Hotair, H19, lincror, TINCR, CUDR, and LincMD1. Three lncrnas, including H19, CUDR, and lincmd1, were elevated in both hmscs (Fig. 1A) and htdscs (Fig. 1B) and were induced by TGF-b1, indicating their important roles in tenogenesis. Especially H19 exhibited marked upregulation in both cells. TDSCs have been reported to be a good cell source for tendon tissue engineering, and they have spontaneous tenogenic differentiation potentials in vitro (19, 22, 24); hence, we used htdscs as a cell model in the present study. To further validate the H19 expression pattern in htdscs, we used real-time qpcr examination and confirmed that H19 was up-regulated during TGF-b1-induced tenogenic differentiation, and the expression peaked at d 7 (Fig. 1C). Several other tenogenic molecules and extracellular matrix (ECM) marker genes were also examined, such as scleraxis (SCX), Mohawk (MKX), early growth response 1 (EGR1), eyes absent homolog 1 (EYA1), tenomodulin (TNMD), fibromodulin (FMOD), collagen type I (COL1A1), and decorin (DCN), H19 MEDIATES TENDON DIFFERENTIATION 957

5 Figure 2. Overexpression of H19 promoted tenogenic differentiation in htdscs. A) H19 was up-regulated in htdscs by H19- overexpressiing plasmid transfection. Error bar = SD. **P, 0.01 vs. pbabe group by Student s t test. B) The cell morphology of H19-overexpressing htdscs (ph19) and normal htdscs (pbabe). C) The expression pattern of tenogenic markers, such as SCX, MKX, TNMD, FMOD, COL1A1, anddcn, during the tenogenic differentiation of the ph19 and pbabe groups. Error bars = SD. *P, 0.05, **P, 0.01 vs. control group at the same time, by Student s t test. D) Sirius red staining for the ph19 and pbabe groups induced by TGF-b1. E) The measurement of COL1A1 content in cell lysates of the ph19 and pbabe groups by ELISA at d 7. Error bars = SD. *P, 0.05 vs. pbabe group at the same time, by Student s t test. among which, SCX, MKX, TNMD, FMOD, COL1A1, and DCN displayed significant increases during the TGF-b1- induced tenogenic differentiation. H19 overexpression promoted tenogenic differentiation We next generated stable H19-overexpressing htdscs (ph19) by a retroviral system and the establishment of a stable cell line was verified by real-time qpcr (Fig. 2A). After culture for 5 d, the ph19 group exhibited an elongated fibroblastic morphology with TGF-b1 treatment(fig.2b). The statistical analysis confirmed that the average cell length of the ph19 group was significantly longer than that of the control group (Supplemental Fig. S1). In a further examination of the expression of other tenogenic markers, H19 significantly activated SCX, MKX, TNMD, FMOD, DCN, and COL1A1 during tenogenic differentiation. The expression peak appeared at d 5 in the ph19 group,which was almost 2 d earlier than that in the pbabe group (Fig. 2C). 958 Vol. 31 March 2017 The FASEB Journal x LU ET AL.

6 Furthermore, Sirius red staining revealed more collagen formation in the ph19 group (Fig. 2D). The formation of COL1A1 was measured with a specific ELISA kit, and the results showed that COL1A1 content was significantly increased in the ph19 group at d 7 (Fig. 2E). H19 was a direct target for mir-29b-3p in TDSCs Recent studies demonstrated that H19 acts as a natural spongeforvariousmirnas,suchaslet-7,mir-22,mir- 141, mir-183, and mir-200a, which results in restoration of the target genes of these mirnas (13, 17, 25). We screened the candidate mirnas by bioinformatics prediction and identified a putative binding site for mir-29b-3p in human H19 (Fig. 3A).AsshowninFig. 3B, the ectopic mir-29b-3p mimic can significantly repress the RNA expression level of H19, indicating that this mirna could induce H19 mrna degradation. To further validate the direct interaction between H19 and mir-29b-3p, we generated a luciferase reporter by inserting H19 full-length sequence into the luciferase reporter pmirglo. The luciferase assays showed that mir-29b-3p significantly reduced the luciferase activity of the reporter-carrying H19 sequence (Fig. 3C). Meanwhile, the mutated luciferase reporter was developed by site-directed mutagenesis, and the results demonstrated that mutations on the binding sites successfully abolished the suppressive effect of mir-29b-3p (Fig. 3D). All these results reveal that mir-29b-3p directly targets the H19 sequence, further leading to the degradation of its mrna degradation. MiR-29b-3p was a negative modulator of tenogenic differentiation To further identify the roles of mir-29b-3p in tenogenic differentiation, we examined the tenogenic marker gene expression in htdscs transfected with mir-29b-3p mimic or the inhibitor of mir-29b-3p mimic (anti-mir-29b-3p). The results showed that the tendon marker genes, such as SCX, MKX, EGR1, TNMD, FMOD, anddcn, weredownregulated by mir-29b-3p, whereas only SCX and EGR1 were up-regulated by anti-mir-29b-3p (Fig. 4A), which maybe be the result of the weak inhibitory effect of antimir-29b-3p or low expression of intrinsic mir-29b-3p. Sirius red staining also confirmed that mir-29b-3p was significantly suppressed, whereas its inhibitor promoted collagen formation during tenogenic differentiation (Fig. 4B). ELISAs showed that there was less COL1A1 expression in the mir-29b-3p group, whereas more COL1A1 formation was seen in the anti-mir-29b-3p group (Fig. 4C). Thereafter, mir-29b-3p was regarded as a negative regulator of tenogenic differentiation. TGF-b1 and COL1A1 were both real targets of mir-29b-3p Regarding the tenogenic effect of mir-29b-3p, we tried to identify the candidate protein-coding genes targeted by Figure 3. H19 was a direct target for mir-29b-3p. A) Bioinformatics prediction of target sites in H19 for mir-29b-3p. B) The mrna expression of H19 in htdscs transfected with mir-29b-3p or anti-mir-29b-3p mimic. Error bars = SD. **P, 0.01 vs. NC group, by Student s t test. C) HEK293cellswere transfected with mir-29b-3p mimic combined with the luciferase reporter harboring H19 gene. The effect of mir-29b-3p on luciferase activity was measured by luciferase reporter assays. MiR-29b-3p suppressed luciferase activity. Error bars = SD. **P, 0.01 vs. NC group, by Student s t test. D) The mir-29b-3p binding sites were mutated, and the mutated luciferase reporters were cotransfected with this mirna. The mutations on binding sites abolished the previously suppressive effect. this mirna. Among the candidates predicted by the bioinformatics analysis, we found that tenogenic differentiation inducer TGF-b1 and extracellular matrix COL1A1 were of greatest interest (Fig. 5A). However, different from COL1A1, the binding sites of mir-29b-3p on TGF-b1 are located in the coding region, not in the 39UTR. Several studies have shown that mir-29b inhibits fibrosis by suppressing TGF-b1 (26, 27), whereas COL1A1 is a post-transcriptional target of mir-29b in skin fibroblasts (28). In our study, mir-29b-3p significantly induced the down-regulation of both TGF-b1 and COL1A1 at the mrna level and the protein level (Fig. 5B D), whereas the mir-29b-3p inhibitor (antimir-39b-3p) promoted their expression. To validate that TGF-b1 andcol1a1arebona fide targets for mir- 29b-3p, we inserted their target sites into the luciferase reporter (WT). The results showed that mir-29b-3p dramatically suppressed the luciferase activity of the 2 WT luciferase reporters; on the other hand, the mutations of the 2 binding sites successfully abolished the suppressive effects of their WT luciferase reporter (Fig. H19 MEDIATES TENDON DIFFERENTIATION 959

7 Figure 4. MiR-29b-3p suppressed tenogenic differentiation. A) The expression of tenogenic markers, such as SCX, MKX, EGR1, TNMD, FMOD, and DCN, at d 7 in htdscs transfected with mir-29b-3p or anti-mir-29b-3p mimic. Error bars = SD. *P, 0.05, **P, 0.01 vs. NC group; # P, 0.05, ## P, 0.01 vs. anti-nc group; by Student s t test. B) Sirius red staining for htdsc transfection with mir-29b-3p or anti-mir-29b-3p mimics. C) The measurement of COL1A1 content in cell lysates of htdscs transfected with mir-29b-3p or anti-mir-29b-3p mimic by ELISA. Error bars = SD. *P, 0.05 vs. NC group, ## P, 0.01 vs. anti-nc group, by Student s t test. 5E). Taken together, TGF-b1 and COL1A1 are identified to be direct targets of mir-29b-3p. Reinforced H19 overexpression promoted tendon repair in vivo We next examined the effects of H19 on tendon repair by using a mouse tendon defect model. The H19 stable htdscs (ph19) were locally injected into the defect region. After 4 wk, both H&E staining and Masson s trichrome staining indicated that the ph19 group had more matrix and collagen formation in the wound region when compared with the pbabe group (Fig. 6A). Immunohistochemistry showed that the wound regions in the ph19 group expressed more COL1A1, DCN, and TNMD than those in the pbabe group (Fig. 6B). The data confirmed that H19 overexpression promoted tendon repair in vivo, consistent with the in vitro results. 960 Vol. 31 March 2017 The FASEB Journal x LU ET AL.

8 Figure 5. Both TGF-b1 and COL1A1 are direct targets of mir-29b-3p. A) Bioinformatics prediction of target sites for mir-29b- 3p. B) The mrna expression of TGF-b1 and COL1A1 in htdscs transfected with mir-29b-3p or anti-mir-29b-3p mimic. Error bar = SD. **P, 0.01 vs. NC group, # P, 0.05 vs. anti-nc group, by Student s t test. C )TGF-b1expression in cell culture supernatant or cell lysates of htdscs transfected with mir-29b-3p or anti-mir-29b-3p mimic by ELISA. Error bars = SD. *P, 0.05, **P, 0.01 vs. NC group; # P, 0.05 vs. anti-nc group; by Student s t test. D) COL1A1 expression of htdscs transfected with mir-29b-3p or anti-mir-29b-3p mimic by Western blot analysis assays. E) The luciferase assay for validating the interactions between mir-29b-3p and TGF-b1, or COL1A1, respectively. Error bars = SD. *P, 0.05, **P, 0.01 vs. NC group, by Student s t test. DISCUSSION Tendon injures are common at work and in sports and cause considerable pain and disability to patients. There are.30 million cases of newly diagnosed tendon injures every year worldwide (29). However, the process of tendon development remains largely unknown, limiting the developmentofoptimaltherapyfortendoninjures.the poor self-repair capability of tendons leads to a long recovery period after injury or even disability, which not only affects quality of life but also becomes a heavy economic burden on patients (3, 30). In the present study, H19 acted as a mediator for tenogenic differentiation and repair via directly targeting mir-29b-3p, which suppressed TGFb1 and COL1A1 expression. So far, there has been no report on the role of lncrnas that mediate tenogenic differentiation. Our study is the first to examine this role. TDSCs have been identified as a subpopulation of residing stem cells with self-renewal and differentiation abilities and are therefore an ideal cell resource for tendon tissue engineering (20, 22, 24). Our former studies showed that htdscs have spontaneous potential for tenogenic differentiation (19, 20). Although a group of tendonassociated molecules have been identified, the tenogenic differentiation remains elusive, because of the lack of specific tenogenic markers (30). The TGF-b cascade has been recognized as one of the important signaling pathways for mir-29-mediated myogenic differentiation and renal fibrosis (31, 32). It has been demonstrated that TGFb1, -b2, and -b3 are effective tenogenic inducers; all stimulate the tendon transcriptional factors and expression of marker genes, such as SCX, COL1A1, TNMD, and DCN (33 35). In our study, TGF-b1 was used to induce tenogenic differentiation, and the transcriptional factors SCX, MKX, EGR1, EYA1 and other ECM markers, such as CO- L1A1, DCN, FMOD, and TNMD, were all up-regulated during tenogenic differentiation. As an imprinted gene, H19 is maternally expressed in embryos and is essential for embryo development (36). It also may act as a tumor suppressor in specific embryonic H19 MEDIATES TENDON DIFFERENTIATION 961

9 Figure 6. H19 overexpression promoted tendon repair in vivo. A) Histological examination of the effect of ph19 on patellar tendon repair by H&E and Masson s trichrome staining. B) Immunohistochemical staining of COL1A1, DCN, and TNMD in the tendon defect region of ph19 and pbabe groups. Scale bar, 100 mm. tumor cells (37, 38). H19 is up-regulated in multiple cancers and is involved in tumorigenesis, progression, and metastasis (39 43). However, the function of H19 in development of musculoskeletal system remains largely unknown. Our study showed that H19 promotes osteogenesis via activating Wnt/b-catenin signaling (17). This current study further confirmed that TGF-b1-induced tenogenic differentiation was mediated by H19 upregulation, and overexpression of H19 could accelerate tenogenic differentiation and promote tendon repair via stimulating TGF-b1expression, whereas there was no obvious effect on ectopic bone or cartilage formation. Recently, evidence has increasingly implied that lncrna acts as a competing endogenous (ce)rna or mirna sponge and thus modulates a variety of cellular biological activities (44, 45). H19 was reported as an mirna sponge for let-7 in mediating glucose metabolism or tumorigenesis in pancreatic cancer (25, 41); it also served as a cerna sequestering mir-138 and -200a during the epithelial mesenchymal transition in colorectal cancer (13). Furthermore, H19 activated the Wnt/b-catenin pathway by serving as a molecular sponge for mir-141 and -22, leading to the promotion of osteoblast differentiation (17). Different from the cerna hypothesis that no negative correlation exists between the expression of H19 and mirna (25), our study showed that H19 was negatively regulated by mir-29b-3p in TDSCs. Therefore, an unknown mechanism was revealed showing that H19 promoted tenogenesis by via directly targeting mir-29b- 3p and activating endogenous TGF-b1 expression. The MiR-29 family has been considered a crucial regulator of tissue fibrosis, including liver, kidney, lung, and heart, as many reports have revealed that they repress collagen synthesis via direct binding to the 39UTR in fibroblasts. In particular, down-regulation of mir-29b promoted cardiac fibrosis and systemic sclerosis via the TGF-b1/Smad pathway (46 49), indicating that mir-29b may have a significant antifibrotic role. Recently, Chen Figure 7. Schematic representation of TGF-b1/ H19/miR-29b regulatory loop during tenogenic differentiation. 962 Vol. 31 March 2017 The FASEB Journal x LU ET AL.

10 et al. (50) reported that mir-29b inhibits fibroblasts function and causes cell cyclearrestintheg 1 phase by regulating the TGF-b1/p-Smad3 pathway and P21 expression in the Achilles tendon. The TGF-b1/SMAD2/ 3 pathway also plays crucial roles in limb tendon development (51), and disruption of TGF-b signaling resultsinlossofmosttendontissuesinmouseembryos (52). Our results also showed that mir-29b suppressed tenogenic differentiation by directly targeting TGF-b1 and COL1A1 expression. Therefore, data provide a new mechanism of H19- mediated tenogenic differentiation: H19 promotes tenogenic differentiation and accelerates tendon repair by directly targeting mir-29b-3p and activating endogenous TGF-b1 expression, thus developing a feedback loop (Fig. 7). Disruption of the TGF-b1/H19/miR-29b-3p regulatory loop may suppress tenogenic differentiation and delay the tendon repair. ACKNOWLEDGMENTS This work is partially supported by the Young Scientist Mentorship and Research Training (SMART) program and the Lui Che Woo Institute of Innovation Medicine (The Chinese University of Hong Kong). The authors declare no conflicts of interest. AUTHOR CONTRIBUTIONS J.-F. Zhang and G. Li designed the experiments; Y.-F. Lu and Y. Liu analyzed the data and performed most of the experiments; Y. Liu, W.-M. Fu, J. Xu, T.-Y. Wu, Y.-X. Sun, and L.-L. Xu performed animal experiments; Y.-F. Lu, J.-F. Zhang, and Y. Liu wrote the manuscript; and all authors agreed on its contents before submission. REFERENCES 1. Schweitzer, R., Zelzer, E., and Volk, T. (2010) Connecting muscles to tendons: tendons and musculoskeletal development in flies and vertebrates. Development 137, Kvist, M. (1994) Achilles tendon injuries in athletes. Sports Med. 18, Sharma, P., and Maffulli, N. (2005) Tendon injury and tendinopathy: healing and repair. J. Bone Joint Surg. Am. 87, Andres, B. M., and Murrell, G. A. (2008) Treatment of tendinopathy: what works, what does not, and what is on the horizon. Clin. Orthop. Relat. Res. 466, Prensner, J. R., and Chinnaiyan, A. M. (2011) The emergence of lncrnas in cancer biology. Cancer Discov. 1, Rinn, J. L., and Chang, H. Y. (2012) Genome regulation by long noncoding RNAs. Annu. Rev. Biochem. 81, Zhu, L., and Xu, P. C. (2013) Downregulated LncRNA-ANCR promotes osteoblast differentiation by targeting EZH2 and regulating Runx2 expression. Biochem. Biophys. Res. Commun. 432, Zuo,C.,Wang,Z.,Lu,H.,Dai,Z.,Liu,X.,andCui,L.(2013) Expression profiling of lncrnas in C3H10T1/2 mesenchymal stem cells undergoing early osteoblast differentiation. Mol. Med. Rep. 8, Loewer,S.,Cabili,M.N.,Guttman,M.,Loh,Y.H.,Thomas,K.,Park, I. H., Garber, M., Curran, M., Onder, T., Agarwal, S., Manos, P. D., Datta, S., Lander, E. S., Schlaeger, T. M., Daley, G. Q., and Rinn, J. L. (2010) Large intergenic non-coding RNA-RoR modulates reprogramming of human induced pluripotent stem cells. Nat. Genet. 42, Pittenger,M.F.,Mackay,A.M.,Beck,S.C.,Jaiswal,R.K.,Douglas,R., Mosca, J. D., Moorman, M. A., Simonetti, D. W., Craig, S., and Marshak, D. R. (1999) Multilineage potential of adult human mesenchymal stem cells. Science 284, Prockop, D. J. (1997) Marrow stromal cells as stem cells for nonhematopoietic tissues. Science 276, Wang, Y., Xu, Z., Jiang, J., Xu, C., Kang, J., Xiao, L., Wu, M., Xiong, J., Guo, X., and Liu, H. (2013) Endogenous mirna sponge lincrna- RoR regulates Oct4, Nanog, and Sox2 in human embryonic stem cell self-renewal. Dev. Cell 25, Keniry, A., Oxley, D., Monnier, P., Kyba, M., Dandolo, L., Smits, G., and Reik, W. (2012) The H19 lincrna is a developmental reservoir of mir-675 that suppresses growth and Igf1r. Nat. Cell Biol. 14, Goshen, R., Rachmilewitz, J., Schneider, T., de-groot, N., Ariel, I., Palti, Z., and Hochberg, A. A. (1993) The expression of the H-19 and IGF-2 genes during human embryogenesis and placental development. Mol. Reprod. Dev. 34, Lustig, O., Ariel, I., Ilan, J., Lev-Lehman, E., De-Groot, N., and Hochberg, A. (1994) Expression of the imprinted gene H19 in the human fetus. Mol. Reprod. Dev. 38, Huang, Y., Zheng, Y., Jia, L., and Li, W. (2015) Long noncoding RNA H19 promotes osteoblast differentiation via TGF-b1/Smad3/HDAC signaling pathway by deriving mir-675. Stem Cells 33, Liang,W.C.,Fu,W.M.,Wang,Y.B.,Sun,Y.X.,Xu,L.L.,Wong,C.W., Chan, K. M., Li, G., Waye, M. M., and Zhang, J. F. (2016) H19 activates Wnt signaling and promotes osteoblast differentiation by functioning as a competing endogenous RNA. Sci. Rep. 6, Dey, B. K., Pfeifer, K., and Dutta, A. (2014) The H19 long noncoding RNA gives rise to micrornas mir-675-3p and mir-675-5p to promote skeletal muscle differentiation and regeneration. Genes Dev. 28, Guo, J., Chan, K. M., Zhang, J. F., and Li, G. (2016) Tendon-derived stem cells undergo spontaneous tenogenic differentiation. Exp. Cell Res. 341, Rui, Y. F., Lui, P. P., Li, G., Fu, S. C., Lee, Y. W., and Chan, K. M. (2010) Isolation and characterization of multipotent rat tendon-derived stem cells. Tissue Eng. Part A 16, Wang,B.,Guo,J.,Feng,L.,Suen,C.W.,Fu,W.M.,Zhang,J.F.,andLi, G. (2016) MiR124 suppresses collagen formation of human tendon derived stem cells through targeting egr1. Exp. Cell Res. 347, Ni, M., Lui, P. P., Rui, Y. F., Lee, Y. W., Lee, Y. W., Tan, Q., Wong, Y. M., Kong,S.K.,Lau,P.M.,Li,G.,andChan,K.M.(2012)Tendon-derived stem cells (TDSCs) promote tendon repair in a rat patellar tendon window defect model. J. Orthop. Res. 30, Yin, Z., Guo, J., Wu, T. Y., Chen, X., Xu, L. L., Lin, S. E., Sun, Y. X., Chan, K. M., Ouyang, H., and Li, G. (2016) Stepwise differentiation of mesenchymal stem cells augments tendon-like tissue formation and defect repair in vivo. Stem Cells Transl. Med. 5, Bi,Y.,Ehirchiou,D.,Kilts,T.M.,Inkson,C.A.,Embree,M.C., Sonoyama,W.,Li,L.,Leet,A.I.,Seo,B.M.,Zhang,L.,Shi,S.,and Young, M. F. (2007) Identification of tendon stem/progenitor cells and the role of the extracellular matrix in their niche. Nat. Med. 13, Kallen, A. N., Zhou, X.B., Xu,J., Qiao,C., Ma, J., Yan, L., Lu, L., Liu, C., Yi, J. S., Zhang, H., Min, W., Bennett, A. M., Gregory, R. I., Ding, Y., and Huang, Y. (2013) The imprinted H19 lncrna antagonizes let-7 micrornas. Mol. Cell 52, Li,J.,Du,S.,Sheng,X.,Liu,J.,Cen,B.,Huang,F.,andHe,Y.(2016) MicroRNA-29b inhibits endometrial fibrosis by regulating the Sp1- TGF-b1/Smad-CTGF axis in a rat model. Reprod. Sci. 23, Zhang, Y., Huang, X. R., Wei, L. H., Chung, A. C., Yu, C. M., and Lan, H. Y. (2014) mir-29b as a therapeutic agent for angiotensin IIinduced cardiac fibrosis by targeting TGF-b/Smad3 signaling. Mol. Ther. 22, Cheng, J., Wang, Y., Wang, D., and Wu, Y. (2013) Identification of collagen 1 as a post-transcriptional target of mir-29b in skin fibroblasts: therapeutic implication for scar reduction. Am. J. Med. Sci. 346, Clayton,R.A.,andCourt-Brown,C.M.(2008)Theepidemiologyof musculoskeletal tendinous and ligamentous injuries. Injury 39, Nourissat, G., Berenbaum, F., and Duprez, D. (2015) Tendon injury: from biology to tendon repair. Nat. Rev. Rheumatol. 11, Qin,W.,Chung,A.C.,Huang,X.R.,Meng,X.M.,Hui,D.S.,Yu,C.M., Sung,J.J.,andLan,H.Y.(2011)TGF-b/Smad3 signaling promotes renal fibrosis by inhibiting mir-29. J. Am. Soc. Nephrol. 22, Winbanks, C. E., Wang, B., Beyer, C., Koh, P., White, L., Kantharidis, P.,andGregorevic,P.(2011)TGF-betaregulatesmiR-206andmiR-29 H19 MEDIATES TENDON DIFFERENTIATION 963

11 to control myogenic differentiation through regulation of HDAC4. J. Biol. Chem. 286, Farhat,Y.M.,Al-Maliki,A.A.,Chen,T.,Juneja,S.C.,Schwarz,E.M., O Keefe, R. J., and Awad, H. A. (2012) Gene expression analysis of the pleiotropic effects of TGF-b1 in an in vitro model of flexor tendon healing. PLoS One 7, e Guerquin, M. J., Charvet, B., Nourissat, G., Havis, E., Ronsin, O., Bonnin, M.A.,Ruggiu,M.,Olivera-Martinez,I.,Robert,N.,Lu,Y.,Kadler,K.E., Baumberger, T., Doursounian, L., Berenbaum, F., and Duprez, D. (2013) Transcription factor EGR1 directs tendon differentiation and promotes tendon repair. J. Clin. Invest. 123, Qiu,Y.,Wang,X.,Zhang,Y.,Rout,R.,Carr,A.J.,Zhu,L.,Xia,Z., and Sabokbar, A. (2013) Development of a refined tenocyte differentiation culture technique for tendon tissue engineering. Cells Tissues Organs 197, Pathak, S., Saxena, M., D Souza, R., and Balasinor, N. H. (2010) Disrupted imprinting status at the H19 differentially methylated region is associated with the resorbed embryo phenotype in rats. Reprod. Fertil. Dev. 22, Hao, Y., Crenshaw, T., Moulton, T., Newcomb, E., and Tycko, B. (1993) Tumour-suppressor activity of H19 RNA. Nature 365, Isfort, R. J., Cody, D. B., Kerckaert, G. A., Tycko, B., and LeBoeuf, R. A. (1997) Role of the H19 gene in Syrian hamster embryo cell tumorigenicity. Mol. Carcinog. 20, Li,H.,Yu,B.,Li,J.,Su,L.,Yan,M.,Zhu,Z.,andLiu,B.(2014) Overexpression of lncrna H19 enhances carcinogenesis and metastasis of gastric cancer. Oncotarget 5, Luo, M., Li, Z., Wang, W., Zeng, Y., Liu, Z., and Qiu, J. (2013) Long noncoding RNA H19 increases bladder cancer metastasis by associating with EZH2 and inhibiting E-cadherin expression. Cancer Lett. 333, Ma,C.,Nong,K.,Zhu,H.,Wang,W.,Huang,X.,Yuan,Z.,andAi,K. (2014) H19 promotes pancreatic cancer metastasis by derepressing let-7 s suppression on its target HMGA2-mediated EMT. Tumour Biol. 35, Tsang, W. P., Ng, E. K., Ng, S. S., Jin, H., Yu, J., Sung, J. J., and Kwok, T. T. (2010) Oncofetal H19-derived mir-675 regulates tumor suppressor RB in human colorectal cancer. Carcinogenesis 31, Zhu,Z.,Song,L.,He,J.,Sun,Y.,Liu,X.,andZou,X.(2015)Ectopic expressed long non-coding RNA H19 contributes to malignant cell behavior of ovarian cancer. Int. J. Clin. Exp. Pathol. 8, Poliseno, L., Salmena, L., Zhang, J., Carver, B., Haveman, W. J., and Pandolfi, P. P. (2010) A coding-independent function of gene and pseudogene mrnas regulates tumour biology. Nature 465, Salmena, L., Poliseno, L., Tay, Y., Kats, L., and Pandolfi, P. P.(2011) A cerna hypothesis: the Rosetta Stone of a hidden RNA language? Cell 146, Cushing, L., Kuang, P., and Lü, J. (2015) The role of mir-29 in pulmonary fibrosis. Biochem. Cell Biol. 93, He,Y.,Huang,C.,Lin,X.,andLi,J.(2013)MicroRNA-29family,a crucial therapeutic target for fibrosis diseases. Biochimie 95, Li, J., Cen, B., Chen, S., and He, Y. (2016) MicroRNA-29b inhibits TGF-b1-induced fibrosis via regulation of the TGF-b1/ Smad pathway in primary human endometrial stromal cells. Mol. Med. Rep. 13, Yang, T., Liang, Y., Lin, Q., Liu, J., Luo, F., Li, X., Zhou, H., Zhuang, S., and Zhang, H. (2013) mir-29 mediates TGFb1-induced extracellular matrix synthesis through activation of PI3K-AKT pathway in human lung fibroblasts. J. Cell. Biochem. 114, Chen, Q., Lu, H., and Yang, H. (2014) Chitosan inhibits fibroblasts growth in Achilles tendon via TGF-beta1/Smad3 pathway by mir-29b. Int.J.Clin.Exp.Pathol.7, Havis, E., Bonnin, M. A., Olivera-Martinez, I., Nazaret, N., Ruggiu, M., Weibel, J., Durand, C., Guerquin, M. J., Bonod-Bidaud, C., Ruggiero, F., Schweitzer, R., and Duprez, D. (2014) Transcriptomic analysis of mouse limb tendon cells during development. Development 141, Pryce, B. A., Watson, S. S., Murchison, N. D., Staverosky, J. A., Dünker, N., and Schweitzer, R. (2009) Recruitment and maintenance of tendon progenitors by TGFbeta signaling are essential for tendon formation. Development 136, Received for publication June 7, Accepted for publication November 14, Vol. 31 March 2017 The FASEB Journal x LU ET AL.