Characterizing the neuroendocrine and ovarian defects of androgen receptor-knockout female mice

Transcription

1 Am J Physiol Endocrinol Met 35: E717 E76, 13. First pulished July 3, 13; doi:1.115/jpendo Chrcterizing the neuroendocrine nd ovrin defects of ndrogen receptor-knockout femle mice Xioing B. Cheng, Mrk Jimenez, 1 Reen Desi, 1 Lind J. Middleton, 1 Shi R. Joseph, 1 Gung Ning, 3 Chrles M. Alln, 1 Jeremy T. Smith, 4 Dvid J. Hndelsmn, 1 nd Kirsty A. Wlters 1 1 ANZAC Reserch Institute, Andrology Lortory, Concord Hospitl, University of Sydney, New South Wles, Austrli; Deprtment of Endocrinology nd Metolism, Shnghi Tong Ji University Medicl School, Yngpu Hospitl, Shnghi, Chin; 3 Shnghi JioTong University Medicl School, Ruijin Hospitl, Shnghi Institute of Endocrinology nd Metolism, Shnghi Key Lortory of Endocrine Tumors, nd the Endocrine nd Metolic Division, E-Institutes of Shnghi Universities, Rui-Jin Hospitl, Shnghi Jio Tong University School of Medicine, Shnghi, Chin; nd 4 School of Antomy, Physiology nd Humn Biology, University of Western Austrli, Western Austrli, Austrli Sumitted 13 My 13; ccepted in finl form July 13 Cheng XB, Jimenez M, Desi R, Middleton LJ, Joseph SR, Ning G, Alln CM, Smith JT, Hndelsmn DJ, Wlters KA. Chrcterizing the neuroendocrine nd ovrin defects of ndrogen receptor-knockout femle mice. Am J Physiol Endocrinol Met 35: E717 E76, 13. First pulished July 3, 13; doi:1.115/jpendo Homozygous ndrogen receptor (AR)-knockout (ARKO) femle mice re sufertile due to oth intr- nd extrovrin (neuroendocrine) defects s defined y ovry trnsplnttion. Using ARKO mice, this study set out to revel the precise ARregulted pthwys required for optiml ndrogen-regulted ovultion nd fertility. ARKO femles exhiit deficient neuroendocrine negtive feedck, with reduced serum luteinizing hormone (LH) response to ovriectomy (OVX) (P.1). Positive feedck is lso ltered s intct ARKO femles, t lte proestrus, exhiit n often mistimed endogenous ovultory LH surge. Furthermore, t lte proestrus, intct ARKO femles disply diminished preovultory serum estrdiol (E ; P.1) nd LH (P.5) surge levels nd reduced Kiss1 mrna expression in the nteroventrl periventriculr nucleus (P.1) compred with controls. However, this reduced ovultory LH response in intct ARKO femles cn e rescued y OVX nd E priming or tretment with endogenous GnRH. These findings revel tht AR regultes the negtive feedck response to E,E -positive feedck is compromised in ARKO mice, nd AR-regulted negtive nd positive steroidl feedck pthwys impct on intrhypothlmic control of the kisspeptin/gnrh/lh cscde. In ddition, introvrin AR-regulted pthwys controlling ntrl to preovultory follicle dynmics re disrupted ecuse dult ARKO ovries collected t proestrus hve smll ntrl follicles with reduced oocyte/follicle dimeter rtios (P.1) nd incresed proportions of unhelthy lrge ntrl follicles (P.5) compred with controls. As consequence of errnt folliculr growth ptterns, proestrus ARKO ovries lso exhiit fewer preovultory follicle (P.5) nd corpor lute numers (P.1). However, emryo development to the lstocyst stge is unchnged in ARKO femles, nd hence, the sufertility is consequence of reduced ovultions nd not ltered emryo qulity. These findings revel tht the AR hs functionl role in neuroendocrine regultion nd timing of the ovultory LH surge s well s ntrl/ preovultory follicle development. ndrogen receptor; ovultion; femle reproduction A HEALTHY PREOVULATORY FOLLICLE produces mturing oocyte nd secretes estrdiol (E ), leding to preovultory surge, which in turn triggers the ovultory luteinizing hormone (LH) Address for reprint requests nd other correspondence: K. Wlters, Andrology Lortory, ANZAC Reserch Institute, Sydney, NSW 139, Austrli (e-mil: kwlters@nzc.edu.u). surge nd the susequent folliculr rupture nd relese of the oocyte (18). Throughout most of the murine estrous cycle, E exerts negtive feedck on gondotropin-relesing hormone (GnRH) nd LH secretion until the fternoon of proestrus, when there is switch to positive feedck, with rising folliculr E secretion evoking n rupt relese of the preovultory GnRH surge nd then the LH surge tht triggers ovultion (, 3). Although follicle development nd ovultion re physiologiclly well-chrcterized events, the underlying moleculr pthwys re still eing unrveled. The ndrogen receptor (AR), memer of the nucler receptor superfmily encoded y the X chromosome (31), is expressed in the ovry of mny mmmlin species (pig: 9; cow: 19; humn: 4; rt: 58; primte: 69), nd in vivo nd in vitro phrmcologicl studies hve demonstrted direct ndrogen effects on follicle growth (16, 35, 61 63). Findings from severl ndrogen-resistnt femle mouse models [AR-knockout (ARKO)] hve confirmed role for AR-medited ndrogen ctions in femle reproduction (5, 48, 63 65, 67). ARKO femles re sufertile with fewer pups per litter (5, 48, 64), nd dysfunctionl ovultion ws identified s key defect, with femles exhiiting reduced corpor lute numers (5, 48, 64). Reciprocl ovry trnsplnt experiments etween ARKO nd norml femles demonstrted tht oth intr- nd extrovrin defects contriute to the sufertility oserved in ARKO femle mice (65). Within ARKO ovries, folliculr helth ws reduced with n increse in folliculr tresi (5, 48, 64) nd dissocition of cumulus cells from the oocyte in preovultory follicles (5). Furthermore, delyed first litter (64), longer estrous cycles (5, 64), nd the finding tht reduced nturlly ovulted oocyte numers oserved in ARKO femles were overcome y gondotropin (pregnnt mre serum gondotropin/humn chorionic gondotropin) hyperstimultion suggests n extrovrin defect in gondotropin regultion (64). Additionlly, disrupted steroidl feedck signling ws oserved in ARKO femles with n increse in estrus serum FSH levels nd hypersensitivity to negtive E feedck on LH secretion (65). AR is lso widely expressed in the rin, notly in the preoptic re, hypothlmus, nd other limic structures (44), where it is regulted y testosterone (T) nd E (9). Hence, AR signling is likely to influence oth negtive nd positive steroidl feedck mechnisms in the HPG xis governing pulstile hypothlmic GnRH secretion nd consequentil pituitry LH nd FSH relese, notly the ovultory LH surge /13 Copyright 13 the Americn Physiologicl Society Downloded from ( ) on Mrch 3, 19. E717

2 E718 Although hypothlmic GnRH secretion is tightly responsive to negtive feedck from circulting gondl steroids, it is controversil whether GnRH neurons express steroid receptors (7, 6, 5), so their steroidl control is likely to involve intermediry neurons (). Kisspeptin (Kp; product of the Kiss1 gene) is vitl for reproduction, with disruption of its expression or its receptor [G protein-coupled receptor 54 (GPR54)] cusing reproductive filure due to gondotrophin deficiency (38). Kp neurons express AR nd estrogen receptor (ER) nd directly innervte GnRH neurons (38). Kp lso displys potent stimultory effect on gondotrophin relese, with the dministrtion of Kp resulting in n rupt nd sustined LH secretion (15, 38). Sustntil evidence supports Kp-GPR54 signling in generting the estrogen-induced preovultory LH surge (15), nd AR expression in Kp neurons implictes them s n AR trget. Recent findings implicte AR in the regultion of ovultion, with expression of ovultionrelted genes (Cox- nd Areg) incresed in mouse ovries fter tretment with dihydrotestosterone (DHT) ut suppressed y the AR ntgonist flutmide (7). A role for AR-medited ndrogen ctions in triggering ovultion is supported y phrmcologicl evidence in hens, where flutmide dministrtion locked preovultory surges of E nd LH nd ovultion (43). However, in women, dministrtion of high levels of T represses LH secretion, implying tht n optiml level of AR ctivtion is required to mintin norml ptterns of LH secretion (47). Finlly, positive effect of ndrogens on the numer of follicles ville for ovultion is supported y the findings tht dministrtion of T or DHT during the folliculr phse increses preovultory follicle nd corpor lute numers within porcine ovries (1, 11). In summry, there is strong evidence supporting role for introvrin nd neuroendocrine ndrogen ctions vi the AR in the control of femle fertility; however, the precise pthwys underlying these fundmentl mechnisms re yet to e elucidted. Becuse ovultion is key defect in ARKO femles, using our ARKO mice (64), this study set out to determine the specific AR-medited mechnisms involved in the control of lte follicle development, ovultory pthwys, nd the susequent viility of the relesed oocytes. MATERIALS AND METHODS Mice Mice were mintined under stndrd housing conditions (d liitum ccess to food nd wter in temperture- nd humiditycontrolled 1-h light cycle environment) t the ANZAC Reserch Institute. All procedures were performed under ketmine-xylzine nesthesi. All procedures were pproved y the Sydney South West Are Helth Service Animl Welfre Committee within Ntionl Helth nd Medicl Reserch Council (NHMRC) guidelines for niml experimenttion. Genertion nd Genotyping of ARKO Mice Femle homozygous ARKO mice were generted y crossing ARflox mice (37) with either CMV-Cre (64) or Sox-Cre mice (1, 49) s universl deletors. Both Cre lines creted equivlent ARKO phenotypes (49). Genomic DNA isolted from toe clip or til iopsy, s descried previously (5), ws used s templte for PCR genotyping to detect rerrngements in the mouse Ar gene, s descried previously (64). Forwrd PCR primers upstrem of the first LoxP site [within mouse AR exon 3 (AREx3-F, CTTCTCTCAGGGAAACAGAAGT) nd within NEO cssette (ARNeo-F, TAGATCTCTCGTGGGATCATTG)] were used with common reverse primer locted within intron 3 (AR-R, GGGAGACACAGGATAGGAAATT). Two product sizes, 613 p for intct Ar nd 89 p for AR floxed Ar, were otined. Mice contining the CMV-Cre gene were detected using primers nd PCR conditions s descried (46). Glol ARKO mles nd femles were distinguished using primers nd PCR conditions for the mouse Y chromosome sry gene, s descried previously (37, 64). Specimen Collection Dissected ovries were weighed [diestrus: WT (n 1) nd ARKO (n 9); proestrus: WT (n 16) nd ARKO (n 16)], fixed in 4% prformldehyde t 4 C overnight, nd stored in 7% ethnol efore histologicl processing. Ovries for histologicl ssessement (collected t mo of ge) were rndomly selected nd processed through grded lcohols into glycol methcrylte resin (Technovit 71; Hereus Kulzer, Chtswood, Austrli). Ovries were serilly sectioned t m, stined with periodic cid Schiff, nd counterstined with hemtoxylin. Blood ws collected from sexully mture femles y crdic exsnguintion under ketmine-xylzine nesthesi, rested t room temperture for min, nd centrifuged t 5, rpm for 5 min, nd then collected serum ws stored t C. Assessment of Estrous Cycle Estrous cycle stge ws determined in sexully mture femles y light microscope nlysis of vginl epithelil cell smers collected dily (1 AM ech morning) in l of sterile PBS nd then trnsferred to glss slides, ir-dried, nd stined with.5% trypn lue for microscopy (66). Hormone Mesurements in Ovry-Intct Mice Mice were mintined on 1:1-h light cycle, with lights eing turned on t 6 nd off t 18. The ovultory LH surge in mice typiclly occurs round the time when lights re turned off (8). To determine the optiml time to collect lood smples to ssess the LH surge in our mouse colony, lood ws collected y crdic exsnguintion under ketmine-xylzine nesthesi from wild-type (WT) femles ( 4 mo of ge) t 9, 173, 18, 183, nd 19 t proestrus (6 1 femles/time point). Serum ws stored t C until ssy. Timing of the LH surge ws lso ssessed in ARKO femles ( 4 mo of ge) t the sme time points (6 1 femles/time point). Becuse the ovultory LH surge occurs t 183 in our colony of WT mice (Fig. 1A), this time ws chosen s the optimum time to ssess the nturl LH surge in our WT nd ARKO femles t proestrus. WT nd ARKO lood smples were collected t diestrus [WT (n 1), ARKO (n 9)] nd proestrus [WT (n 16), ARKO (n 15)]. Ovriectomy nd Estrogen Replcement Serum LH nd FSH were determined from lood smples collected from intct WT nd ARKO femles t 8 9 [sl group; WT (n 5), ARKO (n 6)], s descried previously (49, 64, 66). Negtive feedck. To evlute estrogen sensitivity of negtive feedck, serum LH levels were evluted fter ovriectomy (OVX) with nd without E (Sigm) dministrtion, s descried previously (1, 65) with the following minor modifiction. On the dy of surgery (dy ), 8-wk-old femles were nesthetized etween 8 nd 11 to undergo OVX nd dministered (suderml) t the sme time with either n empty silstic tue implnt [OVX, AM group; WT (n 5), ARKO (n 6)] or 1-cm implnt filled with.5 g ofe mixed into Silicone Type A Medicl Adhesive [OVX E, AM group; WT (n 6), ARKO (n 6)] (Dow Corning). On dy 6 post-ovx, mice received 1 g of estrdiol enzote (EB; Sigm) in.1 ml of sesme oil injected (sc) etween 9 nd 93. Blood smples were collected t 8 9 on dy 7. AJP-Endocrinol Met doi:1.115/jpendo Downloded from ( ) on Mrch 3, 19.

3 A LH (ng/ml) B LH (ng/ml) WT 9: 17:3 18: 18:3 19: Time of dy ARKO * 9: 17:3 18: 18:3 19: Time of dy Lights off * Lights off * * C LH (ng/ml) D FSH (ng/ml) E719 Fig. 1. Hormone levels. A: serum LH levels in control wild-type (WT) mice in the morning, lte fternoon, nd evening of proestrus (P.5); n 6 1 femles/time point. B: serum LH levels in control ndrogen receptor-knockout (ARKO) mice in the morning, lte fternoon, nd evening of proestrus (P.1); n 6 1 femles/time point. C nd D: open rs, WT; lck rs, ARKO. Serum LH (P.5; C) nd FSH levels (D) t diestrus nd proestrus. : WT (n 1), ARKO (n 9); proestrus: WT (n 16), ARKO (n 15). Dt expressed s mens SE. Different letters denote sttisticlly significnt differences. *Significnt difference from seline (9)., Outliers. Positive feedck. The LH surge response to dministrtion of E ws ssessed in 8-wk-old femles tht were ovriectomized nd treted with E nd EB, s descried previously (1). On the dy of surgery (dy ), 8-wk-old femles were nesthetized etween 8 nd 11 to undergo OVX nd dministered (suderml) t the sme time with 1-cm implnt filled with.5 g ofe mixed into Silicone Type A Medicl Adhesive (Dow Corning) [OVX E, PM group; WT (n 6), ARKO (n 8)]. On dy 6 post-ovx, mice received 1 g of EB (Sigm) in.1 ml of sesme oil injected (sc) etween 9 nd 93. Blood smples were collected t 183 on dy 7. Pituitry Response to GnRH Stimultion Pituitry response to GnRH stimultion ws studied in - to 3-mo-old femles, s descried previously (1, 17). Femles were ovriectomized nd implnted with.5 g ofe implnts, s descried ove. On dy 6 post-ovx, mice received 1 g of EB injected (sc) etween 9 nd 93. Between 8 nd 9 on dy 7 post-ovx, femles were injected (sc) with ng/kg GnRH (L7134; Sigm) or.1 ml of sline vehicle. Blood smples were collected 1 min fter GnRH or sline injection [sline: WT (n 6), ARKO (n 7); GnRH: WT (n 7), ARKO (n 7)]. Hormone Assys Mouse serum LH nd FSH were determined using speciesspecific immunofluorometric ssy, s descried previously (7, 6, 66). All immunossys were performed in single tch. Serum levels [diestrus: WT (n 1), ARKO (n 8); proestrus: WT (n 16), ARKO (n 15)] of estrone (E 1), E, T, nd DHT nd its two principl metolites, 5 -ndrostne-3,17 -diol (3 diol) nd 5 -ndrostne-3,17 -diol (3 diol), were mesured in extrcts of 1 l of mouse serum y liquid chromtogrphy-tndem mss spectrometry (), s dpted for mouse serum (3). The levels of detection for E 1,E, T, DHT, 3 diol, nd 3 diol were.5 pg/ml, 1 pg/ml,.1 ng/ml,.3 ng/ml,.4 ng/ml, nd.4 ng/ml, respectively. To chrcterize T metolism, the sum of DHT nd its two mjor primry metolites, 3 diol nd 3 diol, ws clculted. Kiss1 In Situ Hyridiztion In situ hyridiztion with rdioleled ( 35 S) Kiss1 rioproes ws performed s descried previously (5, 54). The Kiss1-specific cdna templte spnned ses of the mouse cdna sequence (Gen- Bnk ccession no. AF47576) nd ws generted y PCR with primers contining promoters for T7 RNA polymerse in the ntisense direction nd T3 RNA polymerse in the sense direction. Kiss1 rioproes were pplied (55 C for 16 h) nd slides dipped in Ilford K5 photogrphic emulsion (Ilford Imging), stored t 4 C, nd developed wk lter. Kiss1 mrna-contining cells were identified under drk-field illumintion, nd imge nlysis ws crried out using rndomly coded slides with softwre designed to count the totl numer of cells nd the numer of silver grins per cell (gpc), n index of Kiss1 mrna content per cell (Imge-Pro Plus). Cells were counted when the silver grin density ws greter thn three times the ckground. For ech niml, the numer of Kiss1 mrna-positive cells grouped y their loction ws counted [diestrus: WT (n 5), ARKO (n 5); proestrus: WT (n 5), ARKO (n 6)]. Dt re expressed within res of the rin s the men numer of identifile cells nd the men numer of silver gpc. Follicle Clssifiction, Enumertion, Growth, nd Helth Totl numers of growing follicles per ovry t different developmentl stges for ech of the WT (control) nd ARKO ovries [WT (n 5), ARKO (n 4)] were determined s descried previously (36, 64). The follicle clssifiction system ws sed on the system used y Myers et l. (36). Briefly, follicles clssified s smll prentrl follicles contined n oocyte with 1.5 to two lyers of cuoidl grnulos cells, lrge prentrl follicles were clssified y hving n oocyte surrounded y more thn two nd up to five lyers of cuoidl grnulos cells, smll ntrl follicles contined n oocyte surrounded with more thn five lyers of cuoidl grnulos cells nd/or one or two smll res of folliculr fluid, wheres lrge ntrl follicles contined single lrge ntrl cvity, nd preovultory follicles possessed single lrge ntrum nd n oocyte surrounded y cumulus AJP-Endocrinol Met doi:1.115/jpendo Downloded from ( ) on Mrch 3, 19.

4 E7 cells t the end of stlk of murl grnulos cells. Corpus lute were identified y morphologicl properties consistent with luteinized follicles nd y eing visile throughout severl seril sections. Follicles were counted on ll seril sections throughout ech ovry using n Olympus microscope with Stereo Investigtor softwre (MicroBright- Field, Williston, VT). For ll histologicl nlysis, repetitive counting of follicles ws voided y counting/mesuring only follicles contining n oocyte with visile nucleolus. To void is, ll ovries were nlyzed without knowledge of genotype. Oocyte/follicle dimeter rtio ws clculted t ech developmentl stge y mesuring dimeters of follicles nd their contined oocyte in two perpendiculr xes using light microscope t, clirted using Stereo Investigtor computer softwre (MicroBrightfield). Follicles were clssified s unhelthy if they contined degenerte oocyte nd/or 1% of the grnulos cells were pyknotic in ppernce, s descried previously (59, 64). The proportion of unhelthy follicles/ovry ws estimted s the percentge of ll follicles t tht developmentl stge. Quntittive Rel-Time RT-PCR Totl RNA ws extrcted from whole ovries t the proestrus stge of the estrous cycle [8 1 wk of ge; WT (n 5), ARKO (n 6)] using Tri Regent (Sigm) ccording to the mnufcturer s protocol. Reverse trnscription ws performed with totl RNA using the SuperScript III First-Strnd Synthesis System (Invitrogen). Quntittive rel-time PCR nlysis of ovrin cdnas ws performed on Corett RotorGene 6 (Corett Reserch, Sydney, Austrli) using the SensiMix SYBR Kit (Bioline) s recommended nd s descried previously (64 66). A stndrd curve ws generted for ech gene from five seril dilutions of purified PCR product from the sme primers designed for quntittive PCR using Wizrd DNA Clen-Up System (Promeg). Stndrds (dilutions used for ech gene were 1 to 1 6 ) were ssigned n ritrry vlue, nd men reltive mrna expression of smples determined in duplicte ws stndrdized to mouse Rpl19 levels (housekeeping gene), s descried previously (64 66). There ws no significnt differences in Rpl19 mrna levels etween tretment groups (P.5). No templte controls, sustituting wter for cdna, nd negtive reverse trnscription were included in ech run. Gene expression ws detected with specific commercilly purchsed SYBR Green primers for Lhcgr or the following primers pirs nd nneling tempertures: Str (CTTGGCT- GCTCAGTATTGAC nd TGGTGGACAGTCCTTAACAC, 55 C) nd Cyp111 (CGATACTCTTCTCATGCGAG nd CTTTCTTCCAG- GCATCTGAAC, 55 C). Rection steps were 15 min t 95 C, followed y 4 cycles of denturtion t 95 C for 3 s, nneling t 55 C for 3 s, nd extension t 7 C for 3 s. Uterine Flushing nd Blstocyst Nucler Stining Six- to 1-wk-old femle mice [WT (n 6), ARKO (n 7)] were housed with proven fertile WT mle (AR /Y ). Cges were monitored dily for the identifiction of copultory plug. The identifiction of plug ws recorded s dy 1, nd 3 dys fter this femle mice were collected nd emryos flushed from the uterus using M medium (Sigm). The numer of corpor lute present on ovries, emryo retrievl [(no. of emryos collected/no. of corpor lute present) 1], nd stges of emryonic development were recorded. Emryo potentil ws further ssessed y collecting lstocysts nd determining their totl cell numers, s descried previously (4) with modifiction [WT (n 49), ARKO (n 8)]. Blstocysts were wshed in Dulecco s phosphte-uffered sline solution (PBS; Sigm), fixed in % prformldehyde-pbs for 3 min, wshed in PBS, stined in 8 g/ml Hoechst 3334 (Sigm) for 1 min, wshed in PBS, mounted onto slides, nd visulized under UV light. Sttisticl Anlysis Sttisticl nlysis ws performed using NCSS 7 softwre (NCSS Sttisticl Softwre, Kysville, UT). Dt tht ws not normlly distriuted ws trnsformed prior to nlysis using log trnsformtion. Sttisticl differences were tested y ANOVA with post hoc test using Fisher s lest significnt diffrence multiple comprison test. All prmetric tests were confirmed y the nlogous nonprmetric tests. The effects of genotype (ARKO, WT) nd estrous stge (diestrus, proestrus) on serum sex steroids were nlyzed y ANOVA, where ll or nerly ll smples were detectle (T, 3 diol), or y Fisher s test, where significnt proportion of smples were elow the limits of detection (DHT, E 1,E,3 diol). Fisher s test compred the proportions of detectle vs. nondetectle smples ccording to genotype nd estrus stge using Mntel-Henszel nlysis for strtified tles. Anlysis of the effect of genotype t diestrus nd proestrus ws determined using Kruskl-Wllis onewy ANOVA on Rnks with djustment for ties, where nondetectle steroid smples were treted s the vlue set for the limit of detection. P vlues.5 were considered sttisticlly significnt. RESULTS Serum LH nd FSH Levels in Ovry-Intct Mice Compred with seline levels (collected t 9 on the morning of proestrus), the onset of the ovultory surge in WT femles occurred 3 min fter lights off t 183 on the evening of proestrus (P.5) (Fig. 1A). As expected for norml LH surge, LH levels in WT femles were still elevted t 19. ARKO femles exhiited n irregulr elevtion in LH levels, with significnt premture elevtion in LH levels oserved t 173 s well s 183 compred with seline LH levels (P.1; Fig. 1B). Becuse our mouse colony (s ssessed in WT femles) exhiited the onset of the ovultory surge.5 h into the drk cycle, t 183 on the evening of proestrus (P.5; Fig. 1A), this ws chosen s the time to ssess the nturl LH surge in WT nd ARKO femles t proestrus. Ovultory surge LH levels were decresed significntly y 49% t proestrus in ARKO femles compred with WT femles (ARKO: ng/ml, WT: ng/ml, P.5; Fig. 1C). Anlysis of LH levels lso reveled significnt effect of estrous stge (P.1; Fig. 1C). LH levels t diestrus or FSH levels t diestrus nd proestrus were not significntly different etween WT nd ARKO femles (Fig. 1, C nd D). Serum steroid levels in ovry-intct mice Serum E ws more frequently detectle in WT (17/6) thn ARKO femles (8/3) (P.5) nd in proestrus thn diestrus for oth WT (13/16 vs. 4/1; P.5) nd ARKO femles (8/15 vs. /8; P.1). At proestrus, ARKO femles hd significntly lower levels of E thn WT femles (P.1; Fig. A). Serum E 1 ws undetectle in ll smples t diestrus nd in ARKO femles t proestrus ut ws more frequently detectle in WT femles t proestrus thn t diestrus or in ARKO femles t proestrus (1/14, oth P.1). At proestrus, ARKO femles hd significntly lower levels of E 1 thn WT femles (P.1; Fig. B). Serum T ws significntly higher in ARKO thn WT femles (P.5) nd in proestrus vs. diestrus (P.5). There ws no significnt difference etween genotypes t diestrus or proestrus (Fig. C). Serum DHT levels were significntly more frequently detectle in ARKO femles compred with WT femles t diestrus (8/8 vs. 4/1, P.1) ut not t proestrus (6/15 vs. 1/16, P.7). Frequency of detectle serum DHT smples did not chnge etween diestrus nd proestrus in AJP-Endocrinol Met doi:1.115/jpendo Downloded from ( ) on Mrch 3, 19.

5 E71 A C E B D F E1 (pg/ml) DHT (ng/ml) 3β diol (ng/ml) E (pg/ml) T (ng/ml) 3α diol (ng/ml) Fig.. Serum estrogen nd ndrogen levels. Œ, WT mice;, ARKO mice. Dshed line indictes limit of detection. Solid line indictes medin, sence of solid line when the medin is equl to the detection limit. Serum levels of estrdiol (E ; P.1) (A), estrone (E 1; P.1) (B), testosterone (T; C), dihydrotestosterone (DHT; P.1) (D), 5 -ndrostne-3,17 -diol (3 diol; P.1) (E), nd 5 -ndrostne-3,17 -diol (3 diol; P.5) (F) t diestrus nd proestrus. : WT (n 1), ARKO (n 8); proestrus: WT (n 16), ARKO (n 15). *Significnt difference. WT mice, ut the smples were significntly less detectle t proestrus in ARKO mice (8/8 vs. 6/15, P.1). At diestrus, ARKO femles hd significntly higher levels of DHT thn WT femles (P.1; Fig. D). Serum 3 diol ws significntly higher in ARKO thn WT femles (P.1) ut did not differ ccording to estrous cycle stge. At diestrus (P.1) nd proestrus (P.1), ARKO femles hd significntly higher levels of 3 diol thn WT femles (Fig. E). Serum 3 diol ws undetectle in the mjority of diestrus smples (/18) ut ws more frequently detectle t proestrus (14/31, P.1), where it ws more often detected in ARKO compred with WT smples (1/15 vs. 4/16, P.5). At proestrus, ARKO femles hd significntly higher levels of 3 diol thn WT femles (P.5; Fig. F). ARKO femles exhiited n increse in T metolism, s the comined levels of DHT nd its two mjor primry metolites 3 diol nd 3 diol were significntly incresed compred with WT smples t diestrus (medins; ARKO:.9 ng/ml, WT:. ng/ml, P.1) nd proestrus (medins; ARKO: 1. ng/ml, WT:.4 ng/ml, P.1) (dt not shown). Kiss1 mrna Expression Kiss1 mrna ws present in the nteroventrl periventriculr nucleus (AVPV) of ll nimls (Fig. 3, B E). In oth WT nd ARKO mice, the numer of Kiss1-expressing cells ws greter in the fternoon of proestrus compred with diestrus (P.1). During proestrus, there ws no difference etween ARKO nd WT femles in the numer of Kiss1 cells (P.6; Fig. 3F). However, Kiss1 mrna content per cell ws significntly decresed y 39% t proestrus in ARKO femles compred with WT femles (P.1; Fig. 3G). Kiss1 mrna ws lso present in the rcute nucleus of ll nimls, ut this did not differ with either the genotype or stge of estrous cycle (no. of Kiss1 cells; diestrus: WT cells, ARKO cells; proestrus: WT cells, ARKO 15 4 cells; Kiss1 mrna content per cell; diestrus: WT 59 1 gpc, ARKO gpc; proestrus: WT 58 5 gpc, ARKO 63 1 gpc) (dt not shown). Serum LH Response to OVX To determine the effect of AR loss upon negtive feedck, LH response ws ssessed fter OVX for 7 dys. Ovriectomized WT femles exhiited significnt increse in serum LH (1.7.4 ng/ml) compred with sl LH levels in ovry-intct WT mice (.1.3 ng/ml, P.1; Fig. 4A). In contrst, there ws no significnt difference in LH levels etween OVX (.6.15 ng/ml) nd ovry-intct ARKO femles (..4 ng/ml) (Fig. 4A). E -Negtive Feedck E replcement in OVX WT femles repressed levels of LH significntly post-ovx (WT OVX, AM: ng/ml; WT OVX E, AM:..9 ng/ml, P.1). However, there ws no significnt reduction in levels of LH fter E replcement in OVX ARKO femles, (ARKO OVX, AM:.6.14 ng/ml; ARKO OVX E, AM:.1.3 ng/ml; Fig. 4A). E -Positive Feedck Assessment of the LH surge y collection lte in the fternoon reveled tht oth WT nd ARKO femles (WT OVX AJP-Endocrinol Met doi:1.115/jpendo Downloded from ( ) on Mrch 3, 19.

6 E7 Fig. 3. Kiss1 mrna expression in the nteroventrl periventriculr nucleus (AVPV) during the evening of proestrus. A: the distriution of Kiss1 mrna expression in rin mp (regm.5 mm), modified with permission from Pxinos nd Frnklin (4). Kiss1 mrna-expressing neurons re represented y lck circles in squred region indicting the loction of the photomicrogrphs. mpoa, medil preoptic re; MnPO, medin preoptic nucleus; SHy, septohypothlmic nucleus; MS, medil septl nucleus. B E: representtive drk-field photomicrogrphs showing Kiss1 mrna-expressing neurons (s reflected y the presence of white clusters of silver grins) in the AVPV from WT nd ARKO mice during diestrus (B nd C) or lte in the fternoon of proestrus (D nd E). F nd G: open rs, WT mice; lck rs, ARKO mice. F: no. of Kiss1 mrna-expressing cells (P.5). G: Kiss1 mrna content/cell (P.1). : WT (n 5), ARKO (n 5); proestrus: WT (n 5), ARKO (n 6). Dt expressed s mens SE. Different letters denote sttisticlly significnt differences. A F Kiss1 mrna cells, B D G Kiss1 mrna content per cll WT WT C E ARKO µm ARKO E, AM:..9 ng/ml; WT OVX E, PM: ng/ml; ARKO OVX E, AM:.1.3 ng/ml; ARKO OVX E, PM:.1.44 ng/ml, P.1) hd significnt increses in LH levels compred with femles collected on the morning of dy 7 (Fig. 4A). Pituitry Response to Exogenous GnRH Both WT nd ARKO OVX E -treted mice given exogenous GnRH responded with significnt elevtion of serum LH (WT sline:.4.9 ng/ml; WT GnRH: 1.1. ng/ml; ARKO sline:.8.19 ng/ml; ARKO GnRH: ng/ml, P.5; Fig. 4B). Ovry Weights, Follicle Popultions, Development nd Helth, nd mrna Expression of Key Mrkers Involved in Follicle Development Ovry weight ws significntly decresed y 51% t diestrus in ARKO femles compred with WT controls (ARKO: 4..4 mg, WT: mg, P.1) nd y 38% t proestrus (ARKO: 3.8. mg, WT: mg, P.1) (Fig. 5A). At the proestrus stge, ARKO ovries collected from 6- to 8-wk-old femles exhiited greter thn twofold (P.5) decrese in preovultory follicle numers (ARKO:.3.8; WT: 5..9, P.5) nd n pproximtely fourfold reduction (P.1) in corpor lute numers (ARKO:..9; WT: , P.1) when compred with WT controls (Fig. 5B). The verge numer of smll nd lrge ntrl follicles did not differ etween ARKO nd WT ovries (Fig. 5B). Rel-time RT-PCR nlysis on WT nd ARKO ovries collected t proestrus reveled no significnt difference etween WT nd ARKO ovries in Lhcgr mrna expression levels or expression of key mrkers of the shift in steroidogenesis (Str, Cyp111; Fig. 5C). Furthermore, ARKO ovries collected t the proestrus stge exhiited 143% increse in the percentge of unhelthy lrge ntrl follicles present compred with WT ovries (ARKO: , WT: , P.5; Fig. 5D). Histologicl nlysis of ovrin sections identified n increse in the numer of pyknotic grnulos cells present in ARKO lrge ntrl follicles (Fig. 5D). Smll ntrl follicles within ARKO ovries lso exhiited 15% reduction in oocyte/follicle dimeter rtio compred with WT controls (ARKO:.3.4, WT:.4.7, P.1; Fig. 5E). Histologicl nlysis of ovrin sections showed tht development of the ntrl cvity ppered delyed in ARKO follicles, with ARKO ntrl follicles of similr dimeter exhiiting smller ntrl cvities compred with WT ntrl follicles (Fig. 5E). Emryo Development nd Qulity Compred with WT femles, ARKO femles collected 4 dys fter the identifiction of copultory plug exhiited 41% decrese (P.1) in the totl numer of corpor lute present (ARKO: ; WT: 9.7.5). There ws no significnt difference in the percentge of emryos retrieved (ARKO: 81.4% 6., WT: 69.7% 8.; confirming tht of the oocytes ovulted, the mjority were collected for ssessment), the percentge to hve developed to the lstocyst stge (ARKO: %, WT: %), or the totl cell counts per lstocyst (ARKO: , WT: 44.8.) etween ARKO nd WT controls (dt not shown). DISCUSSION In this study, we revel tht AR-medited ctions re involved in regulting gondotropin secretion, in prticulr positive feedck, y ovrin steroids. Furthermore, we demonstrte tht AR-medited ctions re involved in optiml ntrl AJP-Endocrinol Met doi:1.115/jpendo Downloded from ( ) on Mrch 3, 19.

7 A LH (ng/ml) LH (ng/ml) B ,c follicle development nd helth nd thus the ripening of the mturing follicle to the preovultory stge. Previously, centrl role for AR ctions in the control of femle fertility hs een proposed (1,, 41, 43, 47, 55, 56, 65), ut the precise mechnisms involved remin to e confirmed. An extrovrin defect in ARKO femles is indicted y the presence of longer estrous cycles (5, 65) nd delyed time to first litter (64). Reciprocl ovry trnsplnttion etween ARKO nd WT femles identified extrovrin defects s plying role in the oserved sufertility of ARKO femles (65). In the current study, sl levels of serum LH t diestrus re not different etween WT nd ARKO femles. However, unlike in WT femles, following the loss of ovrin feedck y OVX, ARKO femles do not exhiit n increse in LH levels. This decrese in the ility of ARKO femles to regulte hormonl control implies n AR-dependent dmping or desensitizing of the ARKO response to negtive feedck signling y E. In the present study, we reveled tht intct ARKO femles collected t lte proestrus exhiit significntly reduced levels of serum LH reltive to the norml ovultory LH surge in WT femles. Furthermore, the timing of the emergence of the LH surge in ARKO femles ws often premture, nd the durtion ,c AM AM AM PM Sline GnRh Sline GnRh OVX E Scrifice Fig. 4. Hormone levels in intct nd ovriectomized (OVX) mice with nd without E tretment. Open rs, WT mice; lck rs, ARKO mice. A: LH serum levels in ovry-intct (seline smples collected etween 8 nd 9) nd OVX femles E collected on dy 7 post-ovx in the morning (8 9) for negtive feedck nd lte fternoon (183) for positive feedck (P.1); n 5 8 femles/group/genotype. B: serum LH levels in OVX E -treted femles given either sline (control) or gondotropinrelesing hormone (GnRH) etween 8 nd 9 on dy 7 post-ovx nd collected 1 min lter (P.5); n 6 7 femles/group/genotype. Dt expressed s mens SE. Different letters denote sttisticlly significnt differences. E73 of the surge ppered reduced. Previously, in nother ARKO mouse model, no differences in hormone levels of E, progesterone, T, LH, or FSH were identified t the proestrus stge (48). However, unlike in our study, it is not cler when smples were collected during proestus (48), nd hence, the lter study my hve missed differences in the ovultory LH surge or the ssocited surge in serum T (3, 4, 8, 3) t proestrus. Our current findings imply tht long with defective lte follicle development contriuting to the reduced ovultions oserved in ARKO femles, ltered timing, reduced mgnitude, nd durtion of the ovultory LH surge in ARKO femles lso ply role. Expression of Kiss1 mrna ws reduced in the AVPV of ARKO femles during the fternoon of proestrus, consistent with the diminished preovultory surge. Kisspeptin, derived from the Kiss1 gene, is vitl for the stimultion of GnRH secretion (51), nd its AVPV expression is criticl for the GnRH/LH surge in mice (14, 53). Moreover, the surge in E, oserved t proestrus nd essentil for the relese of the LH surge (33), is lso significntly decresed in ARKO femles compred with WT femles. Therefore, the reduced Kiss1 expression nd preovultory LH levels oserved in ARKO femles t proestrus my e consequence of decresed nd/or sent E surge rther thn their response to E -positive feedck. This is supported y our previous findings tht Cyp191 (romtse) expression is significntly decresed in ARKO femles (64). Furthermore, s expected with reduction in the romtiztion of ndrogens to E, we hve lso identified n increse in serum levels of ndrogens in ARKO mice nd n increse in testosterone metolism, s the comined levels of DHT nd its two mjor primry metolites, 3 diol nd 3 diol, were significntly incresed t proestrus in ARKO femles compred with WT femles. There is no difference etween genotypes in the ility to induce LH surge fter OVX nd E priming, showing tht ARKO femles re cple of generting n LH surge in response to n dequte dose of E. Likewise, the pituitry response to exogenous GnRH tht is required for the LH surge (13, 34, 39, 45, 7), does not differ etween WT nd ARKO femles. These findings revel tht the AR hs role in the priming of ovultion. Our results imply tht AR regultes negtive nd positive steroidl feedck mechnisms, in prticulr the preovultory E surge, which impcts the control of the kisspeptin/gnrh/lh cscde nd thus the timing nd mgnitude of the ovultory LH surge. ARKO femles in the current study exhiited significntly fewer corpor lute numers per ovry, indictive of fewer ovultions. In greement, we nd other groups hve shown tht ARKO femle mice exhiit mjor disruptions in ovultion rtes (5, 48, 64). Previous reports on follicle popultions in ARKO ovries hve grouped preovultory follicles with smll nd lrge ntrl stges (5, 48) or hve een crried out t the diestrus stge (64), so specific chnges to preovultory follicles remin undefined. Hence, to determine whether the reduction in ovultion rtes in ARKO femles is due to reduced numers of preovultory follicles present in ARKO ovries, we ssessed follicle popultions t the proestrus stge. In the present study, we hve reveled tht preovultory follicle numers within ARKO ovries re reduced significntly, implying tht fewer follicles develop to the finl stges of follicle development. Gene expression of LH receptor nd key mrkers of the shift in AJP-Endocrinol Met doi:1.115/jpendo Downloded from ( ) on Mrch 3, 19.

8 E74 Fig. 5. Ovry weights, follicle quntifiction nd helth, nd gene expression. Open rs, WT mice; lck rs, ARKO mice. Ovries were collected t diestrus or lte in the fternoon of proestrus. A: ovry weights (P.5). : WT (n 1), ARKO (n 9); proestrus: WT (n 16), ARKO (n 16). B: verge no. of ntrl follicles, preovultory follicles, nd corpor lute (P.5) per ovry t proestrus. WT (n 5), ARKO (n 4). C: rel-time RT-PCR nlysis of expression levels of key functionl mrkers in ovries collected t proestrus. StAR, steroidogenic cute regultory protein; Cyp111, cytochrome P45 side-chin clevge; Lhcgr, LH receptor. WT (n 5), ARKO (n 6). D: %unhelthy ntrl nd preovultory follicles (P.5). WT (n 5), ARKO (n 4). Histologicl lrge ntrl follicle crosssection from WT nd ARKO ovries; rrows indicte pyknotic grnulos cells. E: oocyte/ follicle rtio in ntrl nd preovultory follicles (P.1). WT (n 5), ARKO (n 4). Histologicl smll ntrl follicle cross-section from WT nd ARKO ovries showing smll ntrl cvity in lrge ntrl ARKO follicle. Dt expressed s mens SE. Different letters denote sttisticlly significnt differences. A Ovry weight (mg) B Counts/ovry C Reltive nmra level Smll ntrl Lrge ntrl c StAR Cyp111 Lhcgr Corpor lute D % unhelthy follicles E Oocyte:follicle dimeter rtio Smll ntrl Smll ntrl Lrge ntrl WT Lrge ntrl Preovultory Preovultory ARKO Preovultory WT ARKO 9µm 9µm steroidogenesis (Str nd Cyp111) from E to progesterone dominnce t proestrus do not differ etween genotypes. However, oocyte/follicle dimeter rtios re reduced in ARKO smll ntrl follicles, indicting possile disruption in the connection etween oocyte nd somtic cells nd n ltered pttern of follicle growth. Furthermore, ARKO follicles pper to hve impired/delyed ntrum development, nd there is significnt increse in the percentge of morphologiclly unhelthy lrge ntrl ARKO follicles. Hence, dysfunctionl lte follicle helth my led to the development of fewer preovultory follicles nd thus reduced E levels, which will contriute to the reduced ovultions oserved in ARKO femles. However, reduced E levels my lso e due to impired follicles secreting less E. In vivo nd vitro phrmcologicl studies hve demonstrted tht ndrogens hve direct effects on erly follicle growth (35, 6, 68, 71) nd follicle helth (6, 3), with exogenous ndrogens exerting oth inhiitory nd stimultory effects t different follicle developmentl stges (reviewed in Ref. 63). Findings from the current study provide direct evidence for AR-medited ctions plying vitl role in mintining follicle helth nd norml ntrl follicle development. The mintennce of AR expression in cumulus cells of the oocyte cumulus complex (57) nd the reduced ility of immture murine oocytes to mture nd undergo emryonic development fter T exposure (5) suggests role for ARmedited ction in oocyte viility. Results from the current study show tht development to the lstocyst stge is not ltered in nturlly mted ARKO femles, implying tht ARmedited ctions do not ply vitl role in erly emryo development. This is in greement with our previous findings of unltered fertiliztion nd progression to the two-cell stge rtes in ARKO femles (64); hence, the sufertility oserved in ARKO femles is consequence of reduced ovultions nd not ltered emryo qulity. In conclusion, our findings demonstrte tht AR-medited ctions ply role in regulting the timing nd mgnitude of the ovultory LH surge nd thus ovultion rtes. Our results imply tht AR regultes ovultion priming y mediting negtive nd positive steroidl feedck mechnisms, which in turn trigger the kisspeptin/gnrh/lh cscde. Furthermore, we hve identified tht AR ctions ply positive role in the lte stges of follicle development y mintining ntrl follicle helth nd promoting preovultory follicle development. ACKNOWLEDGMENTS We thnk Dr. L. Ro (Wlter nd Eliz Hll Institute) nd A. McMhon (Hrvrd University) for the supply of the Sox-Cre mice nd J. Zjc (University of Melourne) for ccess to the ARflox mice. We thnk Jenny Spliviero nd Lucy Yng for technicl support nd Chris O Neill for the emryo nucler stining method. X. B. Cheng thnks Shnghi Jio Tong University nd The University of Sydney for llowing her to undertke this work through the Chinese Funding Scheme (Chin Scholrship Council - Joint Trining Scheme). GRANTS This work ws supported y the NHMRC nd the Austrlsin Menopuse Society. K. A. Wlters ws supported y Project Grnt from the NHMRC (no ). DISCLOSURES The uthors hve nothing to disclose. AUTHOR CONTRIBUTIONS X.B.C., C.M.A., J.T.S., D.J.H., nd K.A.W. contriuted to the conception nd design of the reserch; X.B.C., M.J., R.D., L.J.M., S.R.J., J.T.S., nd K.A.W. performed the experiments; X.B.C., S.R.J., J.T.S., D.J.H., nd K.A.W. nlyzed the dt; X.B.C., C.M.A., J.T.S., D.J.H., nd K.A.W. interpreted the results of the experiments; X.B.C. nd K.A.W. drfted the mnuscript; X.B.C., C.M.A., J.T.S., D.J.H., nd K.A.W. edited nd revised the mnuscript; X.B.C., M.J., R.D., L.J.M., S.R.J., G.N., C.M.A., J.T.S., D.J.H., nd K.A.W. pproved the finl version of the mnuscript; J.T.S., D.J.H., nd K.A.W. prepred the figures. AJP-Endocrinol Met doi:1.115/jpendo Downloded from ( ) on Mrch 3, 19.

9 E75 REFERENCES 1. Aott DH, Dumesic DA, Eisner JR, Colmn RJ, Kemnitz JW. Insights into the development of polycystic ovry syndrome (PCOS) from studies in prentlly ndrogenised femle rhesus monkeys. Trends Endocrinol Met 9: 6 67, Aott DH, Pdmnhn V, Dumesic DA. Contriutions of ndrogen nd estrogen to fetl progrmming of ovrin dysfunction. Reprod Biol Endocrinol 4: 17, Arhm GE. Ovrin nd drenl contriution to peripherl ndrogens during the menstrul cycle. J Clin Endocrinol Met 39: , Arhm GE, Chkmkjin ZH. Serum steroid levels during the menstrul cycle in ilterlly drenlectomized womn. J Clin Endocrinol Met 37: , Anderiesz C, Trounson AO. The effect of testosterone on the mturtion nd developmentl cpcity of murine oocytes in vitro. Hum Reprod 1: , Azzolin GC, Siduddin S. Effect of ndrogens on the ovrin morphology of the hypophysectomized rt. Proc Soc Exp Biol Med 17: 7 73, Belshm DD, Evngelou A, Roy D, Duc VL, Brown TJ. Regultion of gondotropin-relesing hormone (GnRH) gene expression y 5lphdihydrotestosterone in GnRH-secreting GT1 7 hypothlmic neurons. Endocrinology 139: , Bronson FH, Vom Sl FS. Control of the preovultory relese of luteinizing hormone y steroids in the mouse. Endocrinology 14: , Cmpo SM, Crson RS, Findly JK. Distriution of specific ndrogen inding sites within the ovine ovrin follicle. Mol Cell Endocrinol 39: 55 65, Crdens H, Herrick JR, Pope WF. Incresed ovultion rte in gilts treted with dihydrotestosterone. Reproduction 13: ,. 11. Crdens H, Pope WF. Administrtion of testosterone during the folliculr phse incresed the numer of corpor lute in gilts. J Anim Sci 7: , Chppell PE, Schneider JS, Kim P, Xu M, Lydon JP, O Mlley BW, Levine JE. Asence of gondotropin surges nd gondotropin-relesing hormone self-priming in ovriectomized (OVX), estrogen (E)-treted, progesterone receptor knockout (PRKO) mice. Endocrinology 14: , Clrke IJ, Thoms GB, Yo B, Cummins JT. GnRH secretion throughout the ovine estrous cycle. Neuroendocrinology 46: 8 88, Clrkson J, d Anglemont de Tssigny X, Moreno AS, Colledge WH, Herison AE. Kisspeptin-GPR54 signling is essentil for preovultory gondotropin-relesing hormone neuron ctivtion nd the luteinizing hormone surge. J Neurosci 8: , Clrkson J, Herison AE. Oestrogen, kisspeptin, GPR54 nd the preovultory luteinising hormone surge. J Neuroendocrinol 1: , Frookhi R. Effects of romtizle nd nonromtizle ndrogen tretments on luteinizing hormone receptors nd ovultion induction in immture rts. Biol Reprod 33: , Glidewell-Kenney C, Hurley LA, Pfff L, Weiss J, Levine JE, Jmeson JL. Nonclssicl estrogen receptor lph signling medites negtive feedck in the femle mouse reproductive xis. Proc Ntl Acd Sci USA 14: , Gore-Lngton RE, Armstrong DT. Folliculr steroidogenesis nd its control. In: The Physiology of Reproduction, edited y Knoil E nd Neill JD. New York: Rven, 1994, p Hmpton JH, Mnikkm M, Luhn DB, Smith MF, Grverick HA. Androgen receptor mrna expression in the ovine ovry. Domest Anim Endocrinol 7: 81 88, 4.. Hrwood DT, Hndelsmn DJ. Development nd vlidtion of sensitive liquid chromtogrphy-tndem mss spectrometry ssy to simultneously mesure ndrogens nd estrogens in serum without derivtiztion. Clin Chim Act 49: 78 84, Hyshi S, Lewis P, Pevny L, McMhon AP. Efficient gene modultion in mouse epilst using SoxCre trnsgenic mouse strin. Mech Dev 119, Suppl 1: S97 S11,.. Herison AE. Multimodl influence of estrogen upon gondotropinrelesing hormone neurons. Endocr Rev 19: 3 33, Hillier SG, Ross GT. Effects of exogenous testosterone on ovrin weight, folliculr morphology nd introvrin progesterone concentrtion in estrogen-primed hypophysectomized immture femle rts. Biol Reprod : 61 68, Horie K, Tkkur K, Fujiwr H, Suginmi H, Lio S, Mori T. Immunohistochemicl locliztion of ndrogen receptor in the humn ovry throughout the menstrul cycle in reltion to oestrogen nd progesterone receptor expression. Hum Reprod 7: , Hu YC, Wng PH, Yeh S, Wng RS, Xie C, Xu Q, Zhou X, Cho HT, Tsi MY, Chng C. Sufertility nd defective folliculogenesis in femle mice lcking ndrogen receptor. Proc Ntl Acd Sci USA 11: , Hung X, Hrln RE. Asence of ndrogen receptors in LHRH immunorective neurons. Brin Res 64: , Jimenez M, Spliviero JA, Grootenhuis AJ, Verhgen J, Alln CM, Hndelsmn DJ. Vlidtion of n ultrsensitive nd specific immunofluorometric ssy for mouse follicle-stimulting hormone. Biol Reprod 7: 78 85, Judd HL, Yen SS. Serum ndrostenedione nd testosterone levels during the menstrul cycle. J Clin Endocrinol Met 36: , Kumr RC, Thkur MK. Androgen receptor mrna is inversely regulted y testosterone nd estrdiol in dult mouse rin. Neuroiol Aging 5: , Levine JE. New concepts of the neuroendocrine regultion of gondotropin surges in rts. Biol Reprod 56: 93 3, Luhn DB, Joseph DR, Sullivn PM, Willrd HF, French FS, Wilson EM. Cloning of humn ndrogen receptor complementry DNA nd locliztion to the X chromosome. Science 4: 37 33, McNmr KM, Hrwood DT, Simninen U, Wlters KA, Jimenez M, Hndelsmn DJ. Mesurement of sex steroids in murine lood nd reproductive tissues y liquid chromtogrphy-tndem mss spectrometry. J Steroid Biochem Mol Biol 11: , Moenter SM, Crty A, Krsch FJ. The estrdiol-induced surge of gondotropin-relesing hormone in the ewe. Endocrinology 17: , Moenter SM, Crty A, Loctelli A, Krsch FJ. Pttern of gondotropin-relesing hormone (GnRH) secretion leding up to ovultion in the ewe: existence of preovultory GnRH surge. Endocrinology 19: , Murry AA, Gosden RG, Allison V, Spers N. Effect of ndrogens on the development of mouse follicles growing in vitro. J Reprod Fertil 113: 7 33, Myers M, Britt KL, Wreford NG, Eling FJ, Kerr JB. Methods for quntifying folliculr numers within the mouse ovry. Reproduction 17: , Notini AJ, Dvey RA, McMnus JF, Bte KL, Zjc JD. Genomic ctions of the ndrogen receptor re required for norml mle sexul differentition in mouse model. J Mol Endocrinol 35: , Okley AE, Clifton DK, Steiner RA. Kisspeptin signling in the rin. Endocr Rev 3: , Pu KY, Berri M, Hess DL, Spies HG. Preovultory gondotropinrelesing hormone surge in ovrin-intct rhesus mcques. Endocrinology 133: , Pxinos G, Frnklin KBJ. The Mouse Brin Atls in Stereotxic Coordintes. Sn Diego, CA: Acdemic, Pieleck J, Quynor SD, Moenter SM. Androgens increse gondotropin-relesing hormone neuron firing ctivity in femles nd interfere with progesterone negtive feedck. Endocrinology 147: , Pursel VG, Wll RJ, Rexrod CE, Hmmer RE, Brinster RL. A rpid whole-mount stining procedure for nuclei of mmmlin emryos. Theriogenology 4: , Rngel PL, Shrp PJ, Gutierrez CG. Testosterone ntgonist (flutmide) locks ovultion nd preovultory surges of progesterone, luteinizing hormone nd oestrdiol in lying hens. Reproduction 131: , Sr M, Luhn DB, French FS, Wilson EM. Immunohistochemicl locliztion of the ndrogen receptor in rt nd humn tissues. Endocrinology 17: , Srkr DK, Chipp SA, Fink G, Sherwood NM. Gondotropinrelesing hormone surge in pro-oestrous rts. Nture 64: , Schwenk F, Bron U, Rjewsky K. A cre-trnsgenic mouse strin for the uiquitous deletion of loxp-flnked gene segments including deletion in germ cells. Nucleic Acids Res 3: , Serfini P, Silv PD, Pulson RJ, Elkind-Hirsch K, Hernndez M, Loo RA. Acute modultion of the hypothlmic-pituitry xis y intr- AJP-Endocrinol Met doi:1.115/jpendo Downloded from ( ) on Mrch 3, 19.