Physiology & Behavior

Transcription

1 Physiology & Behvior 1 (1) Contents lists ville t SciVerse ScienceDirect Physiology & Behvior journl homepge: Physiologicl nd ehviorl responses to intermittent strvtion in C7BL/6J mice Li-N Zhng, Shron E. Mitchell, Ctherine Hmly, Dvid G. Morgn, John C. Clphm, John R. Spekmn, Institute of Biologicl nd Environmentl Sciences, University of Aerdeen, Aerdeen, Scotlnd, UK Reserch nd Development (CVGI), AstrZenec, Alderley Prk, Cheshire, UK rticle info strct Article history: Received 4 My 11 Received in revised form 8 August 11 Accepted 6 August 11 Keywords: Intermittent strvtion Physicl ctivity Body temperture C7BL/6J mice The dul intervention point model sttes tht ody mss is controlled y upper nd lower intervention points, ove nd elow which nimls (nd humns) intervene physiologiclly to ring their ody mss ck into the cceptle rnge. It hs een further suggested tht the lower intervention point my e defined y the risk of strvtion, while the upper intervention point my e defined y the risk of predtion. The ojective of the present study ws to test whether the risk of strvtion determines the lower intervention point nd to exmine the physiologicl nd ehviorl mechnisms tht underpin the regultion of ody mss, when the risk of strvtion is incresed. Sixty-four mice were exposed to rndom dys of complete fsting or % food restriction nd their ody mss nd ft mss responses were mesured. Food intke, physicl ctivity nd ody temperture were mesured throughout the experiment. In ddition, plsm leptin nd insulin, triglyceride nd non-esterified ftty cids, long with hypothlmic neuropeptides gene expression in the rcute nucleus were ssessed fter 13 nd 4 dys of tretment. We found tht C7BL/6J mice incresed ody mss nd ftness in response to short-term (13 dys) intermittent fsting, which ws restored to seline s the tretment ws prolonged. In contrst, intermittently % food restricted mice showed no significnt chnges in ody mss or ftness. Over the first 13 dys of tretment the dt were consistent with the dul intervention point model s the mice showed oth incresed ody mss nd diposity over this period. Over the more protrcted period of 4 dys the effect wned nd ws therefore inconsistent with the model. The ody mss nd ft mss gins in intermittently fsted mice were minly ccounted for y incresed food intke. Elevted NPY gene expression fter 13 dys (three 4 h fsting events) my hve driven the increse in food intke. However, no chnges were oserved in such neuropeptides s POMC, CART, AgRP, O-R nd SOCS 3 or circulting levels of leptin, insulin, NEFA nd TG. Hypothermi during fsting dys my hve lso contriuted to the increse in ody mss. Over 4 dys of tretment (nine 4 h fsting events) cumultive food intke ws not ffected y intermittent strvtion. However physicl ctivity, minly ctivity during the light phse ws lowered suggesting n dpttion to unpredictle strvtion. Overll, mice exhiited different ehviorl nd physiologicl responses to intermittent strvtion depending on the durtion of tretment. 11 Pulished y Elsevier Inc. 1. Introduction 1.1. Body mss regultion The glol epidemic of oesity hs rised the need for etter understnding of the mechnisms tht regulte ody nd ft mss. A lnce etween energy intke nd energy expenditure is necessry to mintin stle ody mss. It is well estlished tht the centrl nervous system (CNS) regultes food intke nd energy expenditure in response to neuronl, hormonl nd nutrient signls [1 3]. The hypothlmus is the most studied re in CNS with respect to the regultion of energy homeostsis. The rcute nucleus in prticulr is Corresponding uthor. Tel.: ; fx: E-mil ddress: J.Spekmn@dn.c.uk (J.R. Spekmn). known to ply n importnt role in energy homeostsis ecuse it contins two distinct popultions of neurons: pro-opiomelnocortin (POMC) neurons tht express the endogenous norectic melnocortin receptor gonist (α-melnocyte stimulting hormone, α-msh) long with cocine-nd-mphetmine-regulted trnscript (CART), nd neurons tht express neuropeptide Y (NPY) nd lso the endogenous orexigenic melnocortin receptor ntgonist, gouti-relted protein (AgRP) [4 6]. These neuronl popultions respond to peripherl signls, such s leptin, insulin nd gstrointestinl hormones y modifying the production of the ove neuropeptides tht modulte energy lnce [7]. Moreover, leptin signling within neurons is dependent on the presence of the long form of the leptin receptor (O-R) [8], which signls principlly vi the Jnus kinse (JAK)/ signl trnsducer nd ctivtor of trnscription 3 (STAT3) pthwy [9]. The suppressor of cytokine signling 3 (SOCS3) is negtive regultor of the leptin receptor which is stimulted y the JAK/STAT /$ see front mtter 11 Pulished y Elsevier Inc. doi:1.116/j.physeh

2 L.-N. Zhng et l. / Physiology & Behvior 1 (1) pthwy [1 13]. Gene expression levels of O-R nd SOCS3 re mrkers of leptin sensitivity [14]. There hve een severl theoreticl models tht hve ttempted to conceptulize the mechnisms involved in the regultion of ody mss nd ftness. Kennedy (193) proposed the liposttic set point model which suggested tht the size of ody ft depots is sensed y lipostt, which djusts food intke nd energy metolism to mintin the ody nd ft msses t set-point [1]. Although leptin hs een often interpreted s the moleculr mnifesttion of the liposttic ft signl [16], this model is in conflict with the evidence in ptterns of chnges in niml nd humn ody mss [17,18]. An lterntive interprettion emerged suggesting tht ody mss is not regulted y set-point, ut rther is controlled y upper nd lower intervention points, ove nd elow which nimls (nd humns) intervene physiologiclly to ring their ody mss ck into the cceptle rnge [19,]. In humns the upper intervention point my e locted t different positions in different individuls explining why some individuls ecome oese when exposed to environments with redily ville food supplies, ut others re le to regulte their ody weights t norml levels. Bsed on dt from smll mmmls nd irds, Spekmn (7) hs further suggested tht the lower intervention point my e defined y the risk of strvtion while the upper intervention point my e defined y the risk of predtion []. In this scenrio, one would expect tht n incresed risk of strvtion would increse the lower intervention level nd nimls would gin ft nd ody mss. 1.. Intermittent strvtion Periods of negtive energy lnce rising from restricted feeding or totl strvtion re common events [1]. Throughout their lives, smll mmmls must fce periodic food shortges interspersed y periods of food undnce. Stochsticlly imposed intermittent periods of fsting (complete sence of food) or periodic food restriction (involving reduced levels reltive to hitul intke, ut not complete sence) my mimic the unpredictle food vilility in the wild. However, few studies hve investigted the physiologicl nd ehviorl responses to stochstic food exposure. Swiss mice showed incresed food intke nd decresed energy expenditure on dys tht intervened etween 4 h fsting events over 4 weeks tretment (including 3 or 4 fsting dys nd 4 or 3 feeding dys ech week), nd they decresed overll ody mss []. However in nother study the sme group found tht 4 weeks tretment including 3 fsting dys nd 4 feeding dys ech week hd no effect on overll ody mss [3]. Alternte dy fsting (ADF) is similr nd widely studied regimen, however, most of the studies hve een focused on the eneficil effects on ging nd the effect of ADF on ody weight is less often reported. Body mss hs een shown to e highly vrile in response to ADF in oth humns nd in niml models. In Fisher rts, when ADF regimens were pplied in the short term, no effect on ody weight ws oserved fter weeks [4], wheres gins in ody mss were noted in C17BL/1 mice fter 8 weeks []. However, in other studies, when ADF ws dministered for 1 weeks, ody mss decresed in oth C7BL/6 mice nd rts. This vriility in response is confusing nd its reltionship to the dul-intervention model is uncertin ecuse in ADF the fsting dys come t predictle intervls, nd hence the uncertin risk of strvtion is not ltered y this tretment. Even in the studies performed y Zho nd collegues [,3] the occurrence of fsting dys is so frequent tht it my e predictle leding to different responses from those predicted y the dul-intervention point model. In the present study we imed firstly to test whether strvtion risk defines the lower intervention point for ody mss nd diposity s suggested in the dul intervention point model, y experimentlly incresing strvtion risk over period of 4 dys, y exposing mice to nine rndom dys of complete fsting or food restriction, nd recording their ody mss nd ft mss responses. Second we investigted the physiologicl nd ehviorl mechnisms tht underpin the regultion of ody mss during intermittent fsting or food restriction, y mesuring food intke, physicl ctivity nd ody temperture throughout the experiment. In ddition, NPY, AgRP, POMC, CART, O-R nd SOCS3 gene expression in the rcute nucleus of the hypothlmus were ssessed fter 13 dys nd 4 dys of tretment. We lso mesured plsm leptin nd insulin, s well s triglyceride (TG) nd non-esterified ftty cids (NEFA). We hypothesized tht if the dul intervention point model is correct rndomly imposed intermittent fsting nd food restriction would cuse ody mss nd ft mss to increse s result of n increse in the lower intervention point. Secondly, we hypothesized tht physiologicl nd ehviorl compenstion mechnisms would e employed to djust ody mss nd ftness within the rnge nd thirdly, tht leptin, insulin nd other potentil signls would chnge in response to intermittent fsting nd food restriction nd neuropeptides sensitive to leptin would e involved in the ody mss response.. Mteril nd methods.1. Animl housing nd intermittent strvtion regimen Sixty four femle C7BL/6 mice ged 6 8 weeks were purchsed from Chrles River (Chrles River UK Ltd, Kent, UK) nd housed in single cges (M3 cge cm, NKP Cges, Kent, UK) in temperture controlled room (1±1 C) under 1:1-hour light:drk photoperiod with the lights coming on t 6: nd dwn/dusk period of min t either end of the light period. Wood shvings nd shredded pper edding were provided for enrichment. At round ge 9 1 weeks mice were implnted with trnsmitters tht mesured their ody tempertures nd physicl ctivity levels (detils elow) nd were then fed stndrd control diet (D14B, 1% kcl/ft, Reserch Diet, New Brunswick, NJ, USA) d liitum until weeks of ge when they were rndomly ssigned into three groups: control group AL, fed d liitum (n=); IF, intermittently fsted (n=); IR, intermittently % food restricted (n=). All mice hd free ccess to wter throughout the study. All procedures were reviewed y locl ethicl committee nd performed in ccordnce with UK home office regultions under license PPL 6/377 held y JRS. Mice were divided into two cohorts contining 3 mice in ech AL (n=1); IF (n=11); IR (n=11). Note the smple sizes in ech group nd cohort were unlnced ecuse the numer of recording pds for the implnted trnsmitters (see elow) ws fixed t 64. Body mss nd food intke were recorded for 3 dys on dily sis prior to the intermittent strvtion regime. Animls were stochsticlly exposed to 4 h fsting or restriction on 9 occsions over period of 4 dys. Ech strvtion dy ws lwys followed y non-strvtion dy. Proility of next dy would e strvtion ws set t.1 nd ws decided using rndom integers. During the tretment, dys 4, 7, 1, 14, 16,, 6, 9 nd 39 were ssigned s fsting/restriction dys. On ech tretment dy, IF mice were completely deprived of food, while IR mice were given % of their verge dily food intke mesured over the seline period t the strt of the experiment. Mice were provided with d liitum food etween fsting/restriction dys. Body mss nd food intke were mesured t 1 h every dy when food ws given or removed. The first cohort of mice ws killed on dy 13 of the tretment, while the second cohort ws killed on dy 4... Physicl ctivity nd ody temperture Prior to experimenttion the mice were implnted with telemetry trnsmitter to monitor ody temperture (T ) nd physicl

3 378 L.-N. Zhng et l. / Physiology & Behvior 1 (1) ctivity (PA) (Model PDT-4 E-Mitter, Mini-Mitter, Bend, OR, USA). The surgery ws crried out under nesthesi induced y mixed flow of isofluorne nd oxygen. An incision of pproximtely 1. cm ws mde in the ventrl skin, then second smller incision mde through the peritonel wll. The trnsmitter ws inserted intrperitonelly, nd the two lyers were sutured seprtely (Ethicon Vicryl: W998; W&J Dunlops Ltd., Dumfries, UK). The surgicl procedure took round 1 min/mouse nd mice were given weeks with miniml hndling to llow them to recover from the surgery. A receiver pd (ER-4 Receiver, Mini-Mitter, Bend, OR, USA) under the cge where the mouse ws housed received PA nd T informtion from the trnsmitter which ws collected every minute y Windows PC-sed dt cquisition system (VitlView : Mini-Mitter, Bend, OR, USA). PA nd T recordings were verged for ech hour to show dily ctivity nd T ptterns. Dily mens, nd mens during drk nd light phses were clculted throughout the seline nd tretment periods..3. Body ftness nd plsm metolites levels Body ft mss (FM) ws determined using dul energy X-ry sorptiometry (DXA; PIXImus Series Densimeters, GE Medicl Systems Ultrsound nd BMD, Bedford, UK). Mice were nesthetized during the scn. Dt generted from the DXA softwre were corrected using n eqution developed specificlly for our mchine [6]. DXA ws performed to ssess ody ftness t seline in oth cohorts, nd dditionlly on dy 1 for cohort 1 nd on dys 4, 3, 37 for cohort. Mice were scrificed fter fsting for 4 h. Blood smples were collected y crdic puncture for the determintion of circulting hormone nd metolite levels (leptin, insulin, TG nd NEFA). Ft depots (epidydiml ft, perirenl ft, mesenteric ft nd sucutneous ft) were dissected nd weighed. All lood smples were plced in EDTA-treted vils nd centrifuged t 4 C t 1 rpm for 1 min. Blood plsm ws stored t 8 C until nlysis. Plsm leptin nd insulin were mesured with ELISA-sed methods using commercilly ville kits (mouse leptin ELISA kit, Millipore Billeric, MA, USA; mouse insulin ELISA kit, Crystl Chem Inc, Downers Grove, IL, USA, respectively), while plsm NEFA nd TG were mesured using colorimetric ssys (NEFA-HR (), Wko Chemicls, Neuss, Germny; Triglyceride nd Free Glycerol Kit, Sigm-Aldrich, Kent, UK, respectively)..4. Gene expression of neuropeptides.4.1. Tissue collection nd preprtion Mice were killed y CO inhltion. Their rins were immeditely removed, frozen in isopentne over dry ice nd stored t 8 C. Coronl μm sections of the hypothlmic region were cut on cryostt (Leic, CM3S, Milton Keynes, UK) nd thw mounted on poly-llysine-coted slides. slides (with pproximtely 6 sections on ech slide) through the hypothlmus were collected per niml, nd they were numered s 1 1, 11. Two slides numered s 1 nd 11 (or nd 1, etc.) were used for one specific neuropeptide..4.. Rioproe synthesis Templte DNA, complimentry to the mrna sequence of interest, ws gifted from Dr. Shron Mitchell. Briefly frgments were mplified from mouse rin cdna y polymerse chin rection (PCR). Primers (Eurofins MWG Operon, London, UK), frgment size nd Accession numers re detiled in Tle 1. PCR products were cloned into either the pcr-script Amp SK (+) vector (Strtgene, CA, USA) or the pgmet Esy Vector (Promeg, Southmpton, UK) nd trnsformed into competent cells. Plsmid DNA ws isolted using the QIAprep Spin Miniprep kit (Qigen, Germny) nd linerized with pproprite restriction enzymes (Promeg, Southmpton, UK). All sequences were verified y Eurofins Sequencing Services (London, UK). The linerized DNA ws trnscried using T7, T3 or SP6 RNA polymerse promoters mtched to restriction site contined within the vector. Rioproes were leled with 3S-UTP (Perkin Elmer, UK) nd unincorported lel removed y spinning through Chromospin columns (BD Biosciences, UK). Finlly rioproes were mde up to finl concentrtion of 1 16 c.p.m ml 1 in hyridiztion uffer. Antisense nd sense rioproes were tested for specificity nd ckground inding In situ hyridiztion Lwre ws ked t C nd ll solutions mde up in.1% diethylpyrocronte (DEPC) to prevent RNse contmintion. Sections were fixed in 4% prformldehyde (Sigm-Aldrich, UK)/.1 M phosphte uffer (144 mm NH PO 4 nd.6 mm N HPO4, ph 7.4; PB) for min on ice nd wshed in.1 M PB. To eliminte ckground signl nd inctivte RNses, sections were first immersed in.1 mm triethnolmine (TEA) (Sigm-Aldrich, UK) for min efore cetyltion in.1 mm TEA/.% cetic nhydride (Sigm-Aldrich, UK) for 1 min t room temperture. Sections were gin wshed in.1 M PB for 4 min, dehydrted through incresed concentrtions of ethnol (%, 7%, 9% nd 1%) nd dried under vcuum. Leled proe ws pipetted onto cover slips, nneled to sections nd seled with DPX efore n overnight hyridiztion t 8 C. Post-hyridiztion, cover slips were removed y soking slides in 4 X sline-sodium citrte uffer (1 mm sodium chloride nd 1 mm sodium citrte, ph7; SSC). Nonspecific hyridiztion ws dissocited y incresing the temperture, up to 6 C for 3 min. Unhyridized RNA ws digested with RNse for 3 min. Sections were deslted over series of SSC solutions: X SSC, 1 X SSC,. X SSC nd.1 X SSC nd finlly dehydrted through grded incresed concentrtions of %, 7%, 9% nd 1% ethnol. The slides were ir-dried nd exposed to Kodk BioMx Film (Sigm, UK) for time pproprite to specific rioproe. Autordiogrphs of sections including microscle stndrds were scnned on Umx Power Look II (UMAX Dt System, Fremont, CA, USA), nd gene expression ws tken s the integrted opticl density (IOD) in the re of interest using ImgeJ softwre system (WinZip Computing Inc., USA). The slides were oserved y linded oserver... Sttisticl nlysis All dt were expressed s mens±sd. Generl liner modeling (GLM) with individul ID included s rndom fctor nested within the tretment to ccount for the repeted mesures ws used to compre chnges of ody mss, ody ft mss, food intke, PA nd T throughout the experiment. One-wy nlysis of vrince (ANOVA) with post hoc Tukey tests ws used to test the etween-group differences of ody mss, ody ft mss, food intke, cumultive food Tle 1 Detils of primers used, the frgment size nd Accession numers. Gene Primers to 3 p Accession numer AgRP TCCTTCCCCAATCCCAATCC NM_747 CGCCCTACCTTCTACTTTATCC CART CCGAGCAGCGAGGAGGTCCAGAA 37 NM_1373 GGACAGTCACACAGCTTCCCGATCC NPY ATGGACAAGATCCGGGACAG 7 NM_1934 TAAAAGATGGGGTTGACGCAGGTGG POMC GGGCAAGCGCTCCTACTCCAT 348 NM_889 CACTGGCCCTTCTTGTGCG OR GTCCTCTTCTTCTGGAGC 634 NM_ GTGTGAGCATCTCTCCTGGAG SOCS-3 CGCCTCAAGACCTTCAGCTCCAA 6 NM_777 GGGTCACTTTCTCATAGGAGT Agouti-relted peptide, (AgRP); cocine- nd mphetmine-regulted trnscript (CART); neuropeptide Y (NPY); pro-opiomelnocortin (POMC); signling form of leptin receptor (or); suppressor of cytokine signling 3 (SOCS 3).

4 L.-N. Zhng et l. / Physiology & Behvior 1 (1) intke, PA nd T t different time points where group differences were significnt over the whole time course. The two cohorts were nlyzed seprtely. Anlysis of covrince (ANCOVA) ws performed to exmine differences ody ft mss using ody mss s covrite nd ANCOVA ws lso used to test differences in plsm leptin levels using ft mss s covrite. Group differences in plsm insulin, TG, NEFA levels nd ft depots were exmined with one-wy ANOVA. Group differences in neuropeptides gene expression were exmined y comprison of the totl integrted opticl density (IOD) for ech gene using ANOVA. Gene expression dt were presented s percentge of the men for AL control. P vlues. were considered sttisticlly significnt. All dt were nlyzed using SPSS 18. sttisticl pckge for Windows (SPSS Inc., Chicgo, IL, USA). 3. Results 3.1. Body mss nd ftness Cohort 1 Prior to the strt of intermittent strvtion regime, nimls hd similr ody mss on dy (IF, 4.46±1.1 g; IR, 4.8±1.4 g; AL, 4.9±1.7 g; ANOVA: F,9 =.8, P=.96; Fig. 1A). The intermittently fsted (IF) mice significntly decresed ody mss on the first (dy 4) nd second (dy 7) dys of fsting (ANOVA: dy 4, F,9 =7., P=.3; dy 7, F,9 =4.71, P=.17; Fig. 1A). The IF mice did not exhiit significnt decrese in ody mss on the third dy of fsting (dy 1) (ANOVA: F,9 =1.96, P=.19). After 3 dys of fsting nd 7 dys of free feeding, on dys 11 13, IF mice mintined significntly higher ody mss in comprison to oth AL control nd the intermittently restricted (IR) mice (ANOVA: dy 11, F,9 =4.18, P=.; dy 13, F,9 =3.89, P=.3; dy 13, F,9 =3.78, P=.3; Fig. 1A) Cohort There were no significnt differences in ody mss etween groups efore the tretment strted (ANOVA: F,9 =.1, P=.989; Fig. 1B). On dy, the verge ody mss of IF, IR nd AL groups were 3.11± 1.19 g, 3.1±1.1 g nd 3.19±1.1 g, respectively. The responses of the second cohort over the first 13 dys of tretment were lmost identicl to those oserved in cohort 1. After the first strvtion dy, IF mice showed significntly lowered ody mss compred to AL control (Post hoc Tukey test: P.1) nd IR mice (Post hoc Tukey test: P=.4), wheres no differences were detected etween IR mice nd AL control (Post hoc Tukey test: PN.) (ANOVA: F,9 =11., P.1; Fig. 1B). The ody mss of IF mice returned to the AL control level fter one-dy of free feeding (P=.6). The second strvtion dy resulted in similr response in IF mice exemplified y significnt reduction in ody mss (ANOVA: F,9 =11.4, P.1), which ws followed y n immedite increse fter refeeding (ANOVA: F,9 =1.31, P=.8). Moreover, fter the second fsting event the IF mice showed trend for ody mss to increse ove tht of the AL control nimls (.69 g higher) lthough this difference ws not sttisticlly significnt (ANOVA: F,9 =.39, P=.19). Different from the first two strvtion dys, no significnt ody mss loss reltive to the msses of the other groups ws not oserved in IF mice fter the third fsting dy nd no etween groups difference in ody mss ws detected (ANOVA: F,9 =.7, P=.8). Free feeding following the third strvtion dy cused pronounced weight increse in the IF mice ove AL control levels which lsted for 3 continuous free feeding dys (ANOVA: F,9 =4.7, P=.19; F,9 =4.1, P=.7; F,9 =4., P=.; respectively. Post hoc Tukey test: IF vs AF, P.; IR vs AF, PN.). As the tretment progressed, this response of elevted ody mss wekened. Significnt mss losses in IF mice occurred on fsting dys 4 to 9 (ANOVA, P.) while ody mss on the free feeding dys did not increse significntly ove the levels of AL control or IR mice (ANOVA, PN.). Over the 4 dys of tretment, there ws significnt effect of intermittent strvtion on ody mss within groups ut not etween groups (GLM repeted mesures: dy of tretment, F,9 =63.9, P.1; dy of tretment group, F,9 =1.8, P.1; group, F,9 =.48, P=.6; Fig. 1B). All mice in cohort 1 nd cohort hd similr ftness efore the tretment strted (IF: 3.±. g; IR: 3.44±.7 g; AL: 3.64±.7 g: ANCOVA: F,6 =.18, P=.836; Fig. 1C). After 3 strvtion dys nd 9 free feeding dys on dy 1, there ws significnt difference in ody ft mss etween three groups (ANCOVA: F,9 =4.4, P=.; Fig. 1C). IF mice hd higher ody ft thn AL control (Post hoc Tukey test: P=.) while no difference ws found etween IR mice nd AL control (P=.68) or etween IF nd IR (P=.816)(Fig. 1C). On dy 4 (fter 6 strvtion dys nd 18 free feeding dys), the ft mss of IF mice were significntly higher thn AL control (ANCOVA: F,9 =., P=.14; Post hoc Tukey test: IF vs AL, P=.1; Fig. 1C). No differences were found etween the IR group nd the AL control or etween the IR nd IF groups (Post hoc Tukey test: P=.16; P=.384, respectively). However, the differences in ody ftness oserved t dys hd disppered y dy 3 (fter 8 strvtion dys nd free feeding dys) nd dy 37 (fter 8 strvtion dys nd 9 free feeding dys) (ANCOVA: F,9 =1.66, P=.9; F,9 =1.6, P=.7, respectively; Fig. 1C). 3.. Food intke Cohort 1 Before intermittent strvtion tretment strted, ll mice hd similr mount of food intke (IF:.64±.31 g; IR:.67±.1 g;.9±.33 g; ANOVA: F,9 =.1, P=.899; Fig. A). The IF mice in cohort 1 displyed hyperphgi on the first two free feeding dys fter the fsting dys (ANOVA: dys 6, dys 8 9, dy 11: p.1; dy 1, p=.1; Fig. A). By the end of this tretment (dy 13), cumultive food intke differed significntly etween the three groups (ANOVA: F,9 =.73, P=.8; Fig. B). Overll, IR mice consumed.79 g (9%) less food (P=.1) thn AL controls while the mount of cumultive food intke consumed y IF mice ws similr to tht of AL control (P=.9) over the course of the tretment (Fig. B) Cohort Under the free feeding seline condition, there ws no difference in food intke etween groups (ANOVA: PN.). On the first free feeding dy following the first strvtion (dy ), IF nd IR mice consumed significntly more food thn the AF control (ANOVA: F,9 =1.41, P.1; Post hoc Tukey test: P.1, P=.9, respectively; Fig. C). On the second free feeding dy (dy 6), the food intke of IF mice ws still higher thn AL control (ANOVA: F,9 =11.917, P.1; Post hoc Tukey test: P=.; Fig. C) while the food intke of the IR mice returned to the similr level of AL control (Post hoc Tukey test: P=.88). Compred to AL controls, no increse in food intke following the tretment dys ws found in IR mice from the second restriction dy onwrds (Post hoc Tukey test: PN. in ll cses). In contrst, IF mice showed hyperphgic response to strvtion on the first two free feeding dys tht followed oth the second nd third restrictions (dys 8 9 nddys11 1) (ANOVA: dy 8, F,9 =1.8, P.1; dy 9, F,9 =6.4, P=.; dy 11, F,9 =33.83, P.1; dy 1, F,9 =.11, P=.13; Post hoc Tukey test: IF vs AL, P. for ll cses; Fig. C). The mgnitude of hyperphgi ws less on the second refeeding dy thn tht on the first refeeding dy. The ptterns in cohort mtched those of cohort 1 over the first 13 dys of tretment lmost exctly. From dys 14 38, hyperphgi following fsting in the IF group ws present only on the first free feeding dys fter strvtion (ANOVA: dy 1, F,9 =11.1,P.1; dy 17, F,9 =16.86,P.1; dy 1, F,9 =18.44, P.1; dy 7, F,9 =4.6, P=.19; dy 3, F,9 =1.1, P.1; Post hoc Tukey test: IF vs AF, P. for ll

5 38 L.-N. Zhng et l. / Physiology & Behvior 1 (1) A Body mss (g) B C Body ft mss (g) Body mss (g) Dys of tretment Dys of tretment AL IR IF Dy (Cohort1+) Dy1 (Cohort1) Dy4 (Cohort) Dy3 (Cohort) Dy37 (Cohort) Fig. 1. Effects of intermittent fsting/food restriction on ody mss nd ftness in femle C7BL/6J mice. A. Body mss over 13 dys of intermittent fsting/food restriction tretment (cohort 1). B. Body mss over 4 dys of intermittent fsting/food restriction tretment (cohort ). C. Body ft mss t different time points during intermittent fsting/food restriction tretment ( comintion of cohorts 1 nd ). Filled tringles represent intermittently fsted mice (IF), Filled squres represent intermittently food restricted mice (IR), open squres represent control fed d liitum (AL). Filled rs represent intermittently fsted mice (IF), Slshed rs represent intermittently food restricted mice (IR), open rs represent control fed d liitum (AL)., P.. Different letters over rs on the sme tretment dy indicte significnt difference. cses; Fig. C). Unexpectedly, on the first free feeding dy fter the ninth strvtion (dy 4), IF nd IR mice consumed significntly less food thn AL control (ANOVA: F,9 =9.19, P.1; Post hoc Tukey test: IF vs AL, P.1; IR vs AL, P=.1; Fig. C). There ws no significnt difference etween three groups in cumultive food intke over 4 dys of the tretment (ANOVA: F,9 =.6, P=.9; Fig. D) Physicl ctivity Fig. 3A illustrtes physicl ctivity over free feeding dy prior to the experimentl tretment strting. Mice from ll groups showed similr circdin pttern in physicl ctivity with low level of ctivity during the light phse (punctuted y rief rise when distured to e fed t 1 h) nd high level of ctivity during the drk phse. On the first fsting/restriction dy (dy 4), there ws no significnt difference in 4 h physicl ctivity etween the three groups (GLM repeted mesures: dy 4, F,9 =.8, P=.78; Fig. 3B). When the tretment proceeded to the second fsting/restriction dy, 4 h physicl ctivity levels tended to differ etween the three groups lthough the difference did not rech significnce (GLM repeted mesures: dy 7, F,9 =3.8, P=.6; Fig. 3C). From the third fsting/restriction dy (dy 1) nd onwrds, there ws significnt effect of fsting/restriction on 4 h physicl ctivity (GLM repeted mesures: dy 7, F,9 =9.4, P=.1; Post hoc Tukey test: IF vs AL, P=.1, IR vs AL, P =.14; IF vs IR, P=.86, Fig. 3D; dt on dys 14, 16,, 6, 9 nd 39 not shown). In ddition to chnges in 4 h ctivity, there ws no difference in dily verge ctivity etween the three groups on the first two fsting/restriction dys (ANOVA: PN. for oth cses; Fig. 3E). However, IF mice showed significnt decrese in dily verge physicl ctivity on the third to ninth fsting/strvtion dys (ANOVA, P., Post hoc Tukey test, IF vs AL, P.) nd IR mice significnt decresed dily verge ctivity on the fifth to ninth fsting/strvtion

6 A C Dily food intke (g) Dily food intke (g) Dys of tretment L.-N. Zhng et l. / Physiology & Behvior 1 (1) B Cumultive food intke (g) 1 1 AL IR IF D Cumultive food intke (g) Dys of tretment AL IR IF Fig.. Effects of intermittent fsting/food restriction on food intke in femle C7BK/6J mice. A. Dily food intke over 13 dys of intermittent fsting/food restriction tretment (cohort 1). B. Cumultive food intke over 13 dys of intermittent fsting/food restriction tretment. C. Dily food intke over 4 dys of intermittent fsting/food restriction tretment (cohort ). D. Cumultive food intke over 4 dys of intermittent fsting/food restriction tretment. Filled tringles represent intermittently fsted mice (IF), Filled squres represent intermittently food restricted mice (IR), open squres represent control fed d liitum (AL). Filled rs represent intermittently fsted mice (IF), Slshed rs represent intermittently food restricted mice (IR), open rs represent control fed d liitum (AL)., P.. Different letters over rs on the sme tretment dy indicte significnt difference. dys (ANOVA, P., Post hoc Tukey test, IR vs AL, P.) (Fig. 3E). Furthermore, dy of tretment representing the numer of events hd significnt effect on physicl ctivity over the 13 fsting/restriction dys (GLM repeted mesures: group, F,9 =7.7, P=.3; group dy of tretment, F,16 =3.31, P.1; Fig. 3E). The first dy of refeeding (dy ) following the first fsting/restriction (dy 4) 4 h physicl ctivity levels differed significntly etween groups (GLM repeted mesures: F,9 =4.6, P.1). IF nd IR mice displyed lower ctivity levels thn AL control (Post hoc Tukey: IF vs AL, P.1; IR vs AL, P=.1; IF vs IR, P=.; Fig. 3F). Similr responses persisted on the second dy of refeeding on dy 6 (GLM repeted mesures: F,9 =7., P=.3; Post hoc Tukey: IF vs AL, P=.; IR vs AL, P=.31; IF vs IR, P=.76) even though the mgnitude of responses ecme weker. On the third dy of refeeding (dy 13) fter the third fsting/restriction event (dy 1), the difference in physicl ctivity etween groups totlly disppered (GLM repeted mesures: F,9 =.8, P=.46; Fig. 3G). Additionlly, IF mice nd IR mice displyed decrese in dily physicl ctivity on the first refeeding dys following ll fsting/restriction events (ANOVA: P.) except the fourth one on dy 14 (ANOVA: P=.81) nd on the second refeeding dys fter the first-third, fifth, seventh nd ninth fsting/restriction events (ANOVA: P.) (Fig. 3H). Moreover, dy of tretment (representing numer of events) hd significnt effect on physicl ctivity during ll free feeding nd refeeding dys (GLM repeted mesures: group, F,9 =3.74, P=.37; group dy of tretment F,64 =3.39, P.1). Overll, totl ctivity levels of IF mice were significntly lowered y 17% in comprison with AL control over 4 dys of tretment compred with AL controls (ANOVA, F,9 =4.79, P=.17; Post hoc Tukey test, IF vs AL, P=.17) wheres no differences were found etween IR mice nd AL control (P=.8) (Fig. 3I). Consistent with chnges in totl dily ctivity, there were significnt differences etween three groups in ctivity during the light phse (ANOVA: F,9 =11.13, P.1). However, ctivity levels were unchnged during the drk phse cross the three groups (ANOVA: F,9 =., P=.18). In cohort, intermittent fsting nd restriction hd exctly the sme impct on physicl ctivity s during the first 13 dys of tretment in cohort 1.

7 38 L.-N. Zhng et l. / Physiology & Behvior 1 (1) A B C Physicl ctivity (AU) IF IR AL 18: : : : : 4: 6: 8: 1: 1: 14: 16: 18: : : : : 4: 6: 8: 1: 1: 14: 16: D E F Physicl ctivity (AU) 18: : : : : 4: 6: 8: 1: 1: 14: 16: Dily verge physicl ctivity (AU) G H I Physicl ctivity (AU) h PA t seline 4h PA on 1 st strving dy 4h PA on nd strving dy : : : : : 4: 6: 8: 1: 1: 14: 16: 4h PA on 3 rd strving dy Dily PA on 9 strving dys 4h PA on 1 st refeeding dy Dys of fsting/restriction 18: : : : : 4: 6: 8: 1: 1: 14: 16: Dily ctivity (AU) Physicl ctivity (AU) Dys of tretment 18: : : : : 4: 6: 8: 1: 1: 14: 16: 4h PA on 3 rd refeeding dy Dily PA on refeeding dys Accumulted PA over 4 dys Accumulted physicl ctivity (AU) Fig. 3. Effects of intermittent fsting/food restriction on physicl ctivity in femle C7BL/6J mice. A. Representtive grph of 4 h physicl ctivity t seline. B. 4 h physicl ctivity on the first fsting/food restriction dy (GLM repeted mesures: F,9 =.8, P=.78). C. 4 h physicl ctivity on the second fsting/food restriction dy (GLM repeted mesures: F,9 =3.8, P=.6). D. 4 h physicl ctivity on the third fsting/food restriction dy (GLM repeted mesures: F,9 =9.4, P=.1). E. Dily verge physicl ctivity on 9 fsting/food restriction dys (GLM repeted mesures: group, F,9 =7.7, P=.3; group dy of tretment, F,16 =3.31, P.1). F. 4 h physicl ctivity on the first dy of refeeding following the first fsting/ restriction (GLM repeted mesures: F,9 =4.6, P.1). G. 4 h physicl ctivity on the third dy of refeeding fter the third fsting/restriction event (GLM repeted mesures: F,9 =.8, P=.46). H. Dily verge physicl ctivity on refeeding dys. I. Accumulted physicl ctivity over 4 dys of intermittent fsting/food restriction tretment. Filled tringles represent intermittently fsted mice (IF), Filled squres represent intermittently food restricted mice (IR), open squres represent control fed d liitum (AL). Filled rs represent intermittently fsted mice (IF), Slshed rs represent intermittently food restricted mice (IR), open rs represent control fed d liitum (AL)., P.. PA, physicl ctivity. Different letters over rs on the sme tretment dy indicte significnt difference Body temperture All mice showed similr circdin pttern of ody temperture when fed d liitum (Fig. 4A). On dy 4, 4 h fsting nd food restriction oth led to pronounced hypothermi (GLM repeted mesures: F,9 =3., P.1; Post hoc Tukey test: IF vs AL, P.1; IR vs AL, P=.; Fig. 4B). IF mice hd significntly lower ody temperture compred with IR mice (Post hoc Tukey test: IF vs IR, P.1). The effect of fsting/restriction on dily verge temperture ws oserved on ech fsting/restriction dy (ANOVA: P.1 in ll 9 cses; Fig. 4C). Compred with control fed d liitum, verge ody temperture in IF nd IR mice on fsting/restriction dys ws decresed y.48 C nd.9 C, respectively. Body temperture ws returned to the AL control levels fter 1 dy of refeeding (GLM repeted mesures: F,9 =1.1, P=.313; Fig. 4D). There were no significnt differences in dily verge temperture cross the three groups on ll refeeding dys (ANOVA: PN. in ll cses; Fig. 4E). In cohort, the effects of intermittent fsting nd restriction on ody temperture were exctly the sme s in cohort 1 for the first 13 dys of tretment. 3.. Circulting hormone nd metolite levels Circulting levels of leptin were positively correlted with ody ft mss on oth dy 13 nd dy 4 of the tretment, (Liner regression: dy 13, F 1,3 =7.34, P=.11, djusted R =.17; Fig. A; dy 4, F 1,3 =1.13, P=.1, djusted R =.88; Fig. B). On dy 13, there ws no significnt difference in circulting leptin levels cross the three groups (ANCOVA using ft mss s covrite: F,8 =.139, P=.87; Fig. C). However on dy 4 IF mice hd significntly

8 A Body temperture ( C) C Dily verge T ( C) Dily verge T ( C) E L.-N. Zhng et l. / Physiology & Behvior 1 (1) : : : : : 4: 6: 8: 1: 1: 14: 16: Dys of fsting/restriction Dys of tretment B Body temperture ( C) D Body temperture ( C) : : : : : 4: 6: 8: 1: 1: 14: 16: : : : : : 4: 6: 8: 1: 1: 14: 16: 383 Fig. 4. Effects of intermittent fsting/food restriction on ody temperture in femle C7BK/6J mice. A. Representtive grph of 4 h ody temperture t seline. B. 4 h ody temperture on typicl fsting/food restriction dy (GLM repeted mesures: F,9 =3., P.1). C. Dily verge ody temperture on 13 fsting/food restriction dys. D. 4 h ody temperture on typicl refeeding dy. E. Dily verge ody temperture on refeeding dys. Filled tringles represent intermittently fsted mice (IF), Filled squres represent intermittently food restricted mice (IR), open squres represent control fed d liitum (AL). Filled rs represent intermittently fsted mice (IF), Slshed rs represent intermittently food restricted mice (IR), open rs represent control fed d liitum (AL)., P.1. elevted plsm leptin levels compred with the AL control nd IR mice (ANCOVA using ft mss s covrite: F,8 =4.9, P=.1; ANOVA post hoc Tukey: IF vs AL, P=.43, IF vs IR, P=.; Fig. C). Circulting insulin were unchnged on dys 13 nd 4 (ANOVA, F,9 =1.6, P=.; F,9 =1.6, P=.9; Fig. D). Intermittent fsting nd food restriction hd no effect on TG or NEFA levels (ANOVA: PN. for oth TG nd NEFA on dys 13 nd 4; Fig. E,F) Hypothlmic neuropeptides gene expression On dy 13 (cohort 1) fter 3 strvtion dys nd 1 free feeding dys, levels of NPY gene expression in rcute nucleus ws significntly elevted y 49% in IF mice compred with AL control (ANOVA: F,9 =3.39, P=.47; Post hoc Tukey test: IF vs AL, P=.39; Fig. 6A). No differences were detected etween IR mice nd AL control t this time point (Post hoc Tukey test: IR vs AL, P=.7; Fig. 6A). However, the difference in NPY hd disppered fter 4 dys of tretment (cohort ) (ANOVA: F,9 =., P=.8; Fig. 6A). There were no effects of intermittent fsting/restriction on the levels of expression of POMC, CART, AgRP, O-R nd SOCS 3 (ANOVA: PN. for ll on dys 13 nd 4; Fig. 6B F). 4. Discussion 4.1. Effects of intermittent strvtion on ody mss nd ftness in mice We exmined the chnges in ody mss nd ftness in response to elevted strvtion risk. Our finding tht fter 13 dys of tretment there ws significnt increse in oth ody mss nd ft mss in the group tht received intermittent complete food removl supports the suggestion tht strvtion risk defines the lower intervention level, ccording to the dul intervention points model []. However, mice tht were stochsticlly exposed to only % food restriction showed no difference in ody mss compred to controls tht were fed d liitum. This lck of response does not support the suggestion tht strvtion risk increses the lower intervention point. Moreover, when intermittent strvtion ws prolonged for greter durtion, the effects on ody mss nd diposity were reduced nd not significntly greter thn the AL controls. The sence of significnt elevtion in ody mss in response to the longer-term intermittent fsting is lso t odds with the prediction from the dul intervention point model. It seemed tht the immedite response of the mice to incresed strvtion risk ws indeed to elevte ftness, ut tht s time went on different strtegies were employed. One possiility is tht

9 384 L.-N. Zhng et l. / Physiology & Behvior 1 (1) A Plsm leptin (ng/ml) C Plsm leptin (ng/ml) E Plsm TG (ng/ml) Ft mss (g) Ft mss (g) Dy 13 Dy 4 Dy 13 Dy 4 B Plsm leptin (ng/ml) D Plsm insulin (ng/ml) F Plsm NEFA (ng/ml) Dy 13 Dy 4 Dy 13 Dy 4 Fig.. Effects of intermittent fsting/food restriction on circulting hormones nd metolites in femle C7BK/6J mice. A. Liner regression plots of plsm leptin levels ginst ody ft mss on dy 13 of intermittent fsting/food restriction tretment (Liner regression: F 1,3 =7.34, P=.11, djusted R =.17). B. Liner regression plots of plsm leptin levels ginst ody ft mss on dy 4 of intermittent fsting/food restriction tretment. (Liner regression: F 1,3 =1.13, P=.1, djusted R =.88). C. Plsm leptin levels on dy 13 nd dy 4 of intermittent fsting/food restriction tretment (ANCOVA using ft mss s covrite: F,8 =4.9, P=.1). D. Plsm insulin levels on dys 13 nd 4 of intermittent fsting/food restriction tretment. E. Plsm triglyceride (TG) levels on dys 13 nd 4 of intermittent fsting/food restriction tretment. F. Plsm non-esterified ftty cid (NEFA) levels on dys 13 nd 4 of intermittent fsting/food restriction tretment. Filled tringles represent intermittently fsted mice (IF), Filled squres represent intermittently food restricted mice (IR), open squres represent control fed d liitum (AL). Filled rs represent intermittently fsted mice (IF), Slshed rs represent intermittently food restricted mice (IR), open rs represent control fed d liitum (AL). Different letters over rs on the sme tretment dy indicte significnt difference short term intermittent strvtion might provoke more efficient compenstion to defend the negtive energy lnce, thus generting over compenstion in ody mss. Our result from long-term intermittent strvtion is consistent with the finding tht Swiss mice nd striped hmsters (C. rensis) lso showed no chnge in ody mss fter exposure to stochstic food supplies for 4 weeks [3]. In their study, however, Swiss mice nd striped hmsters showed no immedite response of ody mss gin tht ttenuted over time. However, in this ltter study the occurrence of fsting dys ws fr more frequent thn in the present study. Nevertheless, similr findings hve een seen in humns. Helthy women sujects undergoing restricted diet on 4 dys ech week exhiited no sustntil weight chnge fter 4 weeks [7]. However, in other studies where ADF regimens were dministered for 1 weeks, ody weight ws found to decrese [8,9], ut, when ADF regimens were pplied for 16 weeks, no effect on ody weight ws oserved [3,31]. Such findings imply tht nimls were unle to consume twice their dily food intke on the refeeding dy for longer periods, which resulted in ody weight loss. There clerly is vriility in the cpcity of nimls to compenste for fst dy on fed dy [3] prticulrly if fsting dys re s frequently encountered s the fed dys, nd this my compromise their cpcity to elevte ody ftness. Furthermore, there could e longitudinl chnges in this cpcity to compenste dependent on the durtion of tretment. 4.. Physiologicl nd ehviorl responses to intermittent strvtion Food intke In the present study, mice experiencing intermittent fsting displyed pronounced hyperphgi on the first one or two dys of refeeding dys fter the fsting dy, which lrgely ccounted for the weight restortion/elevtion. It seemed necessry to hve t lest dys etween the fsting dys to uild up ft reserve nd hence the difference etween the current study nd the previous studies y Zho nd collegues my rest primrily in the frequency of fsting. If this frequency is too high there my e limited cpcity to compenste on the fed dys. However, the mgnitude of hyperphgi ws

10 L.-N. Zhng et l. / Physiology & Behvior 1 (1) A B NPY expression (% of AL control) 1 1 Dy 13 Dy 4 POMC expression (% of AL control) Dy 13 Dy 4 C D CART expression (% of AL control) Dy 13 Dy 4 AgRP expression (% of AL control) Dy 13 Dy 4 E F OR expression (% of AL control) Dy 13 Dy 4 SOCS3 expression (% of AL control) 1 1 Dy 13 Dy 4 Fig. 6. Effects of intermittent fsting/food restriction on gene expression of neuropeptides in the hypothlmus in femle C7BK/6J mice. A. Neuropeptide Y. B. Pro-opiomelnocortin (POMC). C. Cocine- nd mphetmine-regulted trnscript (CART). D. Agouti-relted peptide, (AgRP). E. Signling form of leptin receptor (O-R). F. Suppressor of cytokine signling 3 (SOCS 3). Filled rs represent intermittently fsted mice (IF), Slshed rs represent intermittently food restricted mice (IR), open rs represent control fed d liitum (AL). Different letters over rs on the sme tretment dy indicte significnt difference. ssocited with the severity of food deprivtion since IF mice consumed more food thn IR mice on the refeeding dys. So the filure of IR mice to deposit ft reserve ws clerly not ecuse they did not hve the cpcity to et sufficient food on the dys when food ws ville. Post fsting or restriction food compenstion hs een oserved in numer of previous studies e.g. [33 3]. For instnce, rts showed drmtic post fst hyperphgi nd consequently rpid recovery of ody weight lost during strvtion [36,37]. Similrly, n initil hyperphgic response following refeeding ws oserved in C7BL/6 mice previously on 4% food restriction [33]. Hmly et l. (7) further found tht the mgnitude of the hyperphgic response t refeeding ws independent of the prior length of cloric restriction [34]. In contrst, golden hmsters (Mesocricetus urtus) of oth sexes showed little or no post fst food compenstion fter 4 h of food deprivtion nd their dily food intke ws no greter thn dily intke during seline testing [38]. Despite hyperphgic response on refeeding dys, IF mice consumed similr totl mount of food over the 13 dys of intermittent fsting tretment, while IR mice consumed significntly less food compred to AL controls. However, with n even longer durtion of tretment, the difference in ccumulted food intke etween IR mice nd the AL control disppered nd mice from ll the three groups consumed similr totl mount of food over 4 dys of intermittent fsting/restriction tretment. It hs een shown tht the mount of food consumed y rodents mintined on n ADF regimen vries depending on the strin nd, in some cses (e.g., C7BL/6 mice), the nimls gorge during the non-fsting time period to n extent tht overll food intke is essentilly equivlent to tht of nimls fed d liitum [3]. Wn et l.

11 386 L.-N. Zhng et l. / Physiology & Behvior 1 (1) (3) reported tht rts on ADF regimen consumed 3% less food over time compred with rts fed d liitum [39]. The intermittent strvtion regimen provides stochstic food vilility together with food undnce llowing compenstion. Our results suggested tht the responses to refeeding vried with the extent of strvtion. IF mice were le to compenste for 4 h complete food deprivtion on refeeding dys nd mintined cumultive food intke t the sme level s AL control. However the responses to refeeding in IR mice chnged over time. During the first 13 dys of tretment, the decrese in cumultive food intke with unchnged ody mss in IR mice implies decrese in energy expenditure. On dy 4, cumultive food consumption in IR mice ws normlized to AL control level indicting other dpttions e.g. decresed energy expenditure might lso e restored. When intermittently % food restricted, mice might employed different responses dependent on the durtion of tretment Physicl ctivity In contrdiction to previous studies demonstrting n elevtion in physicl ctivity level which occurred in severl species such s lemurs (Lemur ctt) [4], Sierin hmsters (Phodopus sungorus) [41] nd mice [4] in response to food restriction, we oserved decrese in physicl ctivity level in mice when fsted or % food restricted for 4 h, suggesting response to decrese energy expenditure nd conserve energy. This is consistent with the finding tht mice exposed to % food restriction showed decresed ctivity which contriuted to 7.% of ltered energy expenditure to compenste for reduced energy intke [43]. Similrly in femle monkeys (Mcc multt), rpid decrese in physicl ctivity ws oserved to counterct dietinduced weight loss [44]. Since the energy cost of physicl ctivity is n importnt component of energy expenditure, this physiologicl response to reduce energy expenditure is potentilly n integrl fctor contriuting to protection ginst excessive weight loss during cloric restriction nd potentilly predisposes to weight re-gin in postoese individuls [4]. Further nlyses of ctivity dt showed tht the decrese ws minly due to ctivity during the light phse coincident with the occurrence of hypothermi. However, IF nd IR mice hd similr levels of ctivity during the drk phse compred to the controls fed d liitum. Incresed ctivity during food restriction hs een previously interpreted to reflect n increse in forging ehvior, which my enhnce the chnces of survivl in free living niml [46]. This inconsistency could e explined y the short durtion of strvtion (4 h), which filed to induce food forging ehvior in mice. Additionlly, Gutmn et l. (7) oserved tht desert gold spiny mice (Acomys russtus) employed two strtegies for coping with food shortge, some significntly reduced ctivity level concentrting their ctivity round feeding time lowering energy expenditure while others significntly incresed ctivity level serching for food nd thus losing ody mss rpidly [47]. It is currently uncler whether nd how the response in ctivity is correlted with the severity or durtion of strvtion. On refeeding dys fter strvtion, our mice still mintined lowered level of physicl ctivity, which lso contriuted to the recovery nd the incresed ody mss of the IF mice. Although it hs een suggested tht hypoleptinemi cn influence strvtion induced hyperctivity [48,49], in our study the decresed physicl ctivity during intermittent strvtion ws ccompnied y either unltered (13 dys) or elevted (4 dys) leptin levels, indicting tht lowered leptin ws unlikely to e the stimulus of the ctivity chnges Body temperture Mice re documented s n ttrctive model for studying the response of ody temperture to dietry restriction ecuse ody temperture of mice is sensitive to reduced food intke []. Indeed mice from our study demonstrted decrese in ody temperture in response to 4 h of complete fsting or % food restriction. Notly, hypothermi ws only present when food ws deprived or restricted nd refeeding immeditely restored ody temperture to control levels. Cloric restriction is ssocited with lower men ody temperture in most homeotherms tht hve een exmined including mice, rts, monkeys nd humns [49]. The use of torpor hs een descried s one of the key strtegies for coping with food shortge in rodents [1,]. In the present study, to wht extent the reduced ody temperture contriuted to the sving of energy nd thus the prevention of weight loss remined uncler, prticulrly when the reduction in ody temperture ws restored rpidly following refeeding Effects of intermittent fsting/restriction on neuroendocrine sttus Leptin is primrily known for its role in regulting food intke nd energy homeostsis [3]. At the end of 1 dys of intermittent fsting/restriction, no chnges in circulting leptin nd insulin levels were detected. This ws unexpected given oth the incresed ody ftness nd food intke in the IF mice. Moreover, fter long-term intermittent strvtion, IF mice exhiited elevted leptin levels while their ody ftness nd food intke were restored to the sme level s AL controls. It is possile tht leptin sensitivity might hve een impired; however, the sence of chnges in gene expression of O- R nd SOCS 3 suggested this ws not the cse. With respect to other neuropeptides involved in eting ehvior, NPY gene expression ws incresed fter short-term intermittent strvtion. NPY nd AgRP neurons of the hypothlmic rcute nucleus re thought to promote feeding nd consistent with n orexigenic role, fsting induced 4-fold increse in the sl ction potentil frequency of NPY/AgRP neurons [4]. It seems likely tht the elevtion in NPY expression stimulted the incresed food intke in the IF mice. Similrly, n increse in NPY expression nd prllel decrese in POMC expression were oserved in the hypothlmic rcute nucleus of rts killed just efore reound hyperphgi following restricted feeding/repletion protocol [].. Conclusions C7BL/6J mice displyed n incresed ody mss nd ftness in response to 13 dys of intermittent fsting, which were oth restored to seline levels when the tretment ws prolonged to 4 dys. Over the first 13 dys of tretment the dt were consistent with the dul intervention point model s the mice showed oth incresed ody mss nd diposity, however the effect disppered over the more protrcted period of 4 dys. Whether the dt re considered consistent with the dul intervention point model therefore depends criticlly on the time course of the experiment. Over 13 dys the response ws consistent ut over 4 dys it ws not. In the short term, n increse in food intke, decresed physicl ctivity s well s reduction in ody temperture contriuted to the elevted ody mss nd ftness. In contrst, the ody mss of mice treted with intermittent fsting for 4 dys were not significntly elevted. This finding ws inconsistent with the dul intervention point model. Intermittent strvtion resulted in unltered cumultive food intke nd menwhile decresed physicl ctivity level, suggesting n sence of overcompenstion in energy intke ut decrese in energy expenditure in coping with stochstic food. Overll, mice exhiited different ehviorl nd physiologicl responses to intermittent strvtion which were criticlly dependent on the durtion of tretment. Acknowledgment This work ws funded y studentship from University of Aerdeen nd AstrZenec. The uthors wish to thnk Dr Cthy Wyse for her ptient help with cryostt rin sectioning nd for her vlule comments to the mnuscript. The uthors lso would like to cknowledge Rchel Sinclir nd Dr Loke Vnholt for their help with niml work