Boosting lipid productivity of the oleaginous microalga N. gaditana via genome engineering

Size: px
Start display at page:

Download "Boosting lipid productivity of the oleaginous microalga N. gaditana via genome engineering"

Transcription

1 Boosting lipid productivity of the oleaginous microalga N. gaditana via genome engineering Imad Ajjawi, John Verruto, Moena Aqui, Eric Moellering and Robert Brown October 25th 216

2 Outline n Brief intro to the algal biofuel R&D program at Synthetic Genomics Inc. (SGI) n Identification of a novel transcriptional regulator of lipid accumulation via a transcriptomics approach n Establishment of a high-efficiency knockout pipeline in Nannochloropsis n Fine-tuning expression of the transcription factor to maximize lipid productivity n Transcriptomics and further characterization of the mutants to unveil a mechanistic understanding of the lipid phenotype 1

3 SGI s Algal Biofuel R&D Program R&D Program Developing Algae-based Biofuels R&D collaboration with ExxonMobil Competitive Advantages of Algae n 4-1x higher oil yields per acre than traditional crops n Can be grown in non-arable land on brackish/saline water n Short generation time contributes to high productivity which minimizes land utilization From: Algal Bio-oil n R&D program (~ 25 people) developing an algal biomass refinery feedstock n Lower greenhouse gas emissions as compared to petroleum diesel n Lower fresh water consumption than other biofuel options 2

4 Research on Algae has Focused on Model Organisms Our focus is to use model organisms to improve productivity n Increases in lipid productivity have been reported for C. reinhardtii, T. pseudonona and P. tricornutum however, these are model organisms with inherently low lipid productivities Favorable N. gaditana Attributes: n High lipid productivity n Easily transformed by electroporation n Small, compact genome (haploid, 3 Mb) n Attractive host for forward & reverse genetics Radakovits et al

5 Lipid accumulation at the expense of growth N-deprived Nannochloropsis gaditana Total organic Carbon TOC = Biomass proxy Fatty acid methyl esters FAME = Lipid proxy TOC (µg/ml) N -N Slow growth 5 1 Time (d) FAME (µg/ml) N High lipid +N 5 1 Time (d) n Engineering a strain that is capable of accumulating high lipid levels without compromising growth is very desirable a strain with high lipid productivity (vs accumulation) 4

6 Transcriptional Responses of N-deprived Microalgae The Lipid Trigger Hypothesis Transcription Factor n Under N-deprivation a massive cellular transcriptional response occurs suggesting that a master transcriptional regulator controls lipid accumulation aka the lipid trigger 5

7 Comparative Transcriptomics to Identify The Lipid Trigger Early time-point in the N response A FAME (µg/ml) C N RNA-seq +N 3 1 Time (h) B E FDR (-log1) N/+N Fold change (log 2 ) Transcriptomics Stats: n 363 up-regulated genes n 71 down-regulated genes n transcription factors up-regulated n 2 transcription factors down - regulated n With the assumption that transcriptional changes should precede metabolic changes, we selected the 3-hr time-point for mrna sequencing 6

8 Development of High-Throughput Knockout Pipeline All 2 down-regulated putative regulators were targeted for knockout n With the hypothesis that a negative regulator of lipid accumulation would be down-regulated, we targeted all 2 TFs for insertional knockout Ng-Cas9 + grna C HygR ZnCys () Prom HygR 2.5 Kb.5 Kb T Cas9 + D ZnCys-KO 3 Kb * 3 Kb Prom HygR Hyg resistant lines T Positive selection cassette F.5 Kb 1. Construction of a Cas9 mother Ng-Cas Transformation of 2 different transient in vitro synthesized grnas targeting the putative TFs. A hygromycin cassette was used as positive selection 3. PCR screen transformants for insertions at the targeted locus 7

9 A High-Efficiency K.O. Pipeline Was Developed Ng-Cas9 + is a highly efficient editor line n 18 of the 2 regulators targeted were successfully knocked out as confirmed by PCR, and screened for lipid productivity in a batch screen 8

10 Screening for High Lipid Accumulators Lipid and biomass batch screen A.9 BA CB.8 ZnCys-KO FAME/TOC ZnCys-KO ZnCys-KO Time (d) 8 Time (d) FAME (mg/l) D C TAG/TOC (g/g).6 TOC (mg/l) D E F ZnCys-KO Time (d) 4 (NO3) (-N).5 35 ZnCys-KO (NO3) 3 ZnCys-KO.4 n An outlier was clearly identified from the batch screen N n Several lines of evidence confirmed it was a high lipid 15.2 accumulator 1.1 Ch 5 M n However, this strain was very slow-growing 1 µm LD Ch C14: C16: C16:1 C18:1 C18:2 C2:4 C2:5 ZnCys-KO FAME (mol %) TOC (mg/l) 1 µm LD 9

11 Mutation in a locus encoding for a putative Zn 2 Cys 6 transcription factor Creation of weaker alleles by targeted UTR bashing and RNAi silencing A B Relative Normalized Expression BASH-3 65bp NLS Zn 2 Cys 6 RNAi RNAi n Generation of weaker alleles was confirmed by qrt-pcr ZnCys-KO C C FAME/TOC FAME/TOC qrt-pcr BASH-12 3bp FAME/TOC TOC productivity TOC (mg/l/day) n We hypothesized that generation of weaker alleles would result in a more moderate phenotype n A batch assay indicated that the attenuated lines had intermediate FAME/TOC levels when compared to and ZnCys-KO. n Additionally, the attenuated lines grew only slightly slower than.. 1

12 Productivity Assessment on a Semi-Continuous System Attenuated lines exhibited the highest lipid productivity values A 14 A 12 TOC Productivity FAME Productivity 6 FAME (mg/l) ZnCys-BASH-12 ZnCys-BASH-3 ZnCys-RNAi-7 Ng-Cas TOC productivity (g/m 2 /day) FAME productivity (g/m 2 /day) Time (d) C n All 3 attenuated lines showed higher lipid productivities than for over a week, with ZnCys-RNAi-7 being twice as productive as (1% lipid productivity over ) n Equally as important, biomass productivity of ZnCys-attenuated lines was only marginally lower than 11

13 Ammonium Supplementation Complements The Mutant Phenotype Growth on NH 4 an unexpected result A B C FAME (mg/l) ZnCys-KO TOC (mg/l) 8 ZnCys-KO FAME/TOC ZnCys-KO n Supplementation with NH 4 + abolished the mutant phenotype Time (d) Time (d) D TN (mg/l) N-levels on NO (NO3) RNAi-7 (NO3) ZnCys-KO ZnCys-RNAi ZnCys-KO Time (d) D Plastid NO - 3 NRT NO - 3 NR NO - 2 NAR NO - 2 NiR GS NH + 4 NH + 4 AMT NH + 4 GOGAT Gln α-kg 2Glu Glu α-kg C-metabolism GDH Time (d) 12

14 Further Investigating N-Assimilation Key genes in primary N-assimilation appear to be down-regulated C D D NRT2 NiR GOGAT1 Amt2 NR-KO (NO 3 ) ZnCys -KO RNAi-7 (NH 4 ) (NH 4 ) (NH 4 ) NR-KO (NH 4 ) ZnCys -KO (NO 3 ) RNAi-7 (NO 3 ) (NO 3 ) NR NO - NO - 3 NO - 3 NRT 2 NAR NO - 2 NH 4 + AMT NH 4 + Plastid NiR NH 4 + GS Gln α-kg Glu GOGAT α-kg 2Glu GDH Amt1 GS1 UreT NAR2 GS2 GDH GOGAT2 NAR1 NR C-metabolism n The NR-KO has a distinct response that differentiates it from all other samples n However, down-regulation of NRT2 and NiR could explain ZnCys-KO s growing pains on NO 3 Log 2 (fold change) 13

15 Transcriptomics of ZnCys Knockdown Strain Confirmed down-regulation of primary N-assimilation genes Transcriptomics Stats: n 1118 differentially expressed genes (2-fold, FDR <.5) n 79 up-regulated genes n 328 down-regulated n Protein synthesis n Lipid re-modeling Desaturases, elongases n N-assimilation n Photosynthesis n Light Harvesting Ø No changes in FAS or enzymatic steps leading to TAG biosynthesis suggesting that upregulation of these components is not required for the lipid phenotype 14

16 Transcriptomics of ZnCys Knockdown Strain Confirmed down-regulation of primary N-assimilation genes n Under semi-continuous assay conditions, most genes in primary N-assimilation appear to be down-regulated in ZnCys-RNAi-7 15

17 Transcriptomics of ZnCys Knockdown Strain No changes in FAS or enzymatic steps leading to TAG biosynthesis KAR1 KAS1 KAS3 HAD ENR ACCase CBB n Up-regulation of LDSP is consistent with its proposed role in TAG lipid droplet biogenesis n Up-regulation of desaturases and elongases may be a response to a sensed shortage in PUFAs (e.g. low C2:5 in ZnCys-RNAi-7) n Western blotting for FAS components indicated that upregulation of FAS is not required for the lipid phenotype 16

18 Transcriptomics of ZnCys Knockdown Strain Gene Ontology Analysis Over-represented Up-regulated GO categories B 1% % C in Other Biomass % C in FAMEs % C in Carbohydrate % C in Protein 75% 5% ~1% increase (lipids) 25% % ZnCys-BASH-12 ZnCys-RNAi-7 ~45% decrease (protein) n The up-regulated gene set revealed significant enrichment in components of protein synthesis, suggesting a compensatory response to the ~45 % decrease in C partitioning to protein observed in ZnCys-RNAi-7 17

19 Summary of Results Current Mechanistic Understanding Wild type ZnCys-KO ZnCys-attenuated lines ZnCys ZnCys ZnCys N-assimilation NH 4 + C-metabolism N-assimilation NH 4 + C-metabolism N-assimilation NH 4 + C-metabolism Protein ~4% Carbohydrate Lipid ~2% Protein ~5% Carbohydrate Lipid ~55% Protein ~2% Carbohydrate Lipid ~4% n We hypothesize that ZnCys positively controls N-assimilation, thus causing severe growth and protein accumulation restrictions in the knockout n Expression of ZnCys can be fine-tuned to increase C-allocation to lipid at the expense of protein 18

20 Acknowledgements 19

Algal Biofuels Research: Using basic science to maximize fuel output. Jacob Dums, PhD candidate, Heike Sederoff Lab March 9, 2015

Algal Biofuels Research: Using basic science to maximize fuel output. Jacob Dums, PhD candidate, Heike Sederoff Lab March 9, 2015 Algal Biofuels Research: Using basic science to maximize fuel output Jacob Dums, PhD candidate, jtdums@ncsu.edu Heike Sederoff Lab March 9, 2015 Outline Research Approach Dunaliella Increase Oil Content

More information

Signaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana

Signaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana Biochemistry: Signaling in the Nitrogen Assimilation Pathway of Arabidopsis Thaliana 38 CAMERON E. NIENABER ʻ04 Abstract Long recognized as essential plant nutrients and metabolites, inorganic and organic

More information

Re-configuring Yarrowia lipolytica lipogenesis platform towards free fatty acid and biofuel production

Re-configuring Yarrowia lipolytica lipogenesis platform towards free fatty acid and biofuel production Re-configuring Yarrowia lipolytica lipogenesis platform towards free fatty acid and biofuel production Yonghong Meng, Ali Abghari, Rishikesh Ghogare, Xiaochao Xiong, GuokunWang, and Shulin Chen Bioprocessing

More information

Web: https://www.maynoothuniversity.ie/biology 1

Web: https://www.maynoothuniversity.ie/biology 1 Running head: Integrated systems in Aspergillus fumigatus. Interplay between Gliotoxin Resistance, Secretion and the Methyl/Methionine Cycle in Aspergillus fumigatus. Rebecca A. Owens 1, Grainne O Keeffe

More information

SOMATIC HYBRIDIZATION OF SELECTED MICRO ALGAL SPECIES BY PROTOPLAST FUSION-AN ATTEMPT TO GET DESTINED ALGAL CROP FOR COMMERCIAL BIOFUEL PRODUCTION

SOMATIC HYBRIDIZATION OF SELECTED MICRO ALGAL SPECIES BY PROTOPLAST FUSION-AN ATTEMPT TO GET DESTINED ALGAL CROP FOR COMMERCIAL BIOFUEL PRODUCTION SOMATIC HYBRIDIZATION OF SELECTED MICRO ALGAL SPECIES BY PROTOPLAST FUSION-AN ATTEMPT TO GET DESTINED ALGAL CROP FOR COMMERCIAL BIOFUEL PRODUCTION PROJECT REFERENCE NO.: 38S _B_MSC_002 COLLEGE : CMR INSTITUTE

More information

Very-Long Chain Fatty Acid Biosynthesis

Very-Long Chain Fatty Acid Biosynthesis Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions

More information

Biodiesel Production from Algae

Biodiesel Production from Algae University of Southern California, Undergraduate Symposium for Scholarly and Creative Work, April 9-11, 2012 Biodiesel Production from Algae Undergraduate Student Researchers: Avril Pitter, Kirsten Rice,

More information

Extraction of lipids from microalgae: optimization of an analytical method

Extraction of lipids from microalgae: optimization of an analytical method Extraction of lipids from microalgae: optimization of an analytical method Eline Ryckebosch K.U.Leuven Campus Kortrijk Research Unit Food & Lipids Belgium Outline Introduction Materials & Methods Results

More information

Genetic modification of microalgae for the sustainable production of high value products

Genetic modification of microalgae for the sustainable production of high value products Rothamsted Research where knowledge grows Genetic modification of microalgae for the sustainable production of high value products Olga Sayanova 9 May 2016 Cambridge Metabolic Engineering of Microalgae

More information

AFOSR Mathematics, Information and Life Sciences Program Manager Dr. WJ. Kozumbo

AFOSR Mathematics, Information and Life Sciences Program Manager Dr. WJ. Kozumbo AFOSR Mathematics, Information and Life Sciences Program Manager Dr. WJ. Kozumbo (vvalter.kozumbo@afosr.af.mil) Final Technical Report 03/15/08-03/14/11 Project FA9550-08-1-0165 Entitled: Regulation of

More information

Diluted acid pretreatment for an integrated microalgae bio-refinery to produce lipid- and carbohydrate-based biofuels

Diluted acid pretreatment for an integrated microalgae bio-refinery to produce lipid- and carbohydrate-based biofuels Diluted acid pretreatment for an integrated microalgae bio-refinery to produce lipid- and carbohydrate-based biofuels Tao Dong, Lieve Laurens, Nick Nagle, Stefanie Van Wychen, Nicholas Sweeney, Philip

More information

From solar energy to fuel using biology

From solar energy to fuel using biology Tekes BioRefine Nov 2012 From solar energy to fuel using biology concepts & challenges Patrik Jones Bioenergy Group (Univ. Turku, Finland) ,000,000,000 W increase in energy demand per day,000,000,000 exported

More information

Very-Long Chain Fatty Acid Biosynthesis

Very-Long Chain Fatty Acid Biosynthesis Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions

More information

BIOCHEMICAL CHARACTERIZATION OF TRIACYLGLYCEROL METABOLISM IN MICROALGAE. Bensheng Liu A DISSERTATION

BIOCHEMICAL CHARACTERIZATION OF TRIACYLGLYCEROL METABOLISM IN MICROALGAE. Bensheng Liu A DISSERTATION BIOCHEMICAL CHARACTERIZATION OF TRIACYLGLYCEROL METABOLISM IN MICROALGAE By Bensheng Liu A DISSERTATION Submitted to Michigan State University in partial fulfillment of the requirements for the degree

More information

DEPARTMENT OF BIOCHEMISTRY & MOLECULAR BIOLOGY

DEPARTMENT OF BIOCHEMISTRY & MOLECULAR BIOLOGY DEPARTMENT OF BIOCHEMISTRY & MOLECULAR BIOLOGY UNDERGRADUATE POSTER SESSION Monday, April 11, 2011 2:00-4:00pm Lisa Pinkava Under the Direction of Dr. Michael Thomashow Plant Research Laboratory Title:

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Differential expression of mirnas from the pri-mir-17-92a locus. Supplementary Figure 1 Differential expression of mirnas from the pri-mir-17-92a locus. (a) The mir-17-92a expression unit in the third intron of the host mir-17hg transcript. (b,c) Impact of knockdown

More information

Fatty Acid Desaturation

Fatty Acid Desaturation Fatty Acid Desaturation Objectives: 1. Isolation of desaturase mutants 2. Substrates for fatty acid desaturation 3. ellular localization of desaturases References: Buchanan et al. 2000. Biochemistry and

More information

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA

More information

Very-Long Chain Fatty Acid Biosynthesis

Very-Long Chain Fatty Acid Biosynthesis Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions

More information

Nannochloropsis, a rich source of diacylglycerol acyltransferases for engineering of triacylglycerol content in different hosts

Nannochloropsis, a rich source of diacylglycerol acyltransferases for engineering of triacylglycerol content in different hosts DOI 10.1186/s13068-016-0686-8 Biotechnology for Biofuels RESEARCH Open Access Nannochloropsis, a rich source of diacylglycerol acyltransferases for engineering of triacylglycerol content in different hosts

More information

Evaluating Variability of Allergens in Commodity Crops (Peanuts)

Evaluating Variability of Allergens in Commodity Crops (Peanuts) Evaluating Variability of Allergens in Commodity Crops (Peanuts) Peggy Ozias-Akins Laura Ramos Paola Faustinelli Ye Chu University of Georgia Manel Jordana Katherine Arias McMaster University Soheila Maleki

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis

More information

INTEGRATION OF GENERAL AMINO ACID CONTROL AND TOR REGULATORY PATHWAYS IN NITROGEN ASSIMILATION IN YEAST

INTEGRATION OF GENERAL AMINO ACID CONTROL AND TOR REGULATORY PATHWAYS IN NITROGEN ASSIMILATION IN YEAST INTEGRATION OF GENERAL AMINO ACID CONTROL AND TOR REGULATORY PATHWAYS IN NITROGEN ASSIMILATION IN YEAST Kirk A. Staschke 1, Souvik Dey 1, John M. Zaborske 2, Lakshmi Reddy Palam 1, Jeanette N. McClintick

More information

Omega 3 oil sources for use in aquaculture Alternatives to the unstainable harvest of wildfish

Omega 3 oil sources for use in aquaculture Alternatives to the unstainable harvest of wildfish Omega 3 oil sources for use in aquaculture Alternatives to the unstainable harvest of wildfish Prepared by: Matt Miller, Peter Nichols & Chris Carter Problem Aquaculture is growing Requires wild caught

More information

A mutant in Arabidopsis Lacking a Chloroplast Specific Lipid. Lewis Kurschner and Karen Thulasi Masters in Botany

A mutant in Arabidopsis Lacking a Chloroplast Specific Lipid. Lewis Kurschner and Karen Thulasi Masters in Botany A mutant in Arabidopsis Lacking a Chloroplast Specific Lipid Lewis Kurschner and Karen Thulasi Masters in Botany Fatty acid nomenclature Fatty acyl composition Chain length Degree of unsaturation and position

More information

Biochemical shifts in Chlorella lipid metabolism for two-stage bioprocessing

Biochemical shifts in Chlorella lipid metabolism for two-stage bioprocessing Biochemical shifts in Chlorella lipid metabolism for two-stage bioprocessing Julian Rosenberg, PhD Candidate Department of Chemical & Biomolecular Engineering Johns Hopkins University, Baltimore, MD September

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue

More information

Canadian Canola The Path Forward American Fats and Oils Association. Patti Miller, President Canola Council of Canada

Canadian Canola The Path Forward American Fats and Oils Association. Patti Miller, President Canola Council of Canada Canadian Canola The Path Forward American Fats and Oils Association Patti Miller, President Canola Council of Canada Overview Who is the Canola Council? Canadian canola production 20,000 25,000 18,000

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

RNAi in HBV, the next backbone therapy for use in combinations? Bruce D. Given, MD COO, Arrowhead Pharmaceuticals L.I.F.E.R.

RNAi in HBV, the next backbone therapy for use in combinations? Bruce D. Given, MD COO, Arrowhead Pharmaceuticals L.I.F.E.R. RNAi in HBV, the next backbone therapy for use in combinations? Bruce D. Given, MD COO, Arrowhead Pharmaceuticals L.I.F.E.R. October 20, 2017 Safe Harbor Statement This presentation contains forward-looking

More information

Neurotrophic factor GDNF and camp suppress glucocorticoid-inducible PNMT expression in a mouse pheochromocytoma model.

Neurotrophic factor GDNF and camp suppress glucocorticoid-inducible PNMT expression in a mouse pheochromocytoma model. 161 Neurotrophic factor GDNF and camp suppress glucocorticoid-inducible PNMT expression in a mouse pheochromocytoma model. Marian J. Evinger a, James F. Powers b and Arthur S. Tischler b a. Department

More information

Enhanced microbial lipid production with genetically modified yeast and fungus

Enhanced microbial lipid production with genetically modified yeast and fungus Enhanced microbial lipid production with genetically modified yeast and fungus Pacific Rim Summit on Industrial Biotechnology and Bioenergy 2014 Kari Koivuranta, Marilyn Wiebe, Laura Ruohonen and Merja

More information

APPLICATION OF CAROTENOIDS WITH SPECIAL REFERENCE TO MICROALGAE

APPLICATION OF CAROTENOIDS WITH SPECIAL REFERENCE TO MICROALGAE APPLICATION OF CAROTENOIDS WITH SPECIAL REFERENCE TO MICROALGAE Dr. Ranga Rao Ambati Assistant Research Professor Department of Science and Technology Beijing Normal University-Hong Kong Baptist University

More information

Lecture 3-4. Identification of Positive Regulators downstream of SA

Lecture 3-4. Identification of Positive Regulators downstream of SA Lecture 3-4 Identification of Positive Regulators downstream of SA Positive regulators between SA and resistance/pr Systemic resistance PR gene expression? SA Local infection Necrosis SA What could they

More information

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation,

a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, Supplementary Information Supplementary Figures Supplementary Figure 1. a) List of KMTs targeted in the shrna screen. The official symbol, KMT designation, gene ID and specifities are provided. Those highlighted

More information

Application of equilibrium partitioning-based model framework for evaluating soil (and sediment) hazards of lipophilic nonpolar organic substances.

Application of equilibrium partitioning-based model framework for evaluating soil (and sediment) hazards of lipophilic nonpolar organic substances. October 7, 2015 Application of equilibrium partitioning-based model framework for evaluating soil (and sediment) hazards of lipophilic nonpolar organic substances. AD Redman, TF Parkerton, Leon Paumen

More information

Metabolic Solutions Development Company, Kalamazoo, USA.

Metabolic Solutions Development Company, Kalamazoo, USA. New Insulin Sensitizers Produce Differentiation of Brown-like Adipose Cells from a Subcutaneous Fat Depot and Increase Secretion of Adiponectin in vitro William G. McDonald, Serena L. Cole, Danielle D.

More information

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.

Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T

More information

Mechanisms of alternative splicing regulation

Mechanisms of alternative splicing regulation Mechanisms of alternative splicing regulation The number of mechanisms that are known to be involved in splicing regulation approximates the number of splicing decisions that have been analyzed in detail.

More information

glpx Rv1100 Probe 4.4 kb 75 kda 50 kda 37 kda 25 kda 20 kda

glpx Rv1100 Probe 4.4 kb 75 kda 50 kda 37 kda 25 kda 20 kda PvuI 2.0 k PvuI PvuI Rv1101c Rv1100 glpx fum 4.4 k PvuI PvuI ΔglpX Rv1101c Rv1100 HygR fum ΔglpX 5 k 4 k 3 k c 75 kda 50 kda 37 kda GLPX Δ Δ/C GLPX 2 k 1.5 k 25 kda 20 kda PRCB 1 k 0.5 k Supplementary

More information

Reviewer #1. Reviewer #2

Reviewer #1. Reviewer #2 Reviewer #1 A&E The manuscript by Zhou et al. describes production of fatty acids, fatty alcohols, and alkanes in Saccharomyces cerevisiae. First they use various previously developed modifications to

More information

PUFAChain - a value chain from algal biomass to lipid-based products

PUFAChain - a value chain from algal biomass to lipid-based products PUFAChain - a value chain from algal biomass to lipid-based products Thomas Friedl, Stefan Durm, Anastasiia Kryvenda Congress Innovations from biomass, Papenburg, Germany, June 18 2015 Project Objectives

More information

Plant Physiology Preview. Published on December 24, 2015, as DOI: /pp

Plant Physiology Preview. Published on December 24, 2015, as DOI: /pp Plant Physiology Preview. Published on December 24, 2015, as DOI:10.1104/pp.15.01907 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Running head: PSR1 Regulation of Metabolism Corresponding author: Dr Jon Pittman

More information

Bio-energetics and Bio-energy: Blue-mussels as source for raw materials

Bio-energetics and Bio-energy: Blue-mussels as source for raw materials Bio-energetics and Bio-energy: Blue-mussels as source for raw materials Daniel Pleissner, Ph.D.-student, Institute of Biology Kerteminde Seminar, Dec. 21st Bio-production and Bio-energetics: Bio-reactor

More information

Bioprospecting for high PUFA content in Northern marine microalgae. Pia Steinrücken University of Bergen Norway

Bioprospecting for high PUFA content in Northern marine microalgae. Pia Steinrücken University of Bergen Norway Bioprospecting for high PUFA content in Northern marine microalgae Pia Steinrücken University of Bergen Norway 1 Focus new microalgae with industrial potential University of Bergen, Norway University of

More information

Understanding the regulation of oil biosynthesis in oil-rich tissues (for the purpose of enriching plant oil content to generate biofuels)

Understanding the regulation of oil biosynthesis in oil-rich tissues (for the purpose of enriching plant oil content to generate biofuels) Understanding the regulation of oil biosynthesis in oil-rich tissues (for the purpose of enriching plant oil content to generate biofuels) Aruna Kilaru East Tennessee State University Johnson City, TN,

More information

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein

Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.

More information

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]

1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h] 7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1

More information

Supplementary Figure 1 IL-27 IL

Supplementary Figure 1 IL-27 IL Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.

More information

BIO360 Fall 2013 Quiz 1

BIO360 Fall 2013 Quiz 1 BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.

More information

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)

Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.

More information

Supplementary Materials for

Supplementary Materials for www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer

More information

Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR

Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR Fig. S2. Transactivation potential of PPAR Fig. S1. Validation of ChIP-seq binding sites by single gene ChIP-PCR ChIP-PCR was performed on PPARγ and RXR-enriched chromatin harvested during adipocyte differentiation at day and day 6 as described

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression

More information

Lecture 21. RNA-seq: Advanced analysis

Lecture 21. RNA-seq: Advanced analysis Lecture 21 RNA-seq: Advanced analysis Experimental design Introduction An experiment is a process or study that results in the collection of data. Statistical experiments are conducted in situations in

More information

Engineering of Metabolic Pathways and Global Regulators of Yarrowia lipolytica to Produce High Value Commercial Products

Engineering of Metabolic Pathways and Global Regulators of Yarrowia lipolytica to Produce High Value Commercial Products Engineering Conferences International ECI Digital Archives Metabolic Engineering IX Proceedings Summer 6-7-2012 Engineering of Metabolic Pathways and Global Regulators of Yarrowia lipolytica to Produce

More information

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma

Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma RESEARCH FUND FOR THE CONTROL OF INFECTIOUS DISEASES Functional characterisation of hepatitis B viral X protein/microrna-21 interaction in HBVassociated hepatocellular carcinoma CH Li, SC Chow, DL Yin,

More information

Molecular and cellular mechanisms of neutral lipid accumulation in diatom following nitrogen deprivation

Molecular and cellular mechanisms of neutral lipid accumulation in diatom following nitrogen deprivation Yang et al. Biotechnology for Biofuels 2013, 6:67 RESEARCH Open Access Molecular and cellular mechanisms of neutral lipid accumulation in diatom following nitrogen deprivation Zhi-Kai Yang 1, Ying-Fang

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. PL gene expression in tomato fruit.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. PL gene expression in tomato fruit. Supplementary Figure 1 PL gene expression in tomato fruit. Relative expression of five PL-coding genes measured in at least three fruit of each genotype (cv. Alisa Craig) at four stages of development,

More information

Supplementary Information. Supplementary Figure 1

Supplementary Information. Supplementary Figure 1 Supplementary Information Supplementary Figure 1 1 Supplementary Figure 1. Functional assay of the hcas9-2a-mcherry construct (a) Gene correction of a mutant EGFP reporter cell line mediated by hcas9 or

More information

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original

Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

ZL ZDF ZDF + E2 *** Visceral (g) ZDF

ZL ZDF ZDF + E2 *** Visceral (g) ZDF Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect

More information

Supplementary Figure 1

Supplementary Figure 1 A B D Relative TAp73 mrna p73 Supplementary Figure 1 25 2 15 1 5 p63 _-tub. MDA-468 HCC1143 HCC38 SUM149 MDA-468 HCC1143 HCC38 SUM149 HCC-1937 MDA-MB-468 ΔNp63_ TAp73_ TAp73β E C Relative ΔNp63 mrna TAp73

More information

Why discuss the topic of: lipid Biosynthesis? Lipids as: - Biofuels. Dehesh UC Davis

Why discuss the topic of: lipid Biosynthesis? Lipids as: - Biofuels. Dehesh UC Davis Why discuss the topic of: lipid Biosynthesis? Lipids as: - Biofuels Dehesh UC Davis Fossil fuel is believed to be derived from ancient lipid rich organic material such as spores and planktonic algae! Rudolf

More information

Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice

Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Supplementary Information Genome-editing via Oviductal Nucleic Acids Delivery (GONAD) system: a novel microinjection-independent genome engineering method in mice Gou Takahashi, Channabasavaiah B Gurumurthy,

More information

Problem Set 5 KEY

Problem Set 5 KEY 2006 7.012 Problem Set 5 KEY ** Due before 5 PM on THURSDAY, November 9, 2006. ** Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying the development

More information

Nitrate and Ammonium Interactions in Maize

Nitrate and Ammonium Interactions in Maize Nitrate and Ammonium Interactions in Maize By Jessey George Thesis submitted in fulfilment of the requirements for the degree of Doctorate of Philosophy in the Faculty of Sciences at The University of

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Microalgae for the production of lipid and carotenoids: a review with focus on stress regulation and adaptation

Microalgae for the production of lipid and carotenoids: a review with focus on stress regulation and adaptation https://doi.org/10.1186/s13068-018-1275-9 Biotechnology for Biofuels REVIEW Open Access Microalgae for the production of lipid and carotenoids: a review with focus on stress regulation and adaptation Xiao

More information

Supplementary Information

Supplementary Information Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna

More information

Circular RNAs (circrnas) act a stable mirna sponges

Circular RNAs (circrnas) act a stable mirna sponges Circular RNAs (circrnas) act a stable mirna sponges cernas compete for mirnas Ancestal mrna (+3 UTR) Pseudogene RNA (+3 UTR homolgy region) The model holds true for all RNAs that share a mirna binding

More information

Very-Long Chain Fatty Acid Biosynthesis

Very-Long Chain Fatty Acid Biosynthesis Very-Long Chain Fatty Acid Biosynthesis Objectives: 1. Review information on the isolation of mutants deficient in VLCFA biosynthesis 2. Generate hypotheses to explain the absence of mutants with lesions

More information

Biotechnology for Biofuels. Open Access RESEARCH

Biotechnology for Biofuels. Open Access RESEARCH https://doi.org/1.1186/s1368-18-139-3 Biotechnology for Biofuels RESEARCH Open Access Enhanced triacylglycerol production in the diatom Phaeodactylum tricornutum by inactivation of a Hotdog fold thioesterase

More information

Optimization of Lipid Accumulation by Starchless Mutant Chlorella sorokiniana for Biodiesel Production

Optimization of Lipid Accumulation by Starchless Mutant Chlorella sorokiniana for Biodiesel Production Kasetsart J. (Nat. Sci.) 49 : 54-66 (2015) Optimization of Lipid Accumulation by Starchless Mutant Chlorella sorokiniana for Biodiesel Production Watchara Jantasee, Wichien Yongmanitchai and Duenrut Chonudomkul*

More information

Supplementary information

Supplementary information Supplementary information Human Cytomegalovirus MicroRNA mir-us4-1 Inhibits CD8 + T Cell Response by Targeting ERAP1 Sungchul Kim, Sanghyun Lee, Jinwook Shin, Youngkyun Kim, Irini Evnouchidou, Donghyun

More information

Heterotrophic Growth of Chlorella sp. KKU-S2 for Lipid Production using Molasses as a Carbon Substrate

Heterotrophic Growth of Chlorella sp. KKU-S2 for Lipid Production using Molasses as a Carbon Substrate 2011 International Conference on Food Engineering and Biotechnology IPCBEE vol.9 (2011) (2011)IACSIT Press, Singapoore Heterotrophic Growth of Chlorella sp. KKU-S2 for Lipid Production using Molasses as

More information

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3

Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 Supplemental Figure Legends. Figure S1. ERBB3 mrna levels are elevated in Luminal A breast cancers harboring ERBB3 ErbB3 gene copy number gain. Supplemental Figure S1. ERBB3 mrna levels are elevated in

More information

Gene Regulation Part 2

Gene Regulation Part 2 Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that

More information

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow

L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells

More information

Synthesis and elongation of fatty acids

Synthesis and elongation of fatty acids Synthesis and elongation of fatty acids A molecular caliper mechanism for determining very long-chain fatty acid length Vladimir Denic and Jonathan S. Weissman (2007) Cell 130, 663-677 February 28, 2008

More information

Supplementary Information Titles Journal: Nature Medicine

Supplementary Information Titles Journal: Nature Medicine Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11

More information

RNA-seq. Design of experiments

RNA-seq. Design of experiments RNA-seq Design of experiments Experimental design Introduction An experiment is a process or study that results in the collection of data. Statistical experiments are conducted in situations in which researchers

More information

The value of Omics to chemical risk assessment

The value of Omics to chemical risk assessment The value of Omics to chemical risk assessment Timothy W Gant There is a focus on transcriptomics in this talk but for example only. All omics are useful in risk assessment Outline What are we aiming to

More information

supplementary information

supplementary information DOI: 10.1038/ncb2157 Figure S1 Immobilization of histone pre-mrna to chromatin leads to formation of histone locus body with associated Cajal body. Endogenous histone H2b(e) pre-mrna is processed with

More information

ALTERATIONS IN NEURAL FATTY ACID METABOLISM CAUSED BY VITAMIN E DEFICIENCY

ALTERATIONS IN NEURAL FATTY ACID METABOLISM CAUSED BY VITAMIN E DEFICIENCY ALTERATIONS IN NEURAL FATTY ACID METABOLISM CAUSED BY VITAMIN E DEFICIENCY Bonnie Buckingham Faculty Mentor: Dr. Maret Traber Linus Pauling Institute HHMI Summer 2011 Outline Significance Background Hypothesis

More information

Non-fuel Products from Algae An Overview

Non-fuel Products from Algae An Overview List of Contents Non-fuel Products from Algae An Overview Introduction Non-fuel Products from Algae o Pharmaceuticals & Nutraceuticals o Food & Feed o Specialty Chemicals o Personal Care Products o Natural

More information

New Catalytic Approaches to Produce Fuels from Algae

New Catalytic Approaches to Produce Fuels from Algae Panel 25.9.212 New Catalytic Approaches to Produce Fuels from Algae Chen Zhao, Johannes A. Lercher Department of Chemistry, Technische Universität München Panel 25.9.212 utline Introduction Fatty acid

More information

CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies

CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies CRISPR-mediated Editing of Hematopoietic Stem Cells for the Treatment of β-hemoglobinopathies Jennifer Gori American Society of Gene & Cell Therapy May 11, 2017 editasmedicine.com 1 Highlights Developed

More information

Dominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer

Dominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for

More information

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized

More information

Section 6. Junaid Malek, M.D.

Section 6. Junaid Malek, M.D. Section 6 Junaid Malek, M.D. The Golgi and gp160 gp160 transported from ER to the Golgi in coated vesicles These coated vesicles fuse to the cis portion of the Golgi and deposit their cargo in the cisternae

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1 Schematic depiction of the tandem Fc GDF15. Supplementary Figure 2 Supplementary Figure 2 Gfral mrna levels in the brains of both wild-type and knockout Gfral

More information

Factors Affecting Photosynthesis!

Factors Affecting Photosynthesis! Factors Affecting Photosynthesis! Temperature Eppley (1972) Light Sverdrup s Critical Depth Model Nutrients Limitations Uptake Kinetics Temperature! The oceans vary much less than the land does, both seasonally

More information

Factors influencing the Aspergillus fumigatus survival into the host mediated by the calcineurin pathway

Factors influencing the Aspergillus fumigatus survival into the host mediated by the calcineurin pathway Factors influencing the Aspergillus fumigatus survival into the host mediated by the calcineurin pathway Gustavo H. Goldman Universidade de São Paulo, Brazil Calcineurin is a calmodulin/ca +2 dependent

More information

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81.

Supplementary Figure 1. MAT IIα is Acetylated at Lysine 81. IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag

More information

Regulation of Lipid Homeostasis: Lipid Droplets

Regulation of Lipid Homeostasis: Lipid Droplets Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells

More information

Development of subcutaneously administered RNAi therapeutic ARO-HBV for chronic hepatitis B virus infection

Development of subcutaneously administered RNAi therapeutic ARO-HBV for chronic hepatitis B virus infection Development of subcutaneously administered RNAi therapeutic ARO-HBV for chronic hepatitis B virus infection Christine Wooddell, Rui Zhu, Holly Hamilton, Qili Chu, Heather Sternard, Joshua Schumacher, Thomas

More information

Advanced Biofuels Overview. January 21, 2009

Advanced Biofuels Overview. January 21, 2009 Advanced Biofuels verview January 21, 2009 1 Factors to Consider Utility Who is the end user? Production scalability US gasoline consumption: 390 million gallons/day... Environmental friendliness 2 Liquid

More information