TMEM16A knockdown abrogates two different Ca 2+ -activated Cl currents and contractility of smooth muscle in rat mesenteric small arteries

Transcription

1 Pflugers Arch - Eur J Physiol (214) 466: DOI 1.17/s ION CHANNELS, RECEPTORS AND TRANSPORTERS TMEM16A knockdown rogtes two different C 2+ -ctivted Cl currents nd contrctility of smooth muscle in rt mesenteric smll rteries Vieke Secher Dm & Donn M. B. Boedtkjer & Jko Nyvd & Christin Alkjer & Vldimir Mtchkov Received: 9 August 213 /Revised: 1 Octoer 213 /Accepted: 1 Octoer 213 /Pulished online: 27 Octoer 213 # The Author(s) 213. This rticle is pulished with open ccess t Springerlink.com Astrct ThepresenceofC 2+ -ctivted Cl chnnels (CCCs) in vsculr smooth muscle cells (SMCs) is well estlished. Their moleculr identity is, however, elusive. Two distinct C 2+ -ctivted Cl currents (I Cl(C) )were previously chrcterized in SMCs. We hve shown tht the cgmp-dependent I Cl(C) depends on estrophin expression, while the clssicl I Cl(C) is not. Downregultion of estrophins did not ffect rteril contrction ut inhiited the rhythmic contrctions, vsomotion. In this study, we hve used in vivo sirna trnsfection of rt mesenteric smll rteries to investigte the role of puttive CCC, TMEM16A. Isometric force, [C 2+ ] i, nd SMC memrne potentil were mesured in isolted rteril segments. I Cl(C) nd GTPγS-induced nonselective ction current were mesured in isolted SMCs. Downregultion of TMEM16A resulted in inhiition of oth the cgmp-dependent I Cl(C) nd the clssicl I Cl(C) in SMCs. TMEM16A downregultion lso reduced expression of estrophins. TMEM16A downregultion suppressed vsomotion oth in vivo nd in vitro. Downregultion of TMEM16A reduced gonist (nordrenline nd vsopressin) nd K + -induced contrctions. In ccordnce with the depolrizing role of CCCs, TMEM16A downregultion suppressed gonist-induced depolriztion nd elevtion in [C 2+ ] i. Surprisingly, K + - induced depolriztion ws unchnged ut C 2+ entry ws reduced. We suggested tht this is due to reduced expression of the L-type C 2+ chnnels, s oserved t the mrna level. Thus, the importnce of TMEM16A for contrction is, t lest V. S. Dm: D. M. B. Boedtkjer : J. Nyvd : C. Alkjer : V. Mtchkov () Deprtment of Biomedicine, MEMBRANES, Arhus University, Ole Worms Alle ygn.4, 1163, Arhus C 8, Denmrk e-mil: vvm@fi.u.dk in prt, independent from memrne potentil. This study demonstrtes the significnce of TMEM16A for two SMCs I Cl(C) nd vsculr function nd suggests n interction etween TMEM16A nd L-type C 2+ chnnels. Keywords C 2+ -ctivted Cl chnnel. Excittion contrction coupling. Smooth muscle cells. sirna. Memrne potentil. Intrcellulr clcium Introduction Clcium-ctivted chloride chnnels (CCCs) hve een intensely studied during the lst decde [16]. This is, in prt, ecuse these chnnels represent the lrgest remining group of memrne conductnces for which the moleculr identity is uncertin [4]. Recent functionl nd structurl studies strengthen though the position of the TMEM16 fmily (noctmins), which re one of the most prominent cndidtes for CCCs [13, 1, 16, 2]. The heterologous overexpression of t lest some memers of the TMEM16 fmily, i.e., TMEM16A nd TMEM16B, induces I Cl(C) with chrcteristics closely resemling the properties of the endogenous I Cl(C) in smooth muscle cells (SMCs) [, 43, 47]. Moreover, it hs een shown tht ntive I Cl(C) depends on TMEM16A expression [1, 8, 17, 24, 44]. Genetic knockout or ex vivo sirna-sed downregultion of TMEM16A suppresses ntive I Cl(C) nd olishes some CCC-dependent cellulr functions [16, 2]. The presence of CCCs insmcs is well estlished [22, 23]. The SMC I Cl(C) is well chrcterized nd its functionl significnce documented. Since Cl is ctively trnsported into SMCs, incresed SMC Cl current depolrizes the cell memrne [6] ndi Cl(C) hs een suggested to prticipte in excittion contrction coupling. Agonist-induced C 2+ relese

2 1392 Pflugers Arch - Eur J Physiol (214) 466: is generlly thought to led to CCC-dependent memrne depolriztion which in turn opens voltge-gted C 2+ chnnels, which further increses the intrcellulr C 2+. The ntive I Cl(C) hs lso een suggested to e importnt for SMC prolifertion during vsculr remodeling nd for mechnosensitive responses of the rteril wll [46]. Recently, TMEM16A hs een shown to e importnt for I Cl(C), for memrne potentil, nd for myogenic tone in rt cererl rteries [4]. We hve previously shown tht vsculr SMC I Cl(C) is comprised of two currents [2]:indditiontotheI Cl(C) with clssicl iophysicl nd phrmcologicl chrcteristics [2, 27], we identified cgmp-dependent I Cl(C) in the sme SMCs. The two Cl currents co-exist throughout the vsculr tree, lthough the reltive expression differs etween vsculr eds [26]. Interestingly, pulmonry rteries exhiit no cgmpdependent I Cl(C) [2, 26]. Using sirna, we hve previously demonstrted tht knockdown of estrophin expression is ssocited with disppernce of the cgmp-dependent I Cl(C) in SMCs [27] ut hs no effect on the clssicl I Cl(C).Welso found tht knockdown of estrophin is not importnt for gonist-induced contrction [3]. This is consistent with other studies showing tht the Cl grdient is not importnt for gonist-induced vsoconstriction of rt mesenteric rteries [2]. A key role for I Cl(C) in contrction is suggested in other species nd vsculr eds, e.g., rit mesenteric rteries, lthough the ion sustitution experiments were not performed there [41]. Thus, the exct role of the clssicl I Cl(C) for SMC gonistinduced contrction remins uncler. However, downregultion of estrophins significntly suppresses vsomotion [3], which supports the hypothesis tht the cgmp-dependent I Cl(C) is importnt for synchroniztion of SMCs in the genertion of vsomotion [37]. In this study, we test the hypothesis tht TMEM16A, which is endogenously expressed in SMCs [8, 24, 44], is necessry for the ntive I Cl(C) : to do so, we downregulted TMEM16Ainrtmesentericsmllrteriesinvivowith sirna [3, 27, 28]. We found tht the presence of TMEM16A is importnt for oth the cgmp-independent I Cl(C) nd the cgmp-dependent I Cl(C). The interprettion of this result is complicted, however, y our finding tht downregultion of TMEM16A leds to reduced expression of estrophins, which previously hs een shown to e importnt for the cgmp-dependent I Cl(C) [27]. Furthermore, downregultion of TMEM16A reduced the contrctile response nd inhiited vsomotion. Elevtions in intrcellulr C 2+ nd memrne potentil in response to gonist stimultion were lso reduced in TMEM16Adownregulted rteries. However, the contrctile response to K + -induced depolriztion ws lso reduced nd this ws ccompnied y reduced expression of vsculr voltgedependent L-type C 2+ chnnels. The current study suggests tht TMEM16A is importnt for SMCs contrction in memrne potentil-dependent nd potentil-independent wys. Methods All experiments were pproved y nd conducted with permission from the Animl Experiments Inspectorte of the Dnish Ministry of Justice. In vivo sirna trnsfection A segment of rt mesenteric smll rteries ws trnsfected in vivo s descried previously [3, 28]. Shortly, Wistr mle rts were nesthetized with sucutneous injection of comintion of Hypnorm (1 mg/1 g; VetPhrm Ltd., UK) nd midzolm (. mg/1 g; Hmeln Phrm GMBH, Germny). Supplementry nesthesi ws given ech hlf hour during the trnsfection procedure. A medil lprotomy ws performed nd section of the mesentery ws gently pulled out. A short segment (~1 mm) of first order rnch from the superior mesenteric rtery ws gently clened of ft nd the tip (~. mm length) of n elstic micropipette (MicroFill 34G-; World Precision Instruments Inc., USA) ws inserted through puncture mde y needle. The downstrem rteries were flushed with the trnsfection solution nd clmp ws plced ner the entrnce of the smll rteries to the gut wll to void ckflow of lood from the mesenteric rcde; cre ws tken to void overfilling of the rtery segments. Trnsfection ws performed for 2 min; every 2. min, the downstrem clmp ws relesed nd the rteries flushed with new trnsfection solution. After trnsfection, the mesentery ws returned to the peritonel cvity nd the wound closed. The pinkiller Temgesic (2 ml/1 g; Schering-Plough, Belgium) ws given t the end of the trnsfection. TKO -sed trnsfection ws used (Mirus Bio Co., USA). The concentrtion of sirna in the finl trnsfection solution ws ~8 nm. The sirna oligos were mnufctured y Eurofin MWG Operon (Germny) with TT overhng (Tle 1), nd the efficiency of sirna trnsfection ws initilly tested on smooth muscle cell line (A7r) (not shown). Two different sirna directed ginst Tmem16 were used in the study (Tle 1): one ws directed ginst exon 23 (Tmem16-siRNA) nd ws used throughout the whole study, while the second ws directed ginst exon 22 (Tmem16siRNA-2) nd ws used in some experiments. Two mesenteric rtery rnches from one rt were trnsfected ech time; one with sirna directed ginst Tmem16 nd nother with control sirna. Either nonrelted sirna directed ginst enhnced green fluorescent protein (egfp; Amion Ltd) or nonfunctionl sirna directed ginst Tmem16 with four mutted nucleotides ws used s the control sirna (Tle 1). Three dys fter trnsfection, rts were either used for in vivo study or scrificed y CO 2 inhltion to permit mesenteric rteries to e hrvested for in vitro studies. Arteries trnsfected with Tmem16-siRNA, rteries

3 Pflugers Arch - Eur J Physiol (214) 466: Tle 1 Oligonucleotide sequences Trget position Trget gene Primer (sequencing experiments) Sequence Trget rtm_47-66 F ctctgcggcccgg Bp 47 rtm_71-77 F tgccccggggtgtc Bp 71 rtm_1-174 F ccttctgggcctgg Bp 1 rtm_ F tgctcctcccctctgtg Bp 1861 rtm_24-29 F gcctcggccgc Bp 24 rtm_ F ggcctttgcggggt Bp 3361 rtm_ r ccttcttcgtgggctctt Bp 766 rtm_14-173r cgccgtttcttggggc Bp 173 rtm_ r ccgtgggggggttc Bp 188 rtm_39-319r ctgtgggctgtggttgtt Bp 319 rtm_ r ccggctttttctgccct Bp 3713 rtm_ r gcgctcgcccgctc Bp 4619 sirna Sequence Tmem16-siRNA (exon 23) cggucuucuuucuucuuuctt Ano1/NM_ mutted Tmem16-siRNA cggucggcuucucuuuctt Ano1/NM_ Tmem16-siRNA-2 (exon 22) guuuuuucuuuguuuctt Ano1/NM_ egfp-sirna cccuccuggccccgtt egfp Primer (qpcr) Sequence rtm_tq2621-f tgtgtctccttccgtctg Ano1/NM_ rtm_tq282-r ctcttgtgttctgcccg Ano1/NM_ rccn1c-f ctctcctcccttcttccg Ccn1c/NM_ rccn1c-r tcctgctccctcctg Ccn1c/NM_ α1 α-drenergic receptors-f ccgttcttcctgtctgcc Adr1/NM_ α1 α-drenergic receptors-r tgtctctgtgctgtccctc Adr1/NM_ α1 α-drenergic receptors-f cgctttctgggcccc Adr1/NM_ α1 α-drenergic receptors-r ccgcccccttgcc Adr1/NM_ α1d α-drenergic receptors-f cggcccggtgcgg Adr1d/NM_ α1d α-drenergic receptors-r tgcccgccggtgc Adr1d/NM_ rbest1 (Applied Biosystems) Rn14117_m1 Best1/NM_ rbest2 (Applied Biosystems) Rn2372_m1 Best2/NM_ rbest3 (Applied Biosystems) Rn19681_m1 Best3/NM_ rgapdh_tq1-f ccggcgttccggccg Gpdh/NM_178.3 rgapdh_tq1138-r gctcccgctctcgccc Gpdh/NM_178.3 rtfrc_tq178-f gcgtttggttgcttg Tfrc/NM_ rtfrc_tq1961-r gggtcctctgtctgggt Tfrc/NM_ Proe Sequence rtm_tq269-p cctctctgtcgtccgggcc Ano1/NM_ Rccn1c-P tgctgtggccttctcgtccttccgg Ccn1c/NM_ rgapdh_tq14-p gctggtctccgggccctccc Gpdh/NM_178.3 rtfrc_tq19-p cgcgggtggccggtcgttctttt Tfrc/NM_ trnsfected with control sirna (either egfp-sirna or mutted Tmem16-siRNA), nd nontrnsfected rteries from the sme rt were used for the following studies. Contrctile responses of mesenteric smll rteries in vivo Three dys fter trnsfection, rts were nesthetized using ketmine (33 mg/1 g; Ketminol vet, Intervet Interntionl, Hollnd) nd xylzine (7. mg/1 g; Nrcoxyl vet, Intervet Interntionl, Hollnd) dministered sucutneously nd plced in chmer heted to C. A lterl lprotomy ws performed nd short segment (1. 2 cm) of the intestine nd mesentery were crefully pulled out. A single rnch of the mesenteric rtery ws plced in smll reservoir (6. mm width 6. mm length 3 mm depth, corresponding to volume of ~1 μl) y pssing ends of the rnch through openings t

4 1394 Pflugers Arch - Eur J Physiol (214) 466: the two sides of the reservoir. The openings etween the reservoir wlls nd the rtery were seled with high vcuum grese (Dow Corning GMBH, Wiesden, Germny). Thus, the mesenteric rtery segment in the reservoir ws perfused ut isolted extrluminry from the rest of intestine nd mesentery. The reservoir ws filled with physiologicl sline solution (PSS) contining 1 mm HEPES (HEPES-PSS) uled with % CO 2 in N 2. During the experiment, the extrcted intestine nd mesentery were kept moist using ndges soked in HEPES- PSS. Different nordrenline (NA) concentrtions were pplied y dding 1 μl corresponding stock solution prepred in HEPES-PSS to the reservoir. Ech concentrtion ws pplied for 2 3min. The rt ws plced on microscope (Motic PSM-1) tle nd the rtery ws focused. Approximtely % of the surrounding mesenteric ft ws dissected from the top of the segment to enle visuliztion of the inner dimeter of the rtery. The rteril inner dimeter ws cptured with USB CCD Monochrome Cmer (DMK 41 AU2, Imging Source, Germny) ttched to the microscope nd processed using DMT Vessel Acquisition Suite softwre (Dnish Myo Technology A/S, Denmrk). The dimeter mesured immeditely fter wshout three times ws not different from the pssive dimeter mesured in vivo in the presence of 1 μm ppverine hydrochloride, 1 μm phentolmine, 1 μm Y-27632, nd 1 μm cetylcholine (dt not shown). Therefore, chnges in vsculr tone re expressed s percent reduction of the pssive (wshout) dimeter. mrna quntifiction quntittive polymerse chin rection (qpcr) Arteries were dissected nd stored in stilizing regent RNAlter (Qigen, VWR, Denmrk). Isolted rteril segments were homogenized in Tissue Lyser (.33 Hz; Qigen, VWR, Denmrk) for 3 min. RNA isoltion ws crried out using RNesy Micro kit (Qigen, VWR, Denmrk) ccording to the mnufcturer's protocol, followed y stndrd reverse trnscriptse. Quntittive PCR (qpcr) ws performed to ssess the expression of specific RNAs (Tle 1) using Tqmn proe technology (Tmem16 mrna quntifiction; Eurofins MWG Operon, Germny nd estrophin mrna quntifiction; Applied Biosystems, Denmrk) with the mplified sequence eing different from the sirna-trgeted sequence. Quntifiction of RNA for α1, α1, nd α1d drenergic receptors ws performed using SYBR Green ssy. All mplifictions were crried out on MX3P (Strtgene, USA). Gene expression ws normlized to GAPDH nd trnsferrin receptor expression (verge Ct vlue) nd presented s ΔCt vlue. Comprison of gene expression etween nontrnsfected control nd trnsfected rteries ws derived y sutrcting control ΔCt from the trnsfected ΔCt vlue, producing ΔΔCt. Reltive gene expression ws clculted s 1/(2 ΔΔCt ), therey stndrdizing the dt to the nontrnsfected control rteries from the sme rt. Anlyses of Tmem16 splice vrints Primers used for mplifiction of different frgments of Tmem16 re listed in Tle 1. The PCR products otined from rt mesenteric rtery nd ort cdna were sequenced (Eurofins MWG Operon, Germny) nd ligned with the predicted mrna sequence using CLC io-softwre (CLC io, Denmrk). Quntifiction of TMEM16A protein expression single-cell immunofluorescence Single SMCs for single-cell immunofluorescence nd voltge-clmp studies were isolted from rt mesenteric smll rteries s descried previously [2]. Briefly, rtery segments were dissected out, opened longitudinlly, nd plced in ppin digestion solution t 4 C overnight. The ppin digestion solution contined the following (in mm): NCl 11, KCl, MgCl 2 2, KH 2 PO 4., NH 2 PO 4., NHCO 3 1, CCl 2.16, EDTA.49, N-HEPES 1, glucose 1, turine 1, s well s 1. mg/ml ppin, 1.6 mg/ml lumin, nd.4 mg/ml dl-dithiothreitol; ph ws djusted to 7.. Digestion ws completed the next morning y heting the smple to 37 C for 2 min. Single cells were relesed y triturtion with polyethylene pipette. ThesingleSMCswerefixtedwith4%formldehyde (in phosphte-uffered solution (PBS)) for 1 min. After wshing, unrected fixtive ws quenched with 2 mm glycine in PBS nd cells were permeilized with.1 % Triton-X in PBS. Susequently, the cells were incuted with.1 % Triton-X in PBS solution contining the primry ntiody rised ginst TMEM16A (prediluted 3213 ntiody, Acm, UK) for 2 h t room temperture. The cells were then wshed nd incuted in the drk with Alex Fluor 488-conjugted secondry ntiody for 4 min t room temperture (Invitrogen, USA). After wshing, the preprtion ws trnsferred to the confocl microscope. After excittion t 488 nm, the emission signl (LP 3 nm) ws recorded nd stored on the computer for lter nlyses of fluorescence intensity using ImgeJ (NIH, USA). All recordings were mde with the sme microscope settings. No stining ws detected in preprtions treted with only secondry ntiody without primry ntiody (not shown). The intensity of TMEM16A-downregulted SMCs ws normlized to the level in cells isolted from rteries trnsfected with egfp-sirna.

5 Pflugers Arch - Eur J Physiol (214) 466: Voltge-clmp recordings of memrne currents All experiments were mde t room temperture (22 24 C). Ptch pipettes were prepred from orosilicte glss (PG1OT-7.; Hrvrd Apprtus), pulled on P-97 puller (Sutter Instrument Co.) nd fire-polished to chieve tip resistnces in the rnge of 1 MΩ. Recordingsweremde with n Axoptch 2B mplifier (Axon Instruments, Inc.) in whole-cell configurtion s descried previously [2, 27]. Dt were smpled t rte of 2 khz nd filtered t 1 khz. Dt cquisition nd nlysis were done with the softwre pckge Clmpex 7 for Windows (Axon Instruments, Inc.). Series resistnce nd cpcitive current were routinely compensted. C 2+ -ctivted Cl currents were mesured t holding potentil of 6 mv. The C 2+ -ctivted currents were evoked y ptch pipette solution contining the following (in mm): 14 CsCl,. C(OH) 2,.1 MgATP, 6 EGTA, nd 1 HEPES, t ph 7.3 (free clcium concentrtion 9 nm, estimted using WEBMAXC v (Chris Ptton, Stnford University, USA)) [27]. The th solution contined the following (in mm): 14 CsCl,.1 CCl 2, nd 1 HEPES, t ph 7.4. In ccordnce with our previous findings [2, 26], 1mMBCl 2 nd 1 nm chrydotoxin were included in ll th solutions to prevent the ctivtion of outwrd current y niflumic cid [14]. The current voltge (I V) reltionship ws determined y stepping the potentils (2 mv increments) etween 6 nd +6 mv, mintining the voltge t ech step for 1, ms. Sustined current mplitudes were verged for ech step. We compred the cgmp-dependent nd the cgmpindependent C 2+ -ctivted Cl currents from the sme cells sed on differences in their chrcteristics [2 27]: 1 μm niflumic cid, 3 μm of the memrne-permele cgmp nlog 8Br-cGMP, nd 1 μmzn 2+ were used s indicted to chrcterize the currents. We isolted the niflumic cidsensitive cgmp-independent C 2+ -ctivted Cl current nd the cgmp-dependent C 2+ -ctivted Cl current y sutrctions of the current fter ppliction of inhiitor (niflumic cid nd ZnCl 2, respectively) from the current efore these gents were dded [26]. Currents were normlized to cell cpcitnces. The current slope conductnces were evluted s the slope of the I V reltionship of corresponding current. Nonselective ctionic current (I NSC ) ws recorded s descried elsewhere [32]. SMCs were isolted y ppin digestion nd thed in the solution contining the following (in mm): 126 NCl, 6 KCl, 2 CCl 2, 1.2 MgCl 2,14glucose, nd 1. HEPES, ph djusted to 7.2 with NOH. Before I NSC recording, this th solution ws replced with Cs + -rich solution contining the following (in mm): 12 CsCl, 12 glucose, nd 1 HEPES, ph djusted to 7.2 with CsOH. The pipette solution SMCs were dilyzed to evoke I NSC current which contined the following (in mm): 8 CsCl, 1 MgATP, 1 N 2 GTP, cretinine, 2 glucose, 1 HEPES, 1 BAPTA (1,2-is(2-minophenoxy)-ethne-N,N,N,N -tetrcetic cid), nd 4.6 CCl 2 (free [C 2+ ] i estimted to 1 nm), ph djusted to 7.2 with CsOH. Upon formtion of whole cell, the memrne voltge ws held t mv nd the chnges in memrne current were recorded. The current voltge (I V) reltionship ws determined y 2 ms voltge rmp from 9 to +9 mv. The rmp ws repeted every 1 s. I NSC ws evoked y dilyzing SMCs with 4 μm GTPγS in the pipette solution s descried previously [32]. Omission of GTPγS from the pipette solution (not shown) prevents I NSC development. At the end of the experiment, I NSC ws inhiited y 1 μm GdCl 3. Isometric force Trnsfected or nontreted second to third order segments of the mesenteric rtery were dissected out nd clened of connective tissue in ice-cold slt solution (PSS). The clened rteril segments were mounted in n isometric wire myogrph (Dnish Myo Technology A/S, Denmrk) s descried previously [2, 3]. The myogrph chmer ws heted to 37 C, while the PSS ws constntly erted with %CO 2 in ir. Force ws recorded with PowerL 4/2 nd Chrt7 dt cquisition system (ADInstruments Ltd., New Zelnd) nd converted to wll tension y dividing force with doule segment length. Concentrtion response reltionships were constructed y cumultive NA (.1 3 μm) or rginine vsopressin (AVP,.1 1 nm) ddition. Additionlly, the response to 1 mm cffeine nd 124 mm K + ws tested. Vsomotion ws nlyzed t the level of NA tone where the mplitude ws highest, i.e., pproximtely % of mximl tone [3] for oth the in vitro nd the in vivo experiments. Vsomotion ws nlyzed in Chrt7 (ADInstruments Ltd., New Zelnd) y spectrum nlysis. Simultneous mesurements of isometric force nd intrcellulr clcium Simultneous mesurements of isometric force nd intrcellulr C 2+ were performed s descried previously [28, 29]. Arteries in the isometric myogrph were loded with 2. μm Fur-2 (Fur-2, AM; Invitrogen) in loding uffer (finl th concentrtion.4%dmso,.16%pluronicf127,.8 % Cremophor EL) for two consecutive 3-min periods t 37 C. Fur-2-loded preprtions were investigted on the stge of n Olympus IX7 microscope equipped with n Olympus LUCPlnFL N 2 ojective (N.A..4) nd n EsyRtioPro fluorescence imging system (Photon Technology Interntionl, NJ, USA). The rteries in the isometric myogrph were exited t 34 nd 38 nm nd

6 1396 Pflugers Arch - Eur J Physiol (214) 466: emission ws recorded t 1 nm. Concentrtion response reltionships were constructed y cumultive NA (.1 3 μm) ddition to the myogrph th. Responses to 1 mm cffeine nd 6 mm K + were tested. K + response ws performed fter pre-incution with 1 μm phentolmine. At the end of the experiment, the K + response ws recorded fter incution with 1 μm nifedipine. Bckground fluorescence (fter quenching with 2 mm MnCl 2 ) ws determined t the end of ech experiment nd sutrcted. Intrcellulr C 2+ ([C 2+ ] i ) ws expressed from 34/38 fluorescence rtio, normlized to men 34/38 fluorescence rtio in egfptrnsfected rteries in the presence of 1 μm NA. Memrne potentil The rteril segments were mounted s descried ove in the isometric myogrph. Intrcellulr recordings of memrne potentil were otined using glss KCl-filled microelectrodes with resistnce in the rnge of 4 1 MΩ s previously descried [29]. A reference electrode (Ag AgCl) ws plced in the myogrph th. Electrode resistnce ws routinely compensted y lncing the Whetstone ridge of the mplifier (Intro-71, WPI) efore implements. Solutions nd chemicls The PBS for tissue isoltion in immunohistochemicl studies contined the following (in mm): 137 NCl, 2.7 KCl, 8.2 N 2 HPO 4, nd 1.8 KH 2 PO 4, t ph 7.4. The PSS for myogrph studies contined the following (in mm): 119 NCl, 4.7 KCl, 1.18 KH 2 PO 4,1.17MgSO 4,2NHCO 3,1.6CCl 2,.26 EDTA, nd. glucose, gssed with % CO 2 in ir nd djusted to ph 7.4. In solutions with incresed K + concentrtion, NCl ws sustituted with equimolr KCl. Complete Mini, EDTA-free protese inhiitor cocktil ws supplied from Roche Applied Science (Germny). Chrydotoxin ws purchsed from Ltoxn (Frnce). All other chemicls were purchsed from Sigm Aldrich (Denmrk). Dt nlysis All dt re presented s men vlues±sem. Differences etween mens were tested y one-wy ANOVA followed y Bonferroni posttest or y t test where pproprite. P <. ws considered significnt nd n refers to the numer of rts. Results BODIPY-przosin stining of α1-drenergic receptors in the rteril wll Freshly dissected rteries were loded for 9 min t room temperture (in the drk) in PSS contining 1 nm BODIPY -FL-przosin (B-7433, Life Technologies) in humidified chmer gssed with % CO 2 in ir. After loding, the rteries were wshed with PSS nd mounted on slides for imging with LSM Pscl confocl microscope (Zeiss) using 4 wter immersion lens. BODIPY-przosin ws excited y 488 nm rgon lser nd emitted light etween nd 3 nm recorded. The pinhole, gin, nd lser excittion settings remined constnt for ll the experiments. A Z-stck (1 μm imge steps) ws constructed in severl loctions of the rtery wll. A corresponding differentil interference contrst imge ws mde for ech section. Dt were nlyzed y loclizing the internl elstic lmin (utofluorescence) in the Z-stck nd nlyzing the Z-imge 4 μm ove this (denoted SMC-IL). In similr fshion, Z- stck imge 4 μm under the dventiti order ws nlyzed (denoted SMC-OL). The verge re nlyzed for ech imge ws 1, μm 2. Ech rtery ws nlyzed in severl loctions to provide single verge vlue for SMC-IL nd SMC-OL. Control experiments performed with preincution with 1 μm przosin for 3 min prior to incution with 1 nm BODIPY-przosin confirmed specificity of inding to α1-drenoceptors (dt not shown). Two splice vrints of Tmem16 re expressed in rt mesenteric smll rteries nd in ort Frgments of two splice vrints of Tmem16 were mplified from cdna prepred from rt mesenteric rtery RNA. Susequent sequencing confirmed these frgments to e prt of Tmem16 gene product. Mesenteric smll rteries expressed c (deletion of exon 1) or cd (deletion of exon 6) splice vrints in ccordnce with the nomenclture suggested previously [11] (Fig. 1). The primers spnning segment did not mplify ny PCR product. Amplifiction nd sequencing of cdna from rt ort identified the sme two splice vrints (not shown). In vivo trnsfection of rt mesenteric smll rteries with Tmem16-siRNA downregultes the expression of TMEM16A Successful downregultion of Tmem16 3 dys fter trnsfection with Tmem16-siRNA trgeting exon 23 ws confirmed t the mrna level. Tmem16 mrna ws significntly reduced y Tmem16-directed sirna in comprison with the controls: nontrnsfected rteries, rteries trnsfected with mutted Tmem16-siRNA, nd rteries trnsfected with egfp-trgeted sirna (Fig. 2). No significnt difference in Tmem16 expression ws found

7 Pflugers Arch - Eur J Physiol (214) 466: Segment Segment Segment c Segment d Vrint cd Vrint c Fig. 1 Splice vrints of Tmem16 expressed in rt mesenteric smll rteries. Predicted exon structure of rt Tmem16. Exons corresponding to frgments,, c, nd d [11, 12] re indicted. Splice vrints found in rt mesenteric smll rteries re presented. These splice vrints omit either exon 6 or exon 1 corresponding to or d frgments of the protein, respectively. Segment ws not detected nd ll vrints contined segment c etween nontrnsfected control nd rteries trnsfected either with mutted sirna or with egfp-sirna. When Tmem16-siRNA-2 which trgets nother exon (exon 22) ws used for rteril trnsfection, Tmem16 mrna ws lso significntly reduced (24.9±.3 % of the level in nontrnsfected rteries; P =.12, n =4) in comprison with egfp-trget sirna-trnsfected rteries (117.±18.6 %). The effectiveness of trnsfection ws lso vlidted t the protein level using immunorectivity ginst TMEM16A in freshly isolted SMCs (Fig. 2, c). There ws no significnt difference in TMEM16A protein expression etween SMCs isolted from rteries trnsfected with egfp-trgeted sirna nd nontrnsfected rteries. Trnsfection with Tmem16siRNA significntly reduced TMEM16A protein expression in comprison with SMCs isolted from rteries trnsfected with egfp-trgeted sirna (Fig. 2). Downregultion of TMEM16A suppressed lso mrna expression of estrophin-1 (26.4±1.9 vs. 9.8±8.1 % in egfp-sirna-trnsfected rteries, P =.9, n =4), estrophin-2 (7.8±6.1 vs. 1.±. %, P =.4, n =3), nd estrophin-3 (14.7±. vs. 11.8±1. %, P =.2, n =). TMEM16A downregultion suppresses C 2+ -ctivted Cl currents in smooth muscle cells In ccordnce with previous reports [2 27, 37], SMCs freshly isolted from rteries trnsfected with nonrelted sirna expressed two C 2+ -ctivted Cl conductnces, the clssicl, niflumic cid-sensitive I Cl(C) nd the cgmpdependent, Zn 2+ -sensitive I Cl(C) (Fig. 3). SMCs dilyzed with intrcellulr solution contining 9 nm free C 2+ hd voltge- nd time-dependent current which ws significntly suppressed y 1 μm niflumic cid (Fig. 3, ). The iophysicl nd phrmcologicl chrcteristics of this niflumic cid-sensitive I Cl(C) re indistinguishle from those previously descried for the clssicl I Cl(C) [2 27]. The ddition of 8Br-cGMP, memrne-permele nlog of cgmp, in the presence of niflumic cid elicited second voltge- nd time-independent current, which ws inhiited y 1 μm Zn 2+ (Fig. 3, ). This current corresponds to the cgmp-dependent, Zn 2+ -sensitive I Cl(C) (Fig. 3c) chrcterized previously [2 27]. SMCs isolted from the rteries trnsfected with nonrelted sirna hd C 2+ -ctivted Cl conductnces similr to those in nontrnsfected SMCs. There ws no significnt difference in the niflumic cid-sensitive I Cl(C) or the Zn 2+ -sensitive I Cl(C) recorded from these two types of SMCs (dt not shown). Both of these I Cl(C) were, however, significntly diminished y TMEM16A downregultion (Fig. 3 c). The whole-cell slope conductnces of the niflumic cid-sensitive I Cl(C) nd the Zn 2+ -sensitive I Cl(C) were significntly reduced in SMCs downregulted for TMEM16A in comprison with the control (Fig. 3c). TMEM16A downregultion suppresses NA-induced contrction in vivo nd inhiits dimeter oscilltions There ws no difference etween dimeters of fully relxed rteries (pssive dimeters) either trnsfected with egfptrgeted sirna or downregulted for TMEM16A (Fig. 4). Nonstimulted rteries of oth groups hd similr sl tone in vivo efore NA ws pplied (12± vs. 21±6 % for egfpsirna trnsfected nd downregulted for TMEM16A rteries, respectively; n =). NA constricted egfp-sirna in concentrtion-dependent mnner ( logec ws 6.32±.16, n =;Fig.4, ). Arteries downregulted for TMEM16A hve smll responses to NA (Fig. 4, c). All rteries trnsfected with sirna-trgeted egfp (n =) produced rhythmic oscilltions in the inner dimeter when stimulted with NA (Fig. 4, d). Two out of seven rteries downregulted for TMEM16A did not oscillte in dimeter in

8 1398 Pflugers Arch - Eur J Physiol (214) 466: reltive Tmem16 mrna expression, % 1 1 Mutted sirna egfp sirna Tmem16 sirna reltive TMEM16A, protein expression % 1 1 egfp sirna Tmem16 sirna c egfp-sirna Tmem16-siRNA Fig. 2 Downregultion of Tmem16 expression y in vivo trnsfection of mesenteric smll rteries with sirna directed ginst Tmem16 (Tmem16-siRNA). Reltive level of Tmem16 mrna expression in rteries trnsfected with Tmem16-siRNA, with mutted form of Tmem16-siRNA (mutted sirna) or sirna directed ginst egfp (egfp-sirna). Tmem16 expression ws normlized to two housekeeping genes, GAPDH nd TFRC, nd ws set to 1 % in nontrnsfected rteries isolted from the sme rt. n =6, P <.1. TMEM16A protein expression (quntified y immunofluorescence) ws significntly reduced in SMCs isolted from rteries trnsfected with Tmem16-siRNA in comprison with SMCs trnsfected with nonrelted sirna. Results verged from 43 to 69 cells isolted from egfp-sirna nd Tmem16-siRNA-trnsfected rteries (pired) from three rts; P <.1.c Representtive exmples for the experiments shown in.smcs were isolted from mesenteric smll rteries segments trnsfected with egfp-sirna (left pnel) nd Tmem16-siRNA (right pnel) nd stined with TMEM16A ntiody. Fluorescence of cells incuted with only secondry ntiody nd without primry ntiody ws set s ckground. The sme settings were used for ll recordings. Brs indicte 2 μm the presence of NA. The remining five TMEM16Adownregulted rteries oscillted irregulrly nd with significntly reduced mplitude (Fig. 4c, d). TMEM16A contriutes to the gonist-induced contrction of isolted mesenteric smll rteries in vitro Pssive inner dimeters were not different etween the groups of isolted rteries in vitro (Tle 2). When ctive wll tension ws compred, the rteries downregulted for TMEM16A hd reduced gonist-induced contrction in comprison with nontrnsfected rteries nd rteries trnsfected with nonfunctionl sirna (Fig. ). Thus, NA concentrtion response curves indicted significntly reduced sensitivity to the gonist nd suppressed mximl contrctile responses in TMEM16A-downregulted isolted rteries (Fig., ; Tle 2). Surprisingly, rteries trnsfected with mutted, nonfunctionl sirna were more sensitive to NA in comprison with nontrnsfected rteries (Tle 2). This ws not consequence of the trnsfection procedure since the contrctile responses of egfp-sirna-trnsfected isolted rteries were not different from the responses of nontrnsfected isolted rteries (Fig. c; Tle2). Trnsfection with nother Tmem16-siRNA-2 hd functionl consequences similr to those with Tmem16siRNA. Thus, Tmem16-siRNA-2 trnsfection significntly (P =.8) suppressed contrctile responses to 3 μm NA 3.82±.4, 3.1±.14, nd 1.98±.36 N/m (n =4) for nontrnsfected rteries, rteries trnsfected with egfpsirna, nd with Tmem16-siRNA-2, respectively. Elevtion of the extrcellulr K + concentrtion (2 mm) potentited the contrctile responses to NA in ll three experimentl groups ut did not modify the difference etween the responses of the groups (Fig. 6). Thus, isolted rteries trnsfected with Tmem16-siRNA were still less sensitive to NA with reduced mximl contrctile response to NA in comprison with oth nontrnsfected rteries nd rteries trnsfected with nonfunctionl sirna (Fig. 6; Tle 2). The mximl contrctile response to AVP ws lso reduced in isolted rteries trnsfected with Tmem16-siRNA in comprison with nontrnsfected rteries nd the rteries

9 Pflugers Arch - Eur J Physiol (214) 466: Fig. 3 TMEM16A downregultion suppresses oth the niflumic cid-sensitive nd the Zn 2+ -sensitive C 2+ -ctivted Cl currents in SMCs isolted from rtmesentericsmllrteries trnsfected with Tmem16siRNA in vivo. Representtive recordings from SMCs trnsfected with sirna directed ginst egfp (egfp-sirna) or with Tmem16-siRNA. Memrne currents were recorded y stepping holding voltge etween 6 nd +6 mv with 2 mv increments. Memrne currents were consequently recorded under control conditions, fter incution with 1 μm niflumic cid, 3 μm 8Br-cGMP,nd 1 μm ZnCl 2, s indicted. Averged current voltge chrcteristics for the niflumic cid (NFA)-sensitive nd the Zn 2+ -sensitive C 2+ -ctivted Cl currents clculted from the experiments similr to those shown in. c The whole-cell slope conductnces (etween 2 nd +2 mv) of two currents in mesured in SMCs trnsfected with either sirna directed ginst egfp (egfp-sirna) or with Tmem16-siRNA. n =9 13; P <.1 Tmem6-siRNA egfp-sirna current, pa 1 µm niflumic cid voltge, mv -1 3 µm 8Br-cGMP c slope conductence, ns NFA-sensitive C 2+ -ctivted Cl - current 1 µm ZnCl 2 Zn 2+ -sensitive C 2+ -ctivted Cl - current -1-2 NFA-sensitive C 2+ -ctivted Cl - current egfp-sirna Zn 2+ -sensitive C 2+ -ctivted Cl - current egfp-sirna NFA-sensitive C 2+ -ctivted Cl - current Tmem16-siRNA Zn 2+ -sensitive C 2+ -ctivted Cl - current Tmem16-siRNA egfp-sirna Tmem16-siRNA trnsfected with nonfunctionl sirna: lthough no significnt difference in sensitivity to AVP etween rteries trnsfected with Tmem16-siRNA nd nontrnsfected rteries ws oserved (Fig. 7). Similr to NA-stimulted rteries, the rteries trnsfected with mutted nonfunctionl sirna were more sensitive to AVP thn nontrnsfected nd TMEM16Adownregulted rteries (Fig. 7; Tle 2). The trnsfection with egfp-sirna did not ffect contrctile responses to AVP or gonist sensitivity when compred with nontrnsfected rteries (Fig. 7c). The contrctile response to 124 mm K + in the presence of 1 μm phentolmine ws significntly reduced in isolted rteries trnsfected with Tmem16-siRNA in comprison with nontrnsfected rteries nd rteries trnsfected with mutted Tmem16-siRNA (Tle 2). The response to K + depolriztion ws lso significntly reduced (P =.8) in rteries trnsfected with Tmem16-siRNA-2 (1.21±.23 N/ m, n =4) in comprison with nontrnsfected rteries (2.47±.4 N/m) nd rteries trnsfected with egfp-sirna (2.48±.28 N/m). In contrst, the contrctile responses to 1 mm cffeine, to evoke relese of C 2+ from cffeine-sensitive intrcellulr stores, were not different etween the groups. Both Tmem16-siRNA (Tle 2) nd Tmem16-siRNA-2 (.39±.8,.39±.7, nd.36±.6 N/m for nontrnsfected, trnsfected with egfp-sirna, nd Tmem16-siRNA-2

10 14 Pflugers Arch - Eur J Physiol (214) 466: Fig. 4 Mesenteric smll rteries in vivo respond to exogenous NA with chnges in rteril inner dimeter: mtched egfp-sirna nd Tmem16-siRNAtrnsfected rteries from the sme rt were compred. Averged inner dimeters of rteries trnsfected with egfp-sirna nd Tmem16-siRNA nd their chnges in response to NA. n =7, P <.. Representtive curves showing the inner dimeter chnges in response to NA of egfp-sirna-trnsfected rtery () ndtmem16-sirnatrnsfected rtery in vivo (c). d The distriution of vsomotion mplitudes over oscilltion frequencies. Hz for egfpsirna-trnsfected rteries (n =7) nd Tmem16-siRNAtrnsfected rteries in vivo (two out of seven rteries did not oscillte nd were therefore not included in the nlysis; n =). P <. inner dimeter, µm non-stimulted log[na], M [NA], M: µm 1 min c Tmem16-siRNA GFP-siRNA pssive dimeter [NA], M: µm 1 min d Amplitude of oscilltions, µm Tmem16-siRNA GFP-siRNA Frequency of oscilltions, Hz rteries, respectively; n =4) trnsfections hd no effect on cffeine-induced contrction. No difference in relxtion to 1 μm cetylcholine ws found etween the groups, suggesting tht endothelil function ws unffected y the trnsfections (Tle 2). Reduced memrne depolriztion in TMEM16A-downregulted rteries No difference in the resting memrne potentils of SMCs in rteries trnsfected with egfp-sirna nd TMEM16Adownregulted rteries ws found (Fig. 8). NA stimultion depolrized the SMCs in oth groups; however, the NAinduced depolriztion ws significntly reduced in TMEM16A-downregulted rteries compred with egfpsirna-trnsfected rteries (Fig. 8). In contrst, elevtion of extrcellulr K + to 6 mm eqully depolrized the memrne potentil in TMEM16A-downregulted rteries nd egfpsirna-trnsfected rteries. Interestingly, while the SMCs in these rteries produced similr depolriztion to K +, the TMEM16A-downregulted rteries still hd reduced contrctile response in comprison with egfp-sirnatrnsfected rteries (Fig. 8). The contrctile response to K + - induced depolriztion ws completely locked y 1 μm nifedipine in ll experimentl groups (dt not shown).

11 Pflugers Arch - Eur J Physiol (214) 466: Tle 2 Functionl chrcteristics of rteries in isometric experiments. In one group of experiments, we compred three different groups of rteries from the sme rts: Tmem16-siRNA-trnsfected rteries, rteries trnsfected with mutted sirna, nd nontrnsfected rteries. In other experiments, only egfp-trnsfected rteries nd nontrnsfected rteries from the sme rts were compred Rts trnsfected with Tmem16-siRNA nd mutted sirna (n =7) Rts trnsfected with egfp-sirna (n =3) Nontrnsfected Tmem16-siRNA Mutted sirna Nontrnsfected egfp-sirna ID (μm) 297± 3±1 29±11 33±11 297±7 logec NA.68±.7.27±.6,### 6.24±.4.87±.8.82±.14 logec AVP 4.99± ±.9 #.2±.7.12±..7±.1 logec NA+2 mm K +.91±.6.72±.11,### 6.32±.8 Mx NA, N/m.88±.4 2.3±.,## 4.72± ± ±.97 NA+2 mm K +, N/m.7±.4 2.2±.4,# 4.±.46 Mx AVP, N/m.16± ±.44,#.73±. 4.86± ±.79 Mx K +, N/m.4± ±.44,# 4.2±. Cffeine, N/m.7±.1.6±.6.76±.11 Relxtion to ACh, % 68.1± ± ± ± ±.21 ID inner dimeter, NA nordrenline, AVP rginine vsopressin, ACh cetylcholine P <., P <.1, P <.1 vs. nontrnsfected rteries; # P <., ## P <.1, ### P <.1 vs. rteries trnsfected with mutted, nonfunctionl sirna TMEM16A downregultion does not ffect the expression of α1-drenergic receptors The mrna levels of different isoforms of α1-drenergic receptors expressed in the rteril wll of rt mesenteric smll rteries were not ffected y Tmem16-siRNA trnsfection nd were not significntly different from those in rteries trnsfected with egfp-sirna (Fig. 9). The locliztion of α1-drenergic receptors with BODIPY-przosin stining (Fig. 9, c) did not revel ny significnt difference in the intensity of stining etween nontrnsfected rteries nd rteries trnsfected with egfp-sirna nd Tmem16-siRNA. Nonselective ctionic current is unffected y TMEM16A downregultion Intrcellulr injection of the G-protein ctivtor GTPγS in freshly isolted SMCs uncouples the ctivtion of G- proteins from gonist receptor stimultion nd induces nonselective ctionic memrne current (I NSC ). The I NSC reched pek 3 7 min fter reking the ptch memrne nd the SMC dilyzed with GTPγS in the whole-cell voltgeclmp configurtion (Fig. 1). This I NSC ws sensitive to nonselective inhiition with micromolr ppliction of GdCl 3. There ws no significnt difference etween current voltge dependencies of GTPγS-evoked I NSC in SMCs isolted from nontrnsfected rteries nd rteries trnsfected with either egfp-sirna or Tmem16-siRNA (Fig. 1). NA-induced [C 2 ] i + increse is reduced in TMEM16A-downregulted rteries TMEM16A-downregulted rteries hd suppressed [C 2+ ] i chnges in response to NA stimultion in comprison with egfp-sirna-trnsfected rteries (Fig. 11). The slopes of the reltion etween NA-induced contrction nd [C 2+ ] i increse were not different etween the groups indicting tht C 2+ sensitivity ws not ffected (Fig. 11). In contrst, the increse of [C 2+ ] i following relese of C 2+ from the srcoplsmic reticulum with 1 mm cffeine ws similr in ll experimentl groups (Fig. 11c). The [C 2+ ] i increse in response to elevted extrcellulr K + ws significntly reduced in TMEM16A-downregulted rteries in comprison with egfp-sirna-trnsfected rteries (Fig. 11c). The mrna levels for the vsculr L-type clcium chnnel (ccn1c, C V 1.2) in TMEM16A-downregulted rteries were reduced to 46 % of those in nontrnsfected rteries (Fig. 11d). No significnt chnges in ccn1c expression were detected in egfp-sirna-trnsfected rteries. Vsomotion in vitro is suppressed in TMEM16A-downregulted rteries Arteries stimulted with NA to develop out % of their mximl tone produce vsomotion (Fig. 12). A single TMEM16A-downregulted rtery (out of seven) filed to develop oscilltions. The mplitude of vsomotion in the six

12 142 Pflugers Arch - Eur J Physiol (214) 466: Fig. Downregultion of TMEM16A suppressed NAinduced contrctile response of isolted rt mesenteric rteries in vitro. Representtive trce for NA concentrtion response experiment. Concentrtion response to NA of TMEM16Adownregulted rteries, rteries trnsfected with mutted sirna, nd nontrnsfected rteries (n =7). c NA concentrtion contrction reltions of egfpsirna-trnsfected nd nontrnsfected rteries in vitro (n =3). P <., P <.1 Force, mn s [NA] (M): wshout Non-trnsfected Mutted-siRNA Tmem16-siRNA 7 c Tension, N/m Tension, N/m log[na], M log[na], M Non-trnsfected Mutted-siRNA Tmem16-siRNA GFP-siRNA TMEM16A-downregulted rteries displying oscilltions ws significntly reduced in comprison with nontrnsfected rteries, rteries trnsfected with mutted sirna, nd sirna directed ginst egfp (Fig. 12). The trnsfection procedure itself did not pprently lter vsomotion, since no significnt difference etween vsomotion mplitude nd frequency ws found in the three control groups of rteries. Discussion We find in this study tht the expression of TMEM16A is necessry for the two I Cl(C) present in vsculr SMC. Moreover, we hve found tht TMEM16A is n importnt modultor of gonist-induced contrction nd vsomotion in rt mesenteric smll rteries in vivo nd in vitro. Knockdown of TMEM16A with sirna reduces rteril contrction in two potentil wys: vi reduced depolriztion s might e expected for reduction of vsculr Cl chnnel nd, surprisingly, vi reduction of voltge-gted C 2+ chnnel expression in the SMC. TMEM16A s the SMC CCC We hve previously demonstrted tht vsculr SMCs hve two C 2+ -ctivted Cl conductnces [26]: the clssicl I Cl(C) nd the cgmp-dependent I Cl(C) with distinct phrmcologicl nd iophysicl properties [2, 27, 38, 39]. Downregultion of TMEM16A (confirmed t oth mrna nd protein levels) cused the clssicl I Cl(C) to dispper

13 Pflugers Arch - Eur J Physiol (214) 466: Tension, N/m log[na], M + 2 mm K + Non-trnsfected Mutted-siRNA Tmem16-siRNA Fig. 6 NA-induced contrctile response in the presence of 2 mm K + ws suppressed in TMEM16A-downregulted isolted rt mesenteric rteries in comprison with the rteries trnsfected with nonfunctionl sirna nd with nontrnsfected rteries (n =7). P <., P <.1 from SMCs: consistent with previous dt where the niflumic cid-sensitive I Cl(C) ws significntly reduced y ex vivo TMEM16A downregultion in SMCs from pulmonry [24] nd cererl rteries [4, 44, 46]. These findings tken together with the predominnt ner memrne locliztion of TMEM16A seen here nd the previous suggestions of TMEM16A s CCC [, 47] provide strong evidence tht TMEM16A constitutes the clssicl I Cl(C) in SMCs of mesenteric smll rteries. Unexpectedly, downregultion of TMEM16A lso led to disppernce of the cgmp-dependent I Cl(C). Importntly, this ws ccompnied y downregultion in estrophin-1, estrophin-2, nd estrophin3 mrna, indicting tht estrophin mrna regultion is influenced y TMEM16A expression. We hve previously seen tht specific downregultion of estrophin-3 lso downregultes estrophin-1 nd estrophin-2 in SMCs [27], mking it difficult to distinguish etween whether TMEM16A directly Fig. 7 Downregultion of TMEM16A reduced AVPinduced contrctile responses of isolted rt mesenteric smll rteries in vitro. Representtive trce of concentrtion response curve for AVP. Concentrtion response reltions for AVP of TMEM16A-downregulted rteries, rteries trnsfected with nonfunctionl sirna, nd nontrnsfected rteries (n =7). P <.. c Concentrtion response reltions for AVP of egfp-sirna-trnsfected nd nontrnsfected rteries (n =3) Force, mn s [AVP] (M): wshout Non-trnsfected Mutted-siRNA Tmem16-siRNA Tension, N/m c Tension, N/m log[avp], M log[avp], M Non-trnsfected Mutted-siRNA Tmem16-siRNA GFP-siRNA

14 144 Pflugers Arch - Eur J Physiol (214) 466: mv potentil, Memrne Resting 1 µm NA 6 mm K µm phentolmine egfp- sirna controls the expression of ll three estrophins or TMEM16A regultes one of them, which secondrily leds to downregultion of the others. Bsed on these findings, we suggest two possile models for interction etween TMEM16A nd estrophins. One possiility is tht one estrophin (or their comintion) forms the chnnel responsile for the cgmp-dependent I Cl(C) nd tht TMEM16A through regultion of estrophin expression is importnt for this current. Another possiility is tht the TMEM16A protein lone forms the chnnel pore for oth C 2+ -ctivted Cl conductnces, while ccessory suunits (e.g., estrophins) imprt the iophysicl nd phrmcologicl chrcteristics of cgmp-dependent I Cl(C) conducted y TMEM16A. Bestrophins hve previously een suggestedtointerctwithtmem16a[1] similr to the functionl nd moleculr interction etween the cystic firosis trnsmemrne regultor (CFTR) nd TMEM16A [33]. Future studies will determine the nture of these interctions. A potentilly importnt fctor contriuting to the vriility of CCC protein's physicl properties is the expression of different splice vrints. We found two splice vrints of TMEM16A in the lood vessels: rt ort nd Tmem16-siRNA Fig. 8 TMEM16A-downregulted rteries cn depolrize to the sme extent s egfp-sirna-trnsfected rteries ut they hve reduced contrctility. Memrne depolriztion to NA nd tone production in Tmem16-siRNA rteries ws lower in comprison with egfp-sirnatrnsfected rteries. Resting memrne potentil nd depolriztion to 6 mm K + were unchnged, ut force production to elevted extrcellulr K + is lso lower in Tmem16-siRNA rteries compred to egfp-sirna rteries (n =6 7). P <., P < Tension, N/m mesenteric smll rteries express the splice vrint c nd cd. We were unle to find products contining segment, while ll products contined segment c, which is importnt for voltge sensitivity [11]. Although the functionl significnce of segment d is unknown, segment hs een suggested to modulte the C 2+ sensitivity of the TMEM16A-ssocited CCC [11]. TMEM16A nd vsculr function In contrst to our expecttions, the mutted (four mismtching nucleotides) Tmem16-siRNA significntly potentited gonist-induced contrction. The cuse of this effect is not cler: no chnges in TMEM16A expression or Cl currents were seen fter trnsfection with mutted Tmem16-siRNA. Rt mesenteric rteries typiclly disply n incresed sensitivity to gonist(s) nd incresed mximl response if the endothelium hs een removed [1] or is poorly functioning; however, we did not find ny difference in the endothelium-derived relxtion elicited y cetylcholine etween the rtery groups. While this effect my not e ttriutle to n endothelil defect, it is nevertheless n offtrget effect of the mutted sirna since trnsfection with nonrelted egfp-sirna ws without effect on rteril contrctility. We found decresed contrctile responses to NA nd AVP in the isolted rteries downregulted for TMEM16A. To elucidte the mechnism for this, we mde n in-depth investigtion of the possile fctors involved in the reduced response to NA. Our findings tht the NA-induced depolriztion nd increse of [C 2+ ] i were reduced re consistent with CCCs eing importnt for memrne depolriztion nd force development [7, 18, 19, 21, 34 36, 41] nd the oservtion tht CCCs cn e ctivted y G- protein-coupled receptor stimultion [9, 19, 34, 4]. Our findings re lso consistent with recent report of TMEM16A in the cererl vsculr ed, where the pressureinduced depolriztion nd development of myogenic tone were reduced when TMEM16A ws knocked down ex vivo [4]. Furthermore, since the increse of [C 2+ ] i nd force development to cffeine were identicl in the two groups, it seems unlikely tht C 2+ relese nd/or ltertions in the contrctile proteins re contriuting to the reduced gonistinduced contrction. However, full sustitution of Cl with sprtte nd dissiption of the elevted intrcellulr Cl inhiits ll I Cl(C) ut is without sustntil effect on the sensitivity or mximl contrction to NA [2, 31]. Also downregultion of estrophin, which inhiits the cgmp-dependent I Cl(C), does not ffect the response to NA [3]. Finlly, the few studies tht hve tested the effect on the memrne potentil of the Cl grdient in NA-ctivted rteries hve detected only miniml effect [2, 31]. We therefore ssessed whether other prmeters of

15 Pflugers Arch - Eur J Physiol (214) 466: Reltive mrna expression, % 1 1 α1 α1 α1d Normlized men fluorescence intensity, % SMC-OL SMC-IL Tmem16-siRNA egfp-sirna c i ii iii Fig. 9 Downregultion of TMEM16A does not ffect the expression of α1-drenergic receptors. Reltive mrna level of α1, α1, nd α1d isoforms of drenergic receptors in rteries trnsfected with either Tmem16-siRNA or sirna directed ginst egfp (egfp-sirna). Tmem16 expression ws set to 1 % in nontrnsfected rteries isolted from the sme rt. n =4. No significnt difference etween the groups ws found. The verge intensity of BODIPY-przosin stining (representtive imges in c) in the SMCs of the outer lyer of the medi (SMC-OL) nd the inner lyer (SMC-IL) normlized to the intensity oserved in the nontrnsfected rtery (set to 1 %). No significnt difference etween nontrnsfected rteries nd rteries trnsfected with either Tmem16-siRNA or egfp-sirna ws found. c Representtive BODIPY-przosin stining of Tmem16-siRNA-trnsfected rteries (i), egfp-sirna-trnsfected rteries (ii), nd nontrnsfected rteries (iii) for BODIPY-przosin stining nd corresponding differentil interference contrst imge for the sme rtery. Scle r represents μm in ll imges importnce for NA-induced depolriztion nd force development were ffected. To evlute n effect on α1- drenoceptor expression, we mesured α1-receptor mrna nd fluorescent przosin inding ut found neither to e ffected y downregultion of TMEM16A. We lso mesured stimulted ction unspecific current which prticiptes in NAinduced depolriztion, ut gin found no difference in rteries downregulted for TMEM16A. An indiction tht other pthwys my e ffected cme from the highly surprising finding tht TMEM16A downregultion lso reduces force development to high extrcellulr K +. To provide mechnistic insight to this, we mesured memrne potentil nd [C 2+ ] i with high extrcellulr K +. While the memrne potentil ws similr, [C 2+ ] i ws lower in the rteries where TMEM16A ws downregulted. The ltter finding supports nd provides n explntion for the reduced force development. These findings could e explined y reduction of L-type C 2+ chnnel expression nd/or function in the SMCs: to test this possiility, we mesured mrna expression of the poreforming suunit of the L-type voltge-gted C 2+ chnnel nd found significnt reduction. The mechnism responsile for this effect of sirna directed ginst TMEM16A is s yet uncler, ut this finding suggests complicted functionl role for TMEM16A in vsculr tissues. It seems possile tht TMEM16A cts s multifunctionl protein, similr to CFTR, eing CCC in its own right s well s n importnt regultor of other