Supplemental data. Antibodies used for Flow Cytometry. BL = Biolegend (San Diego, CA), BD = BD Biosciences (San Jose, CA) PD-1 Panel
|
|
- Hugh Lindsey
- 5 years ago
- Views:
Transcription
1 Supplemental data Antibodies used for Flow Cytometry BL = Biolegend (San Diego, CA), BD = BD Biosciences (San Jose, CA) PD-1 Panel Brilliant Stain Buffer (BD Cat# ) CD3-BUV395 (BD Cat# ) CD4-BV65 (BL Cat# ) CD8-BV711 (BL Cat# 3143) CD45RO-BV421 (BL Cat# 34223) CD197-FITC (BL Cat# ) CD62L-PE-Cy7 (BL Cat# 34821) CD95-APC (BL Cat# 35611) CD279-PE (BL Cat# 32995) HLA*DR-APC-Cy7 (BL Cat# 37617) CD38-PerCP-Cy5.5 (BL Cat# ) NK Panel Brilliant Stain Buffer (BD Cat# ) CD3-BUV395 (BD Cat# ) CD45-FITC (BD Cat# ) CD16-PE-Cy7 (BL Cat# 3216) CD56-BV421 (BL Cat# ) NKp44-APC (BL Cat# 32519) NKp3-BV711 (BD Cat# ) NKp46-PE (BD Cat# )
2 Monocyte Panel Brilliant Stain Buffer (BD Cat# ) CD3-BUV395 (BD Cat# ) CD19-BV65 (BL Cat# 32237) CD14-BV711 (BL Cat# 31837) CD16- PE-Cy7 (BL Cat# 3216) CD163-PE (Trillium Cat# CD P) CD56-BV421 (BL Cat# ) CD312-FITC (SeroTech Cat# MCA233F) CD97-APC (ebiosciences Cat # ) CD26-APC-Cy7 (BL Cat# 32112) CD38- PerCP-Cy5.5 (BL Cat# ) HLA*DR-APC-Cy7 (BL Cat# 37617)
3 Supplemental Figure 1. Hamilton Anxiety and Depression and Pittsburgh Sleep Quality Index Scores in HIV positive patients receiving aprepitant The Wilcoxon signed-rank test was used to determine whether within subject median change from day is significantly different than. P values are indicated on the graphs. The Hamilton Anxiety Scale The Hamilton Anxiety Scale p=.8 p=.3 Day Day 28 Day The Hamilton Depression The HAM-D 17 p=.6 Day Day 28 Day Pittsburgh Sleep Quality Index Score Pittsburgh Sleep Quality Index Score 15 1 p=.3 5 Day Day 28 Day
4 Supplemental Table 1A. Adverse events by subject (Number of adverse events), n (% of total individuals with adverse event) Subject 1 Subject 3 Subject 4 Subject 6 Subject 7 Subject 11 Subject 12 Total Any Serious Adverse Events Yes () () () () () () () () No 3 (1) 9 (1) 1 (1) 4 (1) 1 (1) 3 (1) 1 (1) 22 (1) Total 3 (1) 9 (1) 1 (1) 4 (1) 1 (1) 3 (1) 1 (1) 22 (1) Severity Mild () 6 (66.7) 1 (1) 1 (25.) 1 (1) 2 (66.7) 1 (1) 12 (54.5) Moderate 3 (1) 3 (33.3) () 3 (75.) () 1 (33.3) () 1 (45.5) Severe () () () () () () () () Total 3 (1) 9 (1) 1 (1) 4 (1) 1 (1) 3 (1) 1 (1) 22 (1) Supplemental Table 1B. Adverse events details by subject, n (%) Subject 1 Subject 3 Subject 4 Subject 6 Total Relationship to Medication Not related () () () 1 (25.) 1 (5.9) Possible 3 (1) 9 (1) 1 (1) 2 (5.) 15 (88.2) Unlikely () () () 1 (25.) 1 (5.9) Action Taken None 3 (1) 9 (1) 1 (1) 4 (1) 17 (1) Outcome Improved () 2 (22.2) () () 2 (11.8) Recovered/resolved 3 (1) 6 (66.7) 1 (1) 3 (75.) 13 (76.5) Unchanged () 1 (11.1) () 1 (25.) 2 (11.8) Ongoing No 3 (1) 8 (88.9) 1 (1) 3 (75.) 15 (88.2) Yes () 1 (11.1) () 1 (25.) 2 (11.8)
5 Supplemental Figure 2. Hemoglobin, hematocrit and RBC count in HIV positive patients receiving aprepitant Wilcoxon signed-rank test was used to determine whether within subject median change from day is significantly different than. Significant p values (<.5) are indicated on the graphs. Hemoglobin (g/dl) Hemoglobin levels p=.1 Day Day 14 Day 28 Day Hematocrit (%) Hematocrit levels p=.3 Day Day 14 Day 28 Day RBC (x1 6 cells/µl) RBC p=.2 Day Day 14 Day 28 Day Supplemental Figure 3. Platelets in HIV positive patients receiving aprepitant Wilcoxon signed-rank test was used to determine whether within subject median change from day is significantly different than. P values are indicated on the graph. platelets (x1 3 /µl) platelets p=.6 p=.2 p=.3 Day Day 14 Day 28 Day
6 Supplemental Figure 4. Changes in total bilirubin, alanine aminotransferase (ALT) and alkaline phosphatase (ALP) in HIV positive patients receiving aprepitant Results are presented as changes in marker levels between day and 14, day and 28 or day and 58 as indicated. Vertical bars are the widths of the 95% confidence intervals. P values by Wilcoxon signed-rank test are indicated on the plots. total bilirubin(mg/dl) p=.9 total bilirubin p=.1 p=.2 ALT (U/L) p=.9 ALT p=.8 p=.3 ALP (U/L) p=.2 ALP p=.3 p< day 14- day 28- day day 14- day 28- day day 14- day 28- day 58-
7 Supplemental Figure 5. Changes in CD4+ T-cell count in HIV positive patients receiving aprepitant Results are presented as changes in absolute CD4+ T-cell numbers between day and 14, day and 28 or day and 58 as indicated. Vertical bars are the widths of the 95% confidence intervals. P values by Wilcoxon signed-rank test are indicated on the plot. 4 CD4 p=.14 change in CD4 (cells per µl) p=.3 p=.6-6 day 14- day 28- day 58-
8 Supplemental Table 2. Viral loads by ultrasensitive HIV viral load assay in HIV positive patients receiving aprepitant HMMCgag (RNA copies/ml) PID Day Day 28 1 < <.75 < <.77 4 <.84 <.78 5 <.79 < < * 2.9 * * 11 <.93 < <.75 * HIV-1 DNA detected in controls without RT; values likely do not represent the true viral load.
9 Supplemental Figure 6. CD4+ Tcm and CD8+ Tcm in HIV positive patients receiving aprepitant Wilcoxon signed-rank test was used to determine whether within subject median change from day is significantly different than. P values are indicated on the graphs. CD4+ Tcm (%) CD4+ Tcm p=.2 p=.1 p=.8 Day Day 14 Day 28 Day CD8+ Tcm (%) CD8+ Tcm p=.7 p=.1 p=.1 Day Day 14 Day 28 Day
10 Supplemental Table 3. Complete list of proteins affected by aprepitant treatment. Likelihood ratio tests were performed using the ANOVA function of the car R package to calculate proteins that showed significant changes in their expression levels after treatment with aprepitant. The regression coefficient demonstrates both the direction and the magnitude of the change. False discovery rate (FDR) adjusted p-values that account for multiple comparisons are included in the table. Protein Name p-value regression coefficient FDR adjusted p-value Proteins with higher expression after aprepitant treatment Cathepsin.Z Complement.C Thioredoxin.domain.containing.protein Lysosomal.protective.protein Asialoglycoprotein.receptor Interleukin.1.receptor.like Leptin.receptor Vitamin.K.dependent.protein.C Vascular.endothelial.growth.factor.A Thyroid.Stimulating.Hormone Alpha.1.antitrypsin Cathepsin.F SPARC.like.protein CD29.antigen Protein.Z.dependent.protease.inhibitor Low.density.lipoprotein.receptor.related.protein.1.soluble Ectonucleoside.triphosphate.diphosphohydrolase Tenascin Hemojuvelin Dipeptidyl.peptidase Apolipoprotein.L Neutral.ceramidase Importin.subunit.alpha Carboxypeptidase.B Receptor.tyrosine.protein.kinase.erbB Arylsulfatase.B N.acylethanolamine.hydrolyzing.acid.amidase Complement.C5b.C6.complex Apolipoprotein.M Mannose.binding.protein.C Netrin Myeloperoxidase
11 Afamin Leucine.rich.repeats.and.immunoglobulin.like.domains.protein Coagulation.Factor.XI Ectonucleotide.pyrophosphatase.phosphodiesterase.family.member Trefoil.factor Carbohydrate.sulfotransferase Alpha.L.iduronidase X protein.sigma Coagulation.factor.VII Tyrosine.protein.kinase.receptor.TYRO Sex.hormone.binding.globulin Annexin.A Endoglin Cation.independent.mannose.6.phosphate.receptor Interleukin.1.receptor.type Antileukoproteinase Hepatocyte.growth.factor.receptor Apolipoprotein.E.isoform.E Tumor.necrosis.factor.receptor.superfamily.member X.ray.repair.cross.complementing.protein Fetuin.B Antithrombin.III Coagulation.Factor.V Serum.amyloid.P.component Repulsive.guidance.molecule.A Low.affinity.immunoglobulin.gamma.Fc.region.receptor.II.b Proprotein.convertase.subtilisin.kexin.type Apolipoprotein.B Dynactin.subunit Vesicular.integral.membrane.protein.VIP Prolactin Platelet.activating.factor.acetylhydrolase Low.density.lipoprotein.receptor.related.protein.1B Kallikrein Hepatocyte.growth.factor.like.protein Ficolin Histone.lysine.N.methyltransferase.EHMT Acid.sphingomyelinase.like.phosphodiesterase.3a Polymeric.immunoglobulin.receptor Tumor.necrosis.factor.ligand.superfamily.member.13B Troponin.I.cardiac.muscle Tumor.necrosis.factor.ligand.superfamily.member gp41.c34.peptide.hiv SLAM.family.member Prothrombin Tyrosine.protein.kinase.JAK GDNF.family.receptor.alpha Heparan.sulfate.6.O.sulfotransferase
12 Bone.morphogenetic.protein Superoxide.dismutase.Mn.mitochondrial Vascular.endothelial.growth.factor.receptor Lactadherin Dipeptidyl.peptidase C.C.motif.chemokine Thrombin C.type.lectin.domain.family.4.member.K Inter.alpha.trypsin.inhibitor.heavy.chain.H Serum.albumin Plasma.protease.C1.inhibitor Osteopontin Leucine.rich.repeat.transmembrane.protein.FLRT Complement.factor.H.related.protein Interleukin.1.alpha Small.nuclear.ribonucleoprotein.F Interleukin.13.receptor.subunit.alpha Cadherin Lymphatic.vessel.endothelial.hyaluronic.acid.receptor Endoplasmic.reticulum.resident.protein Toll.like.receptor Apolipoprotein.E.isoform.E Interleukin.1.receptor.type Iduronate.2.sulfatase Complement.component.C Proteins with lower expression after aprepitant treatment RNA.binding.protein Lymphocyte.activation.gene.3.protein Fibroblast.growth.factor Thrombospondin Prolyl.endopeptidase.FAP Complement.component.C1q.receptor Proto.oncogene.tyrosine.protein.kinase.receptor.Ret Angiogenin Contactin Casein.kinase.II.subunit.alpha C.type.mannose.receptor Complement.C3d.fragment B.cell.receptor.CD Transforming.growth.factor.beta Dermatopontin Insulin.like.growth.factor.I Alpha.2.HS.glycoprotein Cadherin Mitochondrial.import.inner.membrane.translocase.subunit.TIM Bcl.2.like.protein Interleukin.2.receptor.subunit.alpha
13 Collectin Matrix.extracellular.phosphoglycoprotein Caspase Tyrosine.protein.kinase.Lck Ephrin.type.B.receptor A.disintegrin.and.metalloproteinase.with.thrombospondin.motifs C.C.motif.chemokine Dickkopf.related.protein Killer.cell.lectin.like.receptor.subfamily.F.member X3.hydroxyacyl.CoA.dehydrogenase.type Kin.of.IRRE.like.protein Brain.natriuretic.peptide Resistin Interleukin.17.receptor.A Fibroblast.growth.factor.receptor Macrophage.metalloelastase Protein.SET Fibroblast.growth.factor Complement.factor.B DnaJ.homolog.subfamily.B.member Collagen.alpha.1.XXIII..chain Cyclin.dependent.kinase.1.G2.mitotic.specific.cyclin.B1.complex Serine.threonine.protein.kinase.17B Cell.adhesion.molecule.related.down.regulated.by.oncogenes Transforming.growth.factor.beta SLIT.and.NTRK.like.protein Interleukin Serum.paraoxonase.arylesterase Hexokinase High.affinity.nerve.growth.factor.receptor Junctional.adhesion.molecule.B Integrin.alpha.IIb.beta.3.complex Growth.differentiation.factor Stem.cell.growth.factor.alpha Brevican.core.protein Complement.C3b.inactivated Platelet.derived.growth.factor.subunit.A Estrogen.receptor Angiopoietin Serine.threonine.protein.kinase.PAK Protein.tyrosine.kinase Dual.specificity.mitogen.activated.protein.kinase.kinase Reticulon.4.receptor Galectin Interleukin.23.receptor Fibroblast.growth.factor Interleukin Peptidyl.prolyl.cis.trans.isomerase.F.mitochondrial
14 Advanced.glycosylation.end.product.specific.receptor.soluble Matrix.metalloproteinase
x Lymphocyte count /µl CD8+ count/µl 800 Calculated
% Lymphocyte in CBC A. 50 40 30 20 10 Lymphocyte count /µl B. x10 3 2.5 1.5 C. 50 D. 1000 % CD3+CD8+ Cells 40 30 20 Calculated CD8+ count/µl 800 600 400 200 10 0 #61 #63 #64 #65 #68 #71 #72 #75 Figure
More informationSupplementary Table e-1. Flow cytometry reagents and staining combinations
Supplementary data Supplementary Table e-1. Flow cytometry reagents and staining combinations Reagents Antibody Fluorochrome Clone Source conjugation CD3 FITC UCHT1 BD Biosciences CD3 PerCP-Cy5.5 SK7 Biolegend
More informationThe CAPRI-T was one of two (along with the CAPRI-NK, see reference. [29]) basic immunological studies nested within the CAMELIA trial.
1 SUPPLEMENTARY INFORMATION Patient description and recruitment The CAPRI-T was one of two (along with the CAPRI-NK, see reference [29]) basic immunological studies nested within the CAMELIA trial. Patients
More informationComprehensive evaluation of human immune system reconstitution in NSG. and NSG -SGM3 mouse models toward the development of a novel ONCO-HU
Comprehensive evaluation of human immune system reconstitution in NSG and NSG -SGM3 mouse models toward the development of a novel ONCO-HU xenograft model Aaron Middlebrook, 1 Eileen Snowden, 2 Warren
More informationBD Flow Cytometry Reagents Multicolor Panels Designed for Optimal Resolution with the BD LSRFortessa X-20 Cell Analyzer
Multicolor Panels Designed for Optimal Resolution with the BD LSRFortessa X-2 Cell Analyzer Proper multicolor panel design takes into account fluorochrome brightness, antigen density, co-expression, and
More informationSupplementary materials
Supplementary materials Table S Adverse events identified by participants diary logs and blood hematologic and biochemical tests (n=2) group (n=) Placebo group (n=) P value for chi-squared test Asthma
More informationUnderstanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationSupplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads
Supplementary Fig. 1: Ex vivo tetramer enrichment with anti-c-myc beads Representative example of comparative ex vivo tetramer enrichment performed in three independent experiments with either conventional
More informationSupplementary Data. Treg phenotype
Supplementary Data Additional Experiment An additional experiment was performed using cryopreserved peripheral blood mononuclear cells (PBMC) derived from five renal cell carcinoma (RCC) patients [see
More informationSupplementary Materials
Supplementary Materials 43 Figure S1. CD123 in acute lymphoblastic leukemia and leukemia-initiating cells. A. CD123 (histograms) is highly and homogenously expressed in B-ALL blasts (as defined by live,
More informationB and T-Cells. CD8+ Cytotoxic T Cells
Sony Biotechnology Inc. Application Data, SA38 Spectral Analyzer TBNK Panel Page 1 TBNK panel on the SA38 Spectral Analyzer TBNK (B-Cell, T-Cell, and natural killer cells) panels are frequently used to
More informationOnline supplement. Phenotypic, functional and plasticity features of classical and alternatively activated
Online supplement Phenotypic, functional and plasticity features of classical and alternatively activated human macrophages Abdullah Al Tarique*, Jayden Logan *, Emma Thomas *, Patrick G Holt *, Peter
More informationApplication Information Bulletin: Human NK Cells Phenotypic characterizing of human Natural Killer (NK) cell populations in peripheral blood
Application Information Bulletin: Human NK Cells Phenotypic characterizing of human Natural Killer (NK) cell populations in peripheral blood Christopher A Fraker, Ph.D., University of Miami - Miami, Florida
More informationSUPPORTING INFORMATIONS
SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor
More informationSupplementalgfigureg1gSchematicgdiagramgofgtumor1modellingg
SChinjectionh F:LuchLCLsh IVhinjectionh T:cellsh Monitorhforhtumorh growthhandhxeno: reactivehgvhd GVLgexperimentg kcbgvsgpbgt1cellse Xeno1reactiveg experimentg kcbgvsgpbgt1cellse IVhinjectionh 5xh,N^6
More informationSupplementary Table 1: Summary of Reactogenicity Events by Group and Time of Onset in Entebbe
Supplementary Table 1: Summary of Reactogenicity Events by Group and Time of Onset in Group A (n=39) B (n=11) A (n=39) B (n=11) Onset Post-Vaccination Event 3 Minutes 3-14 days Pain 5 (13%) 1 (1%) 6 (15%)
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationSupplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific
SUPPLEMENTARY FIGURE LEGEND Supplementary Figure 1. Enhanced detection of CTLA-4 on the surface of HIV-specific CD4 + T cells correlates with intracellular CTLA-4 levels. (a) Comparative CTLA-4 levels
More informationMAIT cell function is modulated by PD-1 signaling in patients with active
MAIT cell function is modulated by PD-1 signaling in patients with active tuberculosis Jing Jiang, M.D., Xinjing Wang, M.D., Hongjuan An, M.Sc., Bingfen Yang, Ph.D., Zhihong Cao, M.Sc., Yanhua Liu, Ph.D.,
More informationMed Chem 535P ~ Diagnostic Medicinal Chemistry. General Comments
Med Chem 535P ~ Diagnostic Medicinal Chemistry General Comments Most blood chemistry and serology assays are performed automatically. Larger clinical laboratories often use sophisticated analyzers that
More informationPrimary Adult Naïve CD4+ CD45RA+ Cells. Prepared by: David Randolph at University of Alabama, Birmingham
Primary Adult Naïve CD4+ CD45RA+ Cells Prepared by: David Randolph (drdrdr@uab.edu) at University of Alabama, Birmingham Goal: To obtain large numbers of highly pure primary CD4+ CD45RO- CD25- cells from
More informationCD25-PE (BD Biosciences) and labeled with anti-pe-microbeads (Miltenyi Biotec) for depletion of CD25 +
Supplements Supplemental Materials and Methods Depletion of CD25 + T-cells from PBMC. Fresh or HD precultured PBMC were stained with the conjugate CD25-PE (BD Biosciences) and labeled with anti-pe-microbeads
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationSupplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,
a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow
More informationA step-by-step approach to build and analyze a multicolor panel
Analyze A step-by-step approach to build and analyze a multicolor panel For Research Use Only. Not for use in diagnostic or therapeutic procedures. Alexa Fluor is a registered trademark of Life Technologies
More informationIL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
More informationThe Human Cathelicidin LL37 Peptide has High Plasma Levels in B and C Hepatitis Related to Viral Activity but not to 25-Hydroxyvitamin D Plasma Level
The Human Cathelicidin LL37 Peptide has High Plasma Levels in B and C Hepatitis Related to Viral Activity but not to 25-Hydroxyvitamin D Plasma Level SIMONA ALEXANDRA IACOB 1, EUGENIA PANAITESCU 2, DIANA
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More informationOptimizing Intracellular Flow Cytometry
Optimizing Intracellular Flow Cytometry Detection of Cytokines, Transcription Factors, and Phosphoprotein by Flow Cytometry Presented by Erika O Donnell, PhD, BD Biosciences 23-14876-00 Outline Basic principles
More informationInterleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma
Immunity Supplemental Information Interleukin-2-Dependent Allergen-Specific Tissue-Resident Memory Cells Drive Asthma Brian D. Hondowicz, Dowon An, Jason M. Schenkel, Karen S. Kim, Holly R. Steach, Akshay
More informationTables of Normal Values (As of February 2005)
Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1175194/dc1 Supporting Online Material for A Vital Role for Interleukin-21 in the Control of a Chronic Viral Infection John S. Yi, Ming Du, Allan J. Zajac* *To whom
More informationTable S1. Viral load and CD4 count of HIV-infected patient population
Table S1. Viral load and CD4 count of HIV-infected patient population Subject ID Viral load (No. of copies per ml of plasma) CD4 count (No. of cells/µl of blood) 28 7, 14 29 7, 23 21 361,99 94 217 7, 11
More informationSupplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers
Supplementary Table 1. Criteria for selection of normal control individuals among healthy volunteers Medical parameters Cut-off values BMI (kg/m 2 ) 25.0 Waist (cm) (Men and Women) (Men) 85, (Women) 90
More informationSupplementary Table 1
Supplementary Table 1 Flow Cytometry Antibodies Antibody Fluorochrome Clone Vendor CD45 PE-cyanine 7 30-F11 D ioscience CD3 Pacific lue 17A2 iolegend (San Diego, CA) CD11b APC M1/70 iolegend (San Diego,
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationEfficacy and safety of brexpiprazole for the treatment of acute. schizophrenia: a 6-week, randomized, double-blind, placebocontrolled
Supplementary material Efficacy and safety of brexpiprazole for the treatment of acute schizophrenia: a 6-week, randomized, double-blind, placebocontrolled trial Christoph U. Correll, M.D. 1, Aleksandar
More informationSupplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated
1 Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated (U) EGFR TL mice (n=7), Kras mice (n=7), PD-1 blockade
More informationNEW RCPCH REFERENCE RANGES-
s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3
More informationMonitoring Hepatitis C
Monitoring Hepatitis C Section Six Monitoring Hepatitis C Screening for hepatitis C is not routinely done, so you may have to request a test from your medical provider. This usually involves an antibody
More informationFluorochrome Panel 1 Panel 2 Panel 3 Panel 4 Panel 5 CTLA-4 CTLA-4 CD15 CD3 FITC. Bio) PD-1 (MIH4, BD) ICOS (C398.4A, Biolegend) PD-L1 (MIH1, BD)
Additional file : Table S. Antibodies used for panel stain to identify peripheral immune cell subsets. Panel : PD- signaling; Panel : CD + T cells, CD + T cells, B cells; Panel : Tregs; Panel :, -T, cdc,
More informationSupporting Materials for a 31-Day Study of Cobalt(II)chloride Ingestion in Humans: Pharmacokinetics and Clinical Effects
Supporting Materials for a 31- Study of Cobalt(II)chloride Ingestion in Humans: Pharmacokinetics and Clinical Effects Brent L. Finley a, Kenneth M. Unice b, Brent D. Kerger c, Joanne M. Otani a, Dennis
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationSupplementary Note Details of the patient populations studied Strengths and weakness of the study
Supplementary Note Details of the patient populations studied TVD and NCA patients. Patients were recruited to the TVD (triple vessel disease) group who had significant coronary artery disease (defined
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationAllergen-induced Increases in Sputum Levels of Group 2 Innate Lymphoid Cells. Guangzhou Medical University, Guangzhou, China.
Online Supplemental Data Title: Allergen-induced Increases in Sputum Levels of Group 2 Innate Lymphoid Cells in Asthmatic Subjects Authors: Ruchong Chen 1,2, Steven G Smith 1, Brittany Salter 1, Amani
More informationHepatitis C: Management of Previous Non-responders with First Line Protease Inhibitors
Hepatitis C: Management of Previous Non-responders with First Line Protease Inhibitors Fred Poordad, MD The Texas Liver Institute Clinical Professor of Medicine University of Texas Health Science Center
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationWelcome. Welcome. Emerging Technologies in Flow Cytometry
Emerging Technologies in Flow Cytometry Dr. William Dittman December 11, 2012 You may download a copy of the handout by clicking on the handout icon, located in the upper right hand corner of your screen
More informationBMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented
Supplemental Materials Figure S1. Cultured BMDCs express CD11c BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented with 15 ng/ml GM-CSF. Media was changed and fresh
More informationGlow. Save. Let it. and. Get a Discount of 10% BD Biosciences Year End Promotion on a huge Selection of Reagent Solutions
Let it Glow and Save BD Biosciences Year End Promotion 2014 Get a Discount of 10% on a huge Selection of Reagent Solutions All fluorochrome labeled antibodies The complete BD CBA portfolio Kits and reagents
More informationSupplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL
More informationJanuary 25, 2017 Scientific Research Process Name of Journal: ESPS Manuscript NO: Manuscript Type: Title: Authors: Correspondence to
January 25, 2017 Scientific Research Process Name of Journal: World Journal of Gastroenterology ESPS Manuscript NO: 31928 Manuscript Type: ORIGINAL ARTICLE Title: Thiopurine use associated with reduced
More informationSupplemental Figure 1. IL-3 blockade with Fab CSL362 depletes plasmacytoid dendritic cells (pdcs), but not basophils, at higher doses.
Supplemental Figure 1. IL-3 blockade with Fab CSL362 depletes plasmacytoid dendritic cells (pdcs), but not basophils, at higher doses. Percentage of viable (A) pdcs (Sytox Blue-, Lin1-, HLADR+, BDCA2++)
More informationSupplementary Figure S1. DD2 reactivity on human tonsils and analysis of slandc proliferation. Sections are from a representative human tonsil (a-f;
Supplementary Figure S1. DD2 reactivity on human tonsils and analysis of slandc proliferation. Sections are from a representative human tonsil (a-f; n=10) and a representative M- TDLN (g-h; n=5) and stained
More informationactivation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
More informationEvaluation of a Single-Platform Technology for Lymphocyte Immunophenotyping
CLINICAL AND VACCINE IMMUNOLOGY, Oct. 2007, p. 1342 1348 Vol. 14, No. 10 1556-6811/07/$08.00 0 doi:10.1128/cvi.00168-07 Copyright 2007, American Society for Microbiology. All Rights Reserved. Evaluation
More informationTitle. CitationCancer science, 109(4): Issue Date Doc URL. Rights(URL)
Title Toll-like receptor 3 signal augments radiation-induc Yoshida, Sumito; Shime, Hiroaki; Takeda, Yohei; Nam, Author(s) Hiroki; Kasahara, Masanori; Seya, Tsukasa CitationCancer science, 19(): 956-965
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationHuman Immunodeficiency Virus Type-1 Myeloid Derived Suppressor Cells Inhibit Cytomegalovirus Inflammation through Interleukin-27 and B7-H4
Human Immunodeficiency Virus Type-1 Myeloid Derived Suppressor Cells Inhibit Cytomegalovirus Inflammation through Interleukin-27 and B7-H4 Ankita Garg, Rodney Trout and Stephen A. Spector,,* Department
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
More informationa Beckman Coulter Life Sciences: White Paper
a Beckman Coulter Life Sciences: White Paper An 8-color DuraClone IM panel for detection of Human blood dendritic cells by flow cytometry Nathalie Dupas 1, Snehita Sattiraju 2, Neha Girish 2, Murthy Pendyala
More informationNature Immunology: doi: /ni.3836
Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:
More informationEx vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2*
Ex vivo Human Antigen-specific T Cell Proliferation and Degranulation Willemijn Hobo 1, Wieger Norde 1 and Harry Dolstra 2* 1 Department of Laboratory Medicine - Laboratory of Hematology, Radboud University
More informationEXAMPLE REPORT ONLY Contact AMS Biotechnology for current donor specific information
EXAMPLE REPORT ONLY Contact AMS Biotechnology for current donor specific information NAME DIAGNOSIS PROTOCOL OF EVALUATION for Chronic Lymphatic Leukemia (CLL) GENERAL INFORMATION (ALL information required!!)
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationPatient Information Specimen Information Client Information. Specimen: EN255254W. Requisition:
Patient Information Specimen Information Client Information MAIL000 Requisition: 0014895 DIRECT TO PATIENT- WEST HILLS Lab Ref #: PRO76199 8401 FALLBROOK AVE WEST HILLS, CA 91304-3226 Phone: 530.347.6380
More informationliquicolor (AMP Buffer, IFCC) Design Verification
Design Verification (AMP Buffer, IFCC) liquicolor 1 Introduction... 2 2 Imprecision... 2 3 arity and Detection Limit... 2 3.1 arity... 2 3.2 Detection Limit... 3 4 Comparison of Methods... 3 5 Stability...
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationEpic Labs Orderable As STAT PRIORITY As of 06/22/2016
ABG+HB(CORDARTERIAL) - BABY A ABG+HB(CORD ARTERIAL)- BABY B ABG+HB(CORD ARTERIAL)- BABY C ACETAMINOPHEN LEVEL ALANINE AMINOTRANSFERASE (ALT) ALBUMIN, FLUID ALBUMIN, PLEURAL FLUID ALBUMIN, SYNOVIAL FLUID
More informationSupplementary Online Content
Supplementary Online Content Peters PJ, Westheimer E, Cohen S, et al. Screening yield of HIV antigen/antibody combination and pooled HIV RNA testing for acute HIV infection in a high-prevalence population.
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationBD Multitest IMK Kit
BD Multitest IMK Kit 50 Tests Catalog No. 340503 50 Tests with BD Trucount Tubes Catalog No. 340504 IVD 2016 BD. BD, the BD Logo and all other trademarks are property of Becton, Dickinson and Company.
More informationVARIATION IN MEASUREMENT OF HIV RNA VIRAL LOAD
VARIATION IN MEASUREMENT OF HIV RNA VIRAL LOAD SOURCES OF VARIATION (RANDOM VS SYSTEMATIC) MAGNITUDE OF EACH SOURCE CONSEQUENCES FOR CONFIDENCE LIMITS AROUND MEASUREMENTS AND CHANGES DATA FROM ROCHE HIV
More informationsequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5
sfigure 1 Styx mutant mice recapitulate the phenotype of SHIP -/- mice. (A) Analysis of the genomic sequences of a styx mutant reveals a T to A transversion in the donor splice site of intron 5 (GTAAC
More informationHIV-infected subjects were recruited from an ongoing clinic-based cohort (SCOPE)
SUPPLEMENTAL METHODS Populations studied HIV-infected subjects were recruited from an ongoing clinic-based cohort (SCOPE) based at the University of California, San Francisco. From this cohort, we recruited
More information2.4.1 STA-O Assessment 2
2.4.1 STA-O Assessment 2 Work all the problems and determine the correct answers. When you have completed the assessment, open the Assessment 2 activity and input your responses into the online grading
More informationVUmc Basispresentatie
Clinical diagnostic cytometry Gerrit J Schuurhuis Dept of Hematology VU University Medical Center Amsterdam, Netherlands Use of immunophenotyping at diagnosis to trace residual disease after therapy 1.
More informationDuring the past two decades,
Prospectively validated prediction of physiologic variables and organ failure in septic patients: The Systemic Mediator Associated Response Test (SMART) Gus J. Slotman, MD Objective: Conventional outcomes
More informationEvaluation Report of the Pneumatic Tube Transport System (PEVCO) connecting Dialysis Hospital to. Mubarak Hospital. Dr.
5 Evaluation Report of the Transport System (PEVCO) connecting Dialysis Hospital to Mubarak Hospital Dr. Anwar AlAnjeri Senior Registrar Clinical Biochemistry Laboratory Mubarak Hospital Introduction:
More informationIndividual Study Table Referring to Part of the Dossier. Use only) Name of Finished Product:
SYNOPSIS Fresenius Title of the study: A double-blind, randomized study comparing the safety and torelance of SMOFlipid 20% and Intralipid 20% in long-term treatment with parenteral nutrition Coordinating
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationWhat is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such
More informationDetailed step-by-step operating procedures for NK cell and CTL degranulation assays
Supplemental methods Detailed step-by-step operating procedures for NK cell and CTL degranulation assays Materials PBMC isolated from patients, relatives and healthy donors as control K562 cells (ATCC,
More informationPatient Information Specimen Information Client Information. Specimen: EN255254W. Requisition: TSENG, JUSTINA J DOB: 10/26/1955 AGE: 59
Report Status: Final Patient Information Specimen Information Client Information Specimen: EN255254W Client #: 44123510 MAIL001 Requisition: 0014895 Lab Ref #: PRO76199 GREENVILLE RANCHERIA 1425 MONTGOMERY
More informationSupplementary appendix
Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Chandran SS, Somerville RPT, Yang JC, et al.
More informationIgG3 regulates tissue-like memory B cells in HIV-infected individuals
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41590-018-0180-5 In the format provided by the authors and unedited. IgG3 regulates tissue-like memory B cells in HIV-infected individuals Lela
More informationInterferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease
Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,
More informationISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES ALDO E CELE DACCO
ISTITUTO DI RICERCHE FARMACOLOGICHE MARIO NEGRI CENTRO MARIO DI NEGRI RICERCHE INSTITUTE CLINICHE FOR PHARMACOLOGICAL PER LE MALATTIE RESEARCH RARE CLINICAL RESEARCH CENTER ALDO E FOR CELE RARE DACCO DISEASES
More informationImageStream cytometer analysis. Cells were cultured as described above in vented-cap
ImageStream cytometer analysis. Cells were cultured as described above in vented-cap polypropylene tubes, stained with αcd66b-fitc, αm-dc8-pe and αcd56-pe-cy5.5 mabs, washed and fixed with 4 % (w/v) paraformaldehyde.
More informationIntron A Hepatitis C. Intron A (interferon alfa-2b) Description
Federal Employee Program 1310 G Street, N.W. Washington, D.C. 20005 202.942.1000 Fax 202.942.1125 5.01.05 Subject: Intron A Hepatitis C Page: 1 of 5 Last Review Date: November 30, 2018 Intron A Hepatitis
More information<10. IL-1β IL-6 TNF + _ TGF-β + IL-23
3 ns 25 ns 2 IL-17 (pg/ml) 15 1 ns ns 5 IL-1β IL-6 TNF
More informationPathophysiology I Liver and Biliary Disease
Pathophysiology I Liver and Biliary Disease The Liver The liver is located in the right upper portion of the abdominal cavity just beneath the right side of the rib cage. The liver has many functions that
More informationOptimizing Intracellular Flow Cytometry:
Optimizing Intracellular Flow Cytometry: Simultaneous Detection of Cytokines and Transcription Factors An encore presentation by Jurg Rohrer, PhD, BD Biosciences 10.26.10 Outline Introduction Cytokines
More informationLaboratory for Clinical and Biological Studies, University of Miami Miller School of Medicine, Miami, FL, USA.
000000 00000 0000 000 00 0 bdna () 00000 0000 000 00 0 Nuclisens () 000 00 0 000000 00000 0000 000 00 0 Amplicor () Comparison of Amplicor HIV- monitor Test, NucliSens HIV- QT and bdna Versant HIV RNA
More informationFLOW CYTOMETRY PRINCIPLES AND PRACTICE. Toby Eyre Consultant Haematologist Oxford University Hospitals NHS Foundation Trust June 2018
FLOW CYTOMETRY PRINCIPLES AND PRACTICE Toby Eyre Consultant Haematologist Oxford University Hospitals NHS Foundation Trust June 2018 Aims and Objectives Principles of flow cytometry Preparation Steps involved
More information