Supporting Information. Evaluation of Toxicity and Gene Expression Changes Triggered by Oxide Nanoparticles

Size: px

Start display at page:

Download "Supporting Information. Evaluation of Toxicity and Gene Expression Changes Triggered by Oxide Nanoparticles"

Ira Lambert
5 years ago
Views:

1 Evaluation of Toxicity and Gene Expression Changes Triggered Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 1 DOI /bkcs Supporting Information Evaluation of Toxicity and Gene Expression Changes Triggered by Oxide Nanoparticles Pooja Dua,,,a Kiran N. Chaudhari,,a Chang Han Lee, Nitin K. Chaudhari, Sun Woo Hong, Jong-Sung Yu,,* Soyoun Kim,,* and Dong-ki Lee,* Global Research Laboratory for RNAi Medicine, Department of Chemistry and BK21 School of Chemical Materials Science, Sungkyunkwan University, Suwon , Korea. * dklee@skku.edu (D.-k. Lee) Department of Biomedical Engineering, Dongguk University, Seoul , Korea. * skim@dongguk.edu (S. Kim) Department of Advanced Materials Chemistry, BK21 Research Team, Korea University, Chungnam , Korea * jsyu212@korea.ac.kr (J.S. Yu) Received January 10, 2011, Accepted April 25, 2011 Figure S1. Scanning electron microscopic image (a) and Transmission electron microscopy image (b) of MCM-41 (up) and Fe 2O 3 nanoparticles (down).

TEM images of nanoparticles show absence of any agglomeration in culture conditions. Test concentrations of nanparticles i.e. 100 µg/ml of MCM-41, 100 µg/ml of Fe 2O 3 and 12.

2 2 Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 Pooja Dua et al. Figure S2. N2 adsorption/desorption isotherms for surface area measurement and pore size distribution (the inset) of MCM-41and Fe 2O 3 nanoparticles. Pore size distribution is given as the inset. Figure S3. TEM images of nanoparticles show absence of any agglomeration in culture conditions. Test concentrations of nanparticles i.e. 100 µg/ml of MCM-41, 100 µg/ml of Fe 2O 3 and 12.5 µg/ml of ZnO were incubated for 24 h in complete medium. TEM images of NPs in culture medium with and without incubation were acquired. The scale bar measures 1 µm. Figure S4. Cytotoxic effect of nanoparticle-associated ions released in culture medium. HEK293 cells were exposed to the NPsupernatant culture medium for the indicated time-points viz 24 h in presence of 24 h NP-supernatant, 48 h in presence of 48 h NPsupernatent, 72 h in presence of 72 h NP-supernatant. The toxicity was evaluated by WST-1 reagent.

3 Evaluation of Toxicity and Gene Expression Changes Triggered Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 3 Table S1. List of genes and associated biological processes altered by nanoparticles exposure I MCM-41 regulated genes (> 2 fold) Gene ID Gene Name Intensity RatioEnriched Gene Ontology Term NM_ tumor necrosis factor receptor superfamily, member chemokine chemokine receptor interaction NM_ ectodysplasin a 0.47 chemokine chemokine receptor interaction XM_ similar to h2a histone family, member v isoform chromatin assembly-disassembly NM_ histone 1, h2ad 2.44 chromatin assembly-disassembly XM_ similar to h3 histone, family 3b 2.52 chromatin assembly-disassembly NM_ colony stimulating factor 3 (granulocyte) 2.11 defense NM_ pregnancy specific beta-1-glycoprotein defense NM_ colony stimulating factor 3 receptor (granulocyte) 2.16 defense NM_ histone deacetylase defense NM_ pregnancy specific beta-1-glycoprotein defense NM_ histone 1, h2bd 2.35 defense NM_ defensin, beta defense NM_ toll-like receptor defense NM_ sialophorin (gpl115, leukosialin, cd43) 2.45 defense NM_ interleukin defense NM_ chromosome 6 open reading frame defense NM_ fas apoptotic inhibitory molecule defense NM_ regenerating islet-derived 3 alpha 0.41 defense NM_ colony stimulating factor 3 receptor (granulocyte) 0.4 defense NM_ defensin, beta 106a 0.46 defense NM_ potassium voltage-gated channel, shaw-related subfamily, 0.49 gated channel activity member 3 NM_ solute carrier family 4,, member gated channel activity NM_ potassium channel, subfamily v, member gated channel activity NM_ potassium large conductance calcium-activated channel 0.47 gated channel activity NM_ erythropoietin receptor 0.47 gated channel activity NM_ Chemokine C-c motif ligand Inflammation, NM_ kallikrein b, plasma (fletcher factor) Inflammation, response to wounding NM_ purinergic receptor p2x, 0.45 Ion transport NM_ kinase deficient protein 0.47 Ion transport NM_ collagen, type xix, alpha Ion transport NM_ sodium channel, nonvoltage-gated 1, delta 0.44 Ion transport NM_ small proline-rich protein response to wounding NM_ s100 calcium binding protein a9 (calgranulin b) 0.47 response to wounding NM_ interferon regulatory factor response to wounding XM_ similar to 60s ribosomal protein l6 (tax-responsive enhancer 2.57 ribosomal processes element binding protein 107) XM_ similar to ribosomal protein s2; 40s ribosomal protein s2 2.2 ribosomal processes XM_ ribosomal protein s26 pseudogene ribosomal processes XM_ similar to 60s ribosomal protein l29 (p23) 2.34 ribosomal processes XM_ similar to 60s ribosomal protein l10 (qm protein) (tumor 2.14 ribosomal processes suppressor qm) (laminin receptor homolog) XM_ similar to 60s ribosomal protein l10 (qm protein) (tumor 3.01 ribosomal processes suppressor qm) (laminin receptor homolog) XM_ similar to ribosomal protein s ribosomal processes XM_ similar to 60s ribosomal protein l ribosomal processes XM_ similar to 40s ribosomal protein s ribosomal processes XM_ similar to ribosomal protein l ribosomal processes XM_ similar to ribosomal protein l ribosomal processes XM_ similar to ribosomal protein l ribosomal processes XM_ similar to 40s ribosomal protein s ribosomal processes XM_ similar to 40s ribosomal protein s ribosomal processes

4 4 Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 Pooja Dua et al. II Fe 2O 3-NP regulated genes (> 2 fold) Gene ID Gene Name Intensity Ratio Enriched Gene Ontology Term NM_ gastrin-releasing peptide receptor 0.35 cell proliferation NM_ v-ets erythroblastosis virus e26 oncogene like (avian) 0.36 cell proliferation NM_ bcl2/adenovirus e1b 19kd interacting protein like 0.42 cell proliferation NM_ regenerating islet-derived 1 alpha (pancreatic stone 0.42 cell proliferation protein) NM_ lim domain only 1 (rhombotin 1) 0.44 cell proliferation NM_ t-box cell proliferation NM_ bone morphogenetic protein cell proliferation NM_ fibroblast growth factor 8 (androgen-induced) 0.49 cell proliferation NM_ dedicator of cytokinesis chemotaxis NM_ cklf-like marvel transmembrane domain containing chemotaxis NM_ h4 histone, family chromatin assembly- disassembly NM_ histone 1, h2ae 2.29 chromatin assembly -disassembly NM_ histone 1, h2ai 2.32 chromatin assembly -disassembly XM_ similar to set protein (i-2pp2a) (taf-i) (phapii) (igaad) 2.46 chromatin assembly -disassembly XM_ similar to h2a histone family, member v isoform chromatin assembly -disassembly XM_ similar to set protein (i-2pp2a) (taf-i) 2.54 chromatin assembly- disassembly NM_ histone 1, h2ad 2.58 chromatin assembly -disassembly NM_ histone 3, h chromatin assembly -disassembly NM_003523, histone 1, h2bd 2.77 chromatin assembly -disassembly XM_ similar to h3 histone, family 3b 3.31 chromatin assembly -disassembly NM_ defensin, beta defense NM_ sperm associated antigen defense NM_ hla-g histocompatibility antigen, class i, g 2.02 defense NM_ killer cell immunoglobulin-like receptor 2.34 defense NM_ cd160 antigen 2.97 defense NM_ interferon, alpha defense, chemokine chemokine receptor interaction, inflammatory response NM_ pro-platelet basic protein (chemokine (c-x-c motif) ligand 7) 0.49 defense, chemokine chemokine receptor interaction, inflammatory response, cell proliferation, chemotaxis NM_ sialophorin (gpl115, leukosialin, cd43) 2.15 defense, inflammatory response NM_ chemokine (c-c motif) ligand defense, response to wounding, chemokine chemokine receptor interaction, inflammatory response, chemotaxis NM_ s100 calcium binding protein a9 (calgranulin b) 0.40 defense, response to wounding, inflammatory response NM_ complement component 1, q subcomponent, b chain 0.41 defense, response to wounding, inflammatory response NM_ mannan-binding lectin serine peptidase defense, response to wounding, inflammatory response NM_ kallikrein b, plasma (fletcher factor) defense, response to wounding, inflammatory response NM_ TNF receptor superfamily, member inflammatory response, chemokine chemokine receptor interaction NM_ interleukin response to wounding, chemokine chemokine receptor interaction, Inflammatory response, cell proliferation NM_ fc fragment of IGE, receptor for alpha polypeptide 3.00 response to wounding, inflammatory response NM_ adenosine a3 receptor 0.45 response to wounding, inflammatory response, defense NM_ extracellular link domain containing response to wounding NM_ myod family inhibitor 2.01 response to wounding NM_ livin inhibitor-of-apotosis 2.17 response to wounding

5 Evaluation of Toxicity and Gene Expression Changes Triggered Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 5 II Fe 2O 3-NP regulated genes (> 2 fold) NM_ natriuretic peptide precursor b 0.45 renal system process NM_ endothelin renal system process, cell proliferation XM_ similar to 60s ribosomal protein l29 (p23) 2.04 ribosomal processes XM_ similar to ribosomal protein l ribosomal processes XM_ similar to 40s ribosomal protein s ribosomal processes XM_ similar to 40s ribosomal protein s15 (rig protein) 2.54 ribosomal processes XM_ similar to 40s ribosomal protein s ribosomal processes XM_ similar to 60s ribosomal protein l6 (taxreb107) (neoplasm-related protein c140) 2.71 ribosomal processes XM_ similar to 60s ribosomal protein l10 (qm protein) (tumor 2.96 ribosomal processes suppressor qm) XM_ similar to 40s ribosomal protein s ribosomal processes XM_ similar to ribosomal protein l ribosomal processes XM_ similar to 40s ribosomal protein s ribosomal processes XM_ similar to 60s ribosomal protein l10 (qm protein) (tumor 3.62 ribosomal processes suppressor qm) XM_ ribosomal protein s26 pseudogene ribosomal processes XM_ similar to 60s ribosomal protein l ribosomal processes XM_ similar to ribosomal protein s ribosomal processes XM_ similar to ribosomal protein l ribosomal processes III ZnO-NP regulated genes (> 2 fold) Gene ID Gene Name Intensity Enriched Gene Ontology Term Ratio NM_ complement factor i 0.34 activation of Immune response NM_ killer cell lectin-like receptor subfamily c, member activation of Immune response NM_ ubiquitin associated and sh3 domain containing, a 0.45 activation of Immune response NM_ lymphocyte transmembrane adaptor activation of Immune response, inactivation of MAPK NM_ prokineticin Ca 2+ ion homeostasis NM_ matrix metallopeptidase 10 (stromelysin 2) 8.18 Ca 2+ ion homeostasis, inflammatory response NM_ solute carrier family 8 (sodium-calcium exchanger), 2.29 Ca 2+ ion homeostasis, inflammatory response member 2 NM_ annexin a Ca 2+ ion homeostasis, inflammatory response NM_ double c2-like domains, beta 3.06 Ca 2+ ion homeostasis, inflammatory response NM_ s100 calcium binding protein a Ca 2+ ion homeostasis, inflammatory response NM_ calbindin 2, 29kda (calretinin) 2.43 Ca 2+ ion homeostasis, inflammatory response NM_ transglutaminase Ca 2+ ion homeostasis, inflammatory response NM_ matrix metallopeptidase 1 (interstitial collagenase) 6.90 Ca 2+ ion homeostasis, inflammatory response NM_ arylsulfatase d 2.17 Ca 2+ ion homeostasis, inflammatory response NM_ pregnancy upregulated non-ubiquitously expressed 2.04 Ca 2+ ion homeostasis, inflammatory response cam kinase NM_ crumbs homolog 1 (drosophila) 2.48 Ca 2+ ion homeostasis, inflammatory response NM_002590, protocadherin Ca 2+ ion homeostasis, inflammatory response NM_ protease, serine, 2 (trypsin 2) 2.78 Ca 2+ ion homeostasis, inflammatory response NM_ calcium channel, voltage-dependent, alpha 1g 2.28 Ca 2+ ion homeostasis, inflammatory response subunit NM_ complement component 1, s subcomponent 3.96 Ca 2+ ion homeostasis, defense, inflammatory response, response to stress NM_ cadherin 13, h-cadherin (heart) 3.99 Ca 2+ ion homeostasis, inflammatory response, cell death NM_ protein kinase c, gamma 3.41 Ca 2+ ion homeostasis, inflammatory response, cell death, response to stress, VEGF. NM_ matrix metallopeptidase Ca 2+ ion homeostasis, inflammatory response, defense, response to stress NM_ coagulation factor v (proaccelerin, labile factor) 2.68 Ca 2+ ion homeostasis, inflammatory response, response to stress

6 6 Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 Pooja Dua et al. III ZnO-NP regulated genes (> 2 fold) NM_ annexin a Ca 2+ ion homeostasis, inflammatory response, response to stress NM_ integrin, alpha l (cd11a), lymphocyte functionassociated antigen 1) 2.88 Ca 2+ ion homeostasis, inflammatory response, T cell activation, NM_ phospholipase a2, group xiib 4.76 Ca 2+ ion homeostasis, inflammatory response, VEGF NM_ phospholipase a2, group iia (platelets, synovial fluid) 6.54 Ca 2+ ion homeostasis, inflammatory response, VEGF NM_ chemokine (c-c motif) ligand Ca 2+ ion homeostasis, metal ion homeostasis, chemokine chemokine receptor interaction NM_ chemokine (c-c motif) ligand Ca 2+ ion homeostasis, metal ion homeostasis, response to oxidative stress, chemotaxis NM_ glucagon-like peptide 1 receptor 0.43 Ca 2+ ion homeostasis, metal ion homeostasis NM_ interleukin 1, beta 0.36 Ca 2+ ion homeostasis, metal ion homeostasis NM_ serpin peptidase inhibitor, clade b 2.03 cell death NM_ granzyme b (granzyme 2) 2.70 cell death NM_ sphingosine kinase cell death NM_ ring finger protein cell death NM_ estrogen receptor cell death NM_ fibroblast growth factor cell death NM_ bcl2-related protein a cell death NM_ mucin 2, intestinal/tracheal 5.83 cell death NM_ chorionic gonadotropin, beta polypeptide 2.04 cell death NM_ bruton agammaglobulinemia tyrosine kinase 2.69 cell death NM_ homeodomain interacting protein kinase cell death NM_ crystallin, alpha b 3.00 cell death NM_ serum/glucocorticoid regulated kinase 2.05 cell death, response to stress NM_ growth arrest and dna-damage-inducible, beta 3.40 cell death, response to stress NM_ heme oxygenase (decy 2.72 cell death, response to stress NM_ growth arrest and dna-damage-inducible, 2.52 cell death, response to stress NM_ prolactin 0.83 chemokine chemokine receptor interaction NM_ TNF receptor superfamily, member chemokine chemokine receptor interaction NM_ growth hormone receptor 0.49 chemokine chemokine receptor interaction NM_ interleukin 2 receptor, gamma 0.47 chemokine chemokine receptor interaction NM_ erythropoietin 0.48 chemokine chemokine receptor interaction NM_ interferon, alpha chemokine chemokine receptor interaction NM_ lymphotoxin alpha (TNF superfamily, member 1) 5.11 chemokine chemokine receptor interaction, cell death NM_ TNF receptor superfamily, member chemokine chemokine receptor interaction, cell death NM_ TNF receptor superfamily, member chemokine chemokine receptor interaction, cell death NM_ interleukin chemokine chemokine receptor interaction, cell death, Jak- Stat NM_ cardiotrophin-like cytokine factor chemokine chemokine receptor interaction, cell death, Jak- Stat NM_ chemokine (c-x-c motif) ligand chemokine chemokine receptor interaction, chemotaxis NM_ ciliary neurotrophic factor receptor 2.17 chemokine chemokine receptor interaction, Jak-Stat NM_ colony stimulating factor 3 receptor (granulocyte) 2.02 chemokine chemokine receptor interaction, Jak-Stat NM_ interleukin 5 receptor, alpha 2.52 chemokine chemokine receptor interaction, Jak-Stat NM_ interleukin 7 receptor 2.33 chemokine chemokine receptor interaction, Jak-Stat NM_ colony stimulating factor 2 receptor, alpha 2.06 chemokine chemokine receptor interaction, Jak-Stat NM_ cytokine receptor-like factor chemokine chemokine receptor interaction, Jak-Stat

7 Evaluation of Toxicity and Gene Expression Changes Triggered Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 7 III ZnO-NP regulated genes (> 2 fold) NM_ interleukin response to stress, chemokine chemokine receptor interaction, Jak-Stat, NM_ TNF (ligand) superfamily, member chemokine chemokine receptor interaction, negative regulator of cell proliferation NM_ oncostatin m 2.17 cell death, chemokine chemokine receptor interaction, response to stress, Jak-Stat, NM_ serpin peptidase inhibitor, clade d, member chemotaxis NM_ cklf-like marvel transmembrane domain containing 0.46 chemotaxis 1 NM_ pregnancy specific beta-1-glycoprotein defense NM_ histone 1, h2bd 2.09 defense NM_ ankyrin repeat domain 1 (cardiac muscle) 2.35 defense NM_ histone 1, h2bk 2.15 defense NM_ neutrophil cytosolic factor 1, 2.03 defense NM_ il2-inducible t-cell kinase 3.01 defense NM_ pregnancy specific beta-1-glycoprotein defense NM_ fos-like antigen defense NM_ granulysin 2.32 defense NM_ beta-defensin defense NM_ neutrophil cytosolic factor defense NM_ pregnancy specific beta-1-glycoprotein defense NM_ sp140 nuclear body protein 2.11 defense NM_ nacht, leucine rich repeat and pyd containing defense, cell death NM_ fas apoptotic inhibitory molecule defense, cell death NM_ phospholipase a2, group ivc 2.28 defense, cell death, inflammatory response NM_ inhibin, beta a (activin a, activin ab alpha polypeptide) 4.83 defense, chemokine chemokine receptor interaction, cell death NM_ tumor necrosis factor (tnf superfamily, member 2) 2.50 defense, chemokine chemokine receptor interaction, cell death NM_ n-acetylgalactosaminyltransferase 8 (galnac-t8) 2.58 defense, inflammatory response NM_ cholinergic receptor, nicotinic, alpha defense, inflammatory response NM_ phospholipid scramblase defense, inflammatory response NM_ transglutaminase 4 (prostate) 2.72 defense, inflammatory response NM_ myosin, light polypeptide kinase 2.39 defense, inflammatory response NM_ matrix metallopeptidase 9 (gelatinase b) 2.15 defense, inflammatory response, cell death NM_ complement component defense, inflammatory response, response to stress NM_ complement component defense, inflammatory response, response to stress NM_ sialic acid binding ig-like lectin 1, sialoadhesin 2.37 defense, inflammatory response, response to stress NM_ calcitonin/calcitonin-related polypeptide, alpha 2.10 defense, inflammatory response, response to stress NM_ v-fos fbj murine osteosarcoma viral oncogene defense, inflammatory response, response to stress homolog NM_ e74-like factor defense, inflammatory response, response to stress NM_ transferrin 6.58 defense, inflammatory response, response to stress NM_ chemokine (c-x3-c motif) receptor defense, inflammatory response, response to stress NM_ interleukin 17f 6.91 defense, inflammatory response, response to stress NM_ chemokine (c-c motif) ligand defense, inflammatory response, response to stress, chemokine chemokine receptor interaction NM_ cd7 antigen (p41) 2.45 defense, T cell activation NM_ lymphocyte-activation gene defense, T cell activation, cell death NM_ dual specificity phosphatase inactivation of MAPK NM_ protein phosphatase 2, regulatory subunit a isoform 0.47 inactivation of MAPK NM_ zinc finger protein 36, c3h type, homolog (mouse) 3.20 Inflammatory response, response to stress NM_ nuclear receptor subfamily 3, groupc, member metal ion homeostasis NM_ metallothionein-like 5, testis-specific (tesmin) 0.43 metal ion homeostasis, response to oxidative stress NM_ metallothionein 2a metallothionein superfamily NM_ metallothionein 1h metallothionein superfamily

8 8 Bull. Korean Chem. Soc. 2011, Vol. 32, No. 6 Pooja Dua et al. III ZnO-NP regulated genes (> 2 fold) NM_ metallothionein 1x metallothionein superfamily NM_ metallothionein 1g metallothionein superfamily NM_ metallothionein 1b (functional) metallothionein superfamily NM_ metallothionein 1f (functional) metallothionein superfamily NM_ chromosome 20 open reading frame metallothionein superfamily NM_ metallothionein 1j (pseudogene) metallothionein superfamily NM_ ectonucleotide pyrophosphatase negative regulation of cell proliferation NM_ opioid receptor, mu negative regulation of cell proliferation NM_ interferon induced transmembrane protein 1 (9-27) 0.49 negative regulation of cell proliferation NM_ von hippel-lindau tumor suppressor 0.37 negative regulation of cell proliferation NM_ trefoil factor negative regulation of cell proliferation NM_ somatostatin receptor negative regulation of cell proliferation NM_ angiopoietin-like response to oxidative stress NM_ eosinophil peroxidase 0.45 response to oxidative stress NM_ superoxide dismutase 2, mitochondrial 0.18 response to oxidative stress NM_ serpin peptidase inhibitor, clade e 2.96 response to stress NM_ kallikrein response to stress NM_ heat shock 70kda protein response to stress NM_ acetylcholinesterase 2.89 response to stress NM_ activin a receptor type ii-like response to stress NM_ heat shock 27kda protein response to stress NM_ v-maf musculoaponeurotic fibrosarcoma oncogene 4.45 response to stress homolog f NM_ dopamine receptor d response to stress NM_ collagen, type i, alpha response to stress NM_ tyrosine aminotransferase 2.23 response to stress NM_ cd8 antigen, beta polypeptide 1 (p37) 2.02 T cell activation NM_ early growth response T cell activation NM_ cd274 antigen 3.00 T cell activation NM_ sonic hedgehog homolog (drosophila) 3.47 T cell activation NM_ protein tyrosine phosphatase, non-receptor type T cell activation NM_ lymphocyte-specific protein tyrosine kinase 4.13 T cell activation, cell death NM_ cd74 antigen 3.39 T cell activation, cell death NM_ sphingosine kinase VEGF NM_ rho family, small gtp binding protein rac VEGF NM_ sh2 domain protein 2a 2.18 VEGF Table S2. Sequence of Primer pairs used in the study Genes Forward Primer (5'-3') Reverse Primer (3'-5') Metallothionein 2a (MT2a) ACTTGGCACAGCCCACAG GACTCTAGCCGCCTCTTCAG v-fos fbj murine osteosarcoma viral oncogene homolog CCGGGGATAGCCTCTCTTAC AGGTCCGGACTGGTCGAG Interleukin17f (IL17f) TGGCATCATCAATGAAAACC TTCCTTGAGCATTGATGCAG Chemokine cc motif ligand 15 (CCL15) GCTTGTTGCTGTCCTTGGAT GAGTGAACACGGGATGCTTT Heat shock 70kDa protein 6 (HSPA6) GAGATCTCGTCCATGGTGCT TTGATGATCCGCAACACG Matrix metallopeptidase 1 (MMP1) TGGCATCATCAATGAAAACC TTCCTTGAGCATTGATGCAG Pregnancy specific beta-1-glycoprotein 8 (PSG1) GACGCAGGATCCTACACCTT GGTTAAGCTCACAGCCTCCA Pregnancy specific beta-1-glycoprotein (PSG9) AGCTGCCCATCCCCTACAT GGCTCTGACCGTTTAGCCA

Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.

Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3