Supplemental Information. Host-Microbiota Interactions in the Pathogenesis. of Antibiotic-Associated Diseases
|
|
- Maximillian Copeland
- 6 years ago
- Views:
Transcription
1 Cell Reports, Volume Supplemental Information Host-Microbiota Interactions in the Pathogenesis of -Associated Diseases Joshua S. Lichtman, Jessica A. Ferreyra, Katharine M. Ng, Samuel A. Smits, Justin L. Sonnenburg, and Joshua E. Elias
2 A Treatment Salmonella Infection Day: - -Salmonella - +Salmonella n=/group No Pathogen Low Infection + -Salmonella Peak of Infection +Salmonella B Cocktail Treatment C. difficile Infection Fecal Transplant Day: - -C. diff -Clind -Ab cocktail +C. diff n=/group No Pathogen -FT Pathogen below detection Low Infection +Ab cocktail -C. diff +FT Peak of Infection +Clind +C. diff -FT +FT Figure S. -associated Experimental Design,Related to Experimental Procedures. (a) In the Salmonella model, conventionally-raised Swiss Webster mice (n=/group) were treated with mg -hours prior to infection with 8 CFUs of Salmonella typhimurium. Mice were followed for s and fecal pellets were collected prior to antibiotic treatment, prior to infection and and s post-infection. (b) In the C. difficile model, conventional mice were treated with an antibiotic cocktail in drinking water for s, placed on regular drinking water for s and finally given a single dose of mg clindamycin -hours prior to infection with 8 CFUs C. difficile. -s post-infection, mice that received antibiotics (with or without pathogen) received a fecal transplant from the conventional mice. All mice were followed for -s post-infection.
3 A Principal Component # (.%) C Pre-treatment Days post-treatment Treated (Day ) Renin- Kallikrein -related peptidase b7 Major urinary protein Heat shock 7 kda protein B Alpha-defensin-related sequence Transthyretin Serotransferrin Alcohol dehydrogenase Malate dehydrogenase Malate dehydrogenase Heat shock cognate 7 kda protein Calmodulin Cofilin- Selenium-binding protein Cytochrome c Myosin-Ia Destrin Ahnak protein (Fragment) Na+/K+-transporting ATPase subunit alpha- Myosin-VIIb Adseverin Kallikrein related-peptidase Chymotrypsin-like elastase family member A Carboxypeptidase A Elastase B.... Principal Component # (.%) EGFR kinase substrate 8-like protein = MCG8 Hemoglobin subunit beta- UDP-glucose -dehydrogenase Cytochrome P C Ester hydrolase Corf homolog D-dopachrome decarboxylase Medium-chain specific acyl-coa dehydrogenase Oncomodulin Myosin regulatory light chain Ribosome-releasing factor Colipase Phospholipase A Chymotrypsinogen B Pantetheinase Protocadherin E D Pre-treatment Treated (Day ) Days post-treatment Dipeptidyl peptidase Myosin-Ia Histone HB type -F/J/L Superoxide dismutase [Mn] Alcohol dehydrogenase class- Annexin A Tropomyosin alpha- chain Histone H. Prolactin-inducible protein homolog Chymotrypsinogen B Serpin B Annexin A Cytosol aminopeptidase Fumarylacetoacetate hydrolase domain-containing protein Phospholipase A Putative phospholipase B-like Amiloride-sensitive amine oxidase [copper-containing] Cytosolic non-specific dipeptidase Adenosine deaminase Cytochrome c Alpha-actinin- Myosin-9 Hydroxymethylglutaryl-CoA synthase Murinoglobulin- Cadherin-related family member Ig heavy chain V region M Igh protein Chymotrypsin-like elastase family member A Transthyretin Carcinoembryonic antigen-related cell adhesion molecule Igk protein Igh protein (Fragment) Novel protein (ERik) Na(+)/H(+) exchange regulatory cofactor NHE-RF Thioredoxin Mucb protein -mercaptopyruvate sulfurtransferase Biliary glycoprotein Carboxylesterase /7 // / Figure S. Treatment Causes Perturbations to Microbiota Composition and Host Proteome, Related to Figure. PCA analysis of the microbiota upon treatment with (a) and (b), compared to untreated mice over the s after antibiotic treatment. (c,d) Cluster analyses of proteins significantly changed in expression (FDR<., > ln fold change) when comparing (c) clindamycin or (d) streptomycin treated mice - after treatment with the same mice prior treatment. Each column represents a single mouse. Red protein names indicates their significant regulation in both treatment conditions. (e) Venn Diagram comparing the proteins identified in the above analysis. Green= up-regulated in antibiotic-treated condition, Blue= down-regulated in the antibiotic-treated condition, black= up-regulated in clindamycin treatment but down-regulated in streptomycin treatment.
4 A C D.... Relative Abundance of C. diff DNA Principal Component # (.%) 8 Day (Infection on Day ) Conven onal + Salmonella Conven onal + Salmonella + C. diff + C. diff - - (Day ) Principal Component # (.%) + Salmonella (Day ) B Relative Abundance of Salmonella DNA Serum albumin Granulins Actin Annexin A Intelectin-a Glyceraldehyde--phosphate dehydrogenase Cytosol aminopeptidase Neprilysin Zymogen granule membrane protein Cubilin Calmodulin Xaa-Pro dipeptidase Mucin- 78 kda glucose-regulated protein Calcium-activated chloride channel regulator Neutral ceramidase Galectin--binding protein Plastin- Villin- Mucin glycoprotein MUC (Fragment) Regenerating islet-derived protein -gamma Alpha--macroglobulin Chymotrypsin-like elastase family member A Aminopeptidase N Carboxypeptidase B (Tissue) Ela protein (Fragment) E F Relative Spectral Counts Relative Spectral Counts G Relative Spectral Counts Day (Infection on Day ) Serotransferrin Day Complement C Day mice sacrificed Regenerating islet-derived protein -gamma + Salmonella + Salmonella s + C. diff s + C. diff s + C. diff Day Figure S. Host-Microbiota Kinetics During Pathogen Infection, Related to Figure. (a,b) Pathogen load was measured using qpcr assays for (a) C. difficile and (b) Salmonella in mice treated with antibiotics or vehicle controls (mean +/- SEM). (c) PCA of the microbial community composition was conducted on all mice in the Salmonella experiment, s post-infection. (d) Cluster analysis of the proteins significantly (FDR<., ln fold change>) regulated in conventional mice infected with Salmonella -s post-infection. (e-g) From mice in the C. difficile experiment, normalized spectral counts were plotted over time for the innate-immune proteins (e) Serotransferrin, (f) Complement C, and (g) the anti-microbial protein regenerating islet-derived protein -gamma (REG γ) (mean +/- SEM).
5 Unclassified Bacteroidales Bacteroidales Bacteroidaceae Unclassified Clostridiales Clostridiales Ruminococcaceae Enterobacteriales Enterobacteriaceae (relative to ) C. difficile (relative to ) FT (relative to ) FT + C. difficile (relative to ) Figure S. Recovery Dynamics of Individual OTUs Over Day Fecal Transplant Comparison, Related to Figure. Five of the six taxa described in Figure C are represented, as distinct plots for each of the four conditions represented in Figure. As described in Figure C, each colored line represents significant fold changes (natural log, LN) of a single OTU with respect to the same mouse s OUT levels at zero. Black lines line represents the median fold change of OTUs that significantly deviated from their zero levels. No significantly changed OTUs were found for the taxon Lactobacilliales Enterococcaceae (not shown). Numerical fold change values for all taxa can be found in Table S.
6 OTU (Bacteroides) RelativeAbundance s s + FT - 7 Day (Infection on Day ) RelativeAbundance + C. diff + FT - 7 Day (Infection on Day ) Figure S. C. difficile Infection Prevents the Recovery of a Commensal Microbe, Related to Figure. Relative abundance of OTU, a member of the Bacteroides (mean +/- SEM).
7 Table S. Treatment Perturbs the Gastrointestinal Microbiota, Related to Figure. Fold-change for all significantly-different OTUs and s post-antibiotic treatment as measured by DESeq (p<., > ln fold-change). Table S. Salmonella Infection Perturbs the Microbiota in an -Dependent Manner, Related to Figure. Fold change for all significantly-different OTUs on the of Salmonella infection in conventional and streptomycin treated mice, and for the following s, as measured by DESeq (p<., > ln fold-change). Table S. Host Proteins Regulated During -Associated Salmonella Infection, Related to Figure. The fold-change for all significantly-different host proteins when antibiotic-treated, Salmonella infected mice are compared to conventional controls as measured by QSpec (p<., > ln fold-change). Table S. Host Proteins Regulated During DSS Colitis, Related to Figure. The fold-change for all significantly-different host proteins when DSS-treated mice are compared to the same mice prior to treatment, as measured by QSpec (p<., > ln fold-change). Table S. Recovery of the Microbiota After, C. difficile Infection and Fecal Transplant, Related to Figure. The significantly-different OTUs from the groups of mice that received clindamyicn treatment throughout the last s of the experiment as measured by DESeq (p<., > ln fold-change). Table S. Protein abundance (spectral counts) corresponding with all mice and time points, Related to Figures -. Table S7. Taxon abundance (normalized S rdna sequence reads) corresponding with all mice and time points, Related to Figures, and.
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS
SUPPLEMENTAL TABLE I. Identified Proteins in Bovine Testicular Hyaluronidase Type I-S via LC-MS/MS No. Protein 1 serum albumin precursor gi 30794280 2 annexin A2 gi 27807289 3 Phosphatidylethanolamine-binding
More informationBiological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase
Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2
More informationBenakis et al. Supplementary Figure 1
Benakis et al. Supplementary Figure a flora Naive C7BL/ d AC weeks d S rrna sequencing Antibiotic in drinking water Stool pellet collection riginal seeder flora flora Naive C7BL/ d AC weeks d S rrna sequencing
More informationf(x) = x R² = RPKM (M8.MXB) f(x) = x E-014 R² = 1 RPKM (M31.
14 12 f(x) = 1.633186874x - 21.46732234 R² =.995616541 RPKM (M8.MXA) 1 8 6 4 2 2 4 6 8 1 12 14 RPKM (M8.MXB) 14 12 f(x) =.821767782x - 4.192595677497E-14 R² = 1 RPKM (M31.XA) 1 8 6 4 2 2 4 6 8 1 12 14
More informationSupporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma
Supporting Information: Protein Corona Analysis of Silver Nanoparticles Exposed to Fish Plasma Jiejun Gao 1, Lu Lin 2, Alexander Wei 2,*, and Maria S. Sepúlveda 1,* 1 Department of Forestry and Natural
More informationFigure S1, SDC Additional measures of microbial diversity during perioperative period In addition to the Shannon diversity index of Figure 1,
Figure S1, SDC Additional measures of microbial diversity during perioperative period In addition to the Shannon diversity index of Figure 1, additional measures of diversity are shown: Figure S2, SDC
More informationFIRST BIOCHEMISTRY EXAM Tuesday 25/10/ MCQs. Location : 102, 105, 106, 301, 302
FIRST BIOCHEMISTRY EXAM Tuesday 25/10/2016 10-11 40 MCQs. Location : 102, 105, 106, 301, 302 The Behavior of Proteins: Enzymes, Mechanisms, and Control General theory of enzyme action, by Leonor Michaelis
More informationNature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 NLRP12 is downregulated in biopsy samples from patients with active ulcerative colitis (UC). (a-g) NLRP12 expression in 7 UC mrna profiling studies deposited in NCBI GEO database.
More informationSupplementary Data A
Supplementary Data A Proteomic data and MS/MS fragmentation spectra from 2-DE and GeLC-MS/MS analysis of the bovine teat canal lining and the outer teat skin epithelium Table A1: 2-DE proteins spots identified
More informationSupplementary Materials
Supplementary Materials Supplementary figure 1. Taxonomic representation summarized at genus level. Fecal microbiota from a separate set of Jackson and Harlan mice prior to irradiation. A taxon was included
More informationShotgun metaproteomics of the human distal gut microbiota. Present by Lei Chen
Shotgun metaproteomics of the human distal gut microbiota Present by Lei Chen (lc6@indana.edu) Outline Background What are the goals? Materials and Methods Results Discussion Background The human gastrointestinal
More informationFig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease using MetPA analysis (panel A).
Electronic Supplementary Material (ESI) for Molecular BioSystems. This journal is The Royal Society of Chemistry 2015 Fig. S1. Summary of the altered metabolism pathways in alcoholic fatty liver disease
More informationRole of the Gut Microbiota in Autoimmunity
Role of the Gut Microbiota in Autoimmunity Pavan Bhargava, MD - Neuroimmunology Fellow Division of Neuroimmunology and Neurological Infections Johns Hopkins University, Baltimore, MD. May, 2015 None Disclosures
More informationSwissProt/ TrEmbl Acc. No. 1 Description. Found in Other Studies 5. MW (kda) 2 pi 3 Function 4
P02774 Vitamin D-binding protein precursor 52.95 5.4 Cell communication c, a,b S,C P08833 Insulin-like growth factor binding protein 1 precursor 27.88 5.1 Cell communication c, a P02760 AMBP protein precursor
More informationTable S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
More informationSupplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
More informationMitochondria and ATP Synthesis
Mitochondria and ATP Synthesis Mitochondria and ATP Synthesis 1. Mitochondria are sites of ATP synthesis in cells. 2. ATP is used to do work; i.e. ATP is an energy source. 3. ATP hydrolysis releases energy
More informationREGULATION OF ENZYME ACTIVITY. Medical Biochemistry, Lecture 25
REGULATION OF ENZYME ACTIVITY Medical Biochemistry, Lecture 25 Lecture 25, Outline General properties of enzyme regulation Regulation of enzyme concentrations Allosteric enzymes and feedback inhibition
More informationSeparation of Main Proteins in Plasma and Serum
BCH 471 Experiment (2) Separation of Main Proteins in Plasma and Serum PLASMA PROTEINS Mw The main plasma proteins are: þ Albumin (36-50 g/l), Mw 66.241kDa. þ Globulins (18-32 g/l), Mw of globulins Cover
More informationFOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH
FOR OPTIMAL GUT HEALTH KEMIN.COM/GUTHEALTH ALETA A SOURCE OF 1,3-BETA GLUCANS Aleta is highly bioavailable, offering a concentration greater than 5% of 1,3-beta glucans. Aleta provides a consistent response
More informationSupporting Information
Comparative Proteomic Study of Fatty Acid-treated Myoblasts Reveals Role of Cox-2 in Palmitate-induced Insulin Resistance Supporting Information Xiulan Chen 1#, Shimeng Xu 2,3#, Shasha Wei 1,3, Yaqin Deng
More informationSupporting Information
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2018 Supporting Information Covalent functionalization of graphene oxide with
More informationFig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at
Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake
More informationThe Gut Microbiota: Evidence For Gut Microbes as Contributors to Weight Gain
The Gut Microbiota: Evidence For Gut Microbes as Contributors to Weight Gain Michael T. Bailey, Ph.D. Center for Microbial Pathogenesis The Research Institute, Nationwide Children s Hospital Department
More informationTECHNICAL NOTE. Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive
TECHNICAL NOTE Accurate and fast proteomics analysis of human plasma with PlasmaDive and SpectroDive In this technical note you will learn about: Step-by-step set-up of parallel reaction monitoring (PRM)
More informationTHE ROLE OF MICROBIOME IN IBD
Disclosures THE ROLE OF MICROBIOME IN IBD Janssen UCB No relevance to the talk Subra Kugathasan, MD Professor of Pediatrics & Human Genetics Marcus Professor of Pediatric Gastroenterology Emory University
More informationFecal Microbiota Transplantation for Severe sepsis and Diarrhea : a Case Report
Fecal Microbiota Transplantation for Severe sepsis and Diarrhea : a Case Report Qiurong Li Institute of General Surgery, Jinling Hospital Nanjing Univeristy Gut Microbiota 100 trillion cells 10-fold of
More informationRevision. camp pathway
االله الرحمن الرحيم بسم Revision camp pathway camp pathway Revision camp pathway Adenylate cyclase Adenylate Cyclase enzyme Adenylate cyclase catalyses the formation of camp from ATP. Stimulation or inhibition
More informationPhagocytosis: An Evolutionarily Conserved Mechanism to Remove Apoptotic Bodies and Microbial Pathogens
Phagocytosis of IgG-coated Targets by s Phagocytosis: An Evolutionarily Conserved Mechanism to Remove Apoptotic Bodies and Microbial s 3 min 10 min Mast Cells Can Phagocytose Too! Extension of an F-actin-rich
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationSupplementary Table 1: Motor-clutch gene mrna expression Myosin Motors
Supplementary Table 1: Motor-clutch gene mrna expression Myosin Motors Symbol Description Expression Rank MYL6 myosin, light chain 6, alkali, smooth muscle and non-muscle 11903 79 MYH9 myosin, heavy chain
More informationDepartment of Chemistry, Université de Montréal, C.P. 6128, Succursale centre-ville, Montréal, Québec, H3C 3J7, Canada.
Phosphoproteome dynamics of Saccharomyces cerevisiae under heat shock and cold stress Evgeny Kanshin 1,5, Peter Kubiniok 1,2,5, Yogitha Thattikota 1,3, Damien D Amours 1,3 and Pierre Thibault 1,2,4 * 1
More informationValidated Mouse Quantitative RT-PCR Genes Gene Gene Bank Accession Number Name
5HT1a NM_008308.4 Serotonin Receptor 1a 5HT1b NM_010482.1 Serotonin Receptor 1b 5HT2a NM_172812.2 Serotonin Receptor 2a ACO-2 NM_080633.2 Aconitase 2 Adora2A NM_009630.02 Adenosine A2a Receptor Aif1 (IbaI)
More informationFigure S1: Abundance of Fe related proteins in oceanic Synechococcus sp. strain WH8102 in. Ferredoxin. Ferredoxin. Fe ABC transporter
0.004 SW nm 0.04 0.03 nm nm 0.16 0.1 nm nm 0.40 0.3 nm nm 0.80 0.5 nm 1.6 1 nm 16 10 nm 160 100 nm 0 nm 0.04 nm 0.16 nm 0.40 nm 0.80 nm 1.6 nm 16 nm 160 nm Spectral counts 0 nm 0.04 nm 0.16 nm 0.40 nm
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12198 1. Supplementary results 1.1. Associations between gut microbiota, glucose control and medication Women with T2D who used metformin had increased levels of Enterobacteriaceae (i.e.
More informationMinjia Tan, Ph.D Shanghai Institute of Materia Medica, Chinese Academy of Sciences
Lysine Glutarylation Is a Protein Posttranslational Modification Regulated by SIRT5 Minjia Tan, Ph.D Shanghai Institute of Materia Medica, Chinese Academy of Sciences Lysine: the most frequently modified
More informationBIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001
BIOL 4374/BCHS 4313 Cell Biology Exam #1 February 13, 2001 SS# Name This exam is worth a total of 100 points. The number of points each question is worth is shown in parentheses. Good luck! 1. (2) The
More informationName Class Date. 1. Cellular respiration is the process by which the of "food"
Name Class Date Cell Respiration Introduction Cellular respiration is the process by which the chemical energy of "food" molecules is released and partially captured in the form of ATP. Carbohydrates,
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/3/2/e1602038/dc1 Supplementary Materials for Mitochondrial metabolic regulation by GRP78 Manoj Prasad, Kevin J. Pawlak, William E. Burak, Elizabeth E. Perry, Brendan
More informationSequence Coverage (%) Profilin-1 P UD 2
Protein Name Accession Number (Swissprot) Sequence Coverage (%) No. of MS/MS Queries Mascot Score 1 Reference Cytoskeletal proteins Beta-actin P60709 37 14 298 Alpha-actin P68032 33 10 141 20 Beta-actin-like
More informationGut Immune Maturation Depends on Colonization with a Host-Specific Microbiota
Journal Club Gut Immune Maturation Depends on Colonization with a Host-Specific Microbiota Hachung Chung, 1,2 Sünje J. Pamp, 3,6 Jonathan A. Hill, 2,8 Neeraj K. Surana, 1,2,7 Sanna M. Edelman, 1,2 Erin
More informationSupporting Information. Synthesis of Zwitterionic Polymer Particles via Combined Distillation
Supporting Information Synthesis of Zwitterionic Polymer Particles via Combined Distillation Precipitation Polymerization and Click Chemistry for Highly Efficient Enrichment of Glycopeptide Jianxi Liu,
More informationtraits and fasdng TMAO concentradons..6
FIGURE S1: Variability of gut microbiota composidon in Metsim samples 2 FIGURE S2: AssociaDon of bacterial diversity and richness measures with traits.3 FIGURE S3: AssociaDons of OTUs with fasdng blood
More informationSupplementary Figure 1.
Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP
More informationChemistry 107 Exam 4 Study Guide
Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and
More informationMITOCHONDRIA LECTURES OVERVIEW
1 MITOCHONDRIA LECTURES OVERVIEW A. MITOCHONDRIA LECTURES OVERVIEW Mitochondrial Structure The arrangement of membranes: distinct inner and outer membranes, The location of ATPase, DNA and ribosomes The
More informationA) Choose the correct answer: 1) Reduction of a substance can mostly occur in the living cells by:
Code: 1 1) Reduction of a substance can mostly occur in the living cells by: (a) Addition of oxygen (b) Removal of electrons (c) Addition of electrons (d) Addition of hydrogen 2) Starting with succinate
More informationTable S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function
Table S9A: List of taurine regulated genes in Bp K96243 Chr 1 (up regulated >=2 fold) Cluster no GENE ID Start Stop Strand Function 1 BPSL0024 26223 26621 + LrgA family BPSL0025 26690 27412 + hypothetical
More informationThe Potential For Microbiome Modification In Critical Illness. Deborah Cook
The Potential For Microbiome Modification In Critical Illness Deborah Cook To review Objectives The microbiome & concepts about its modification during critical illness Interventions Predisposition to
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationthe nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids
the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma
More informationGrowth and Morbidity of Gambian Infants are Influenced by Maternal Milk Oligosaccharides and Infant Gut Microbiota
Growth and Morbidity of Gambian Infants are Influenced by Maternal Milk Oligosaccharides and Infant Gut Microbiota Authors: Jasmine C. C. Davis 1,2, Zachery T. Lewis 2,3, Sridevi Krishnan 4, Robin M. Bernstein
More informationProteomic Analysis of Glomeruli in Diabetes 1
Proteomic Analysis of Glomeruli in Diabetes 1 Table 1: Identified Proteins from Mouse Glomerular Proteome Map spot# ; Regulation Functional swiss prot mass with group Protein entry (kda) pi Diabetes* Cytoskeletal
More informationChapter 14 - Electron Transport and Oxidative Phosphorylation
Chapter 14 - Electron Transport and Oxidative Phosphorylation The cheetah, whose capacity for aerobic metabolism makes it one of the fastest animals Prentice Hall c2002 Chapter 14 1 14.4 Oxidative Phosphorylation
More informationPlease check the slides
Quick review of main concepts: The major plasma proteins are : albumin, globulin and fibrenogen globulin consists of 3 types: α, β and γ α globulin is divided into 2 types : α1 (includes α1 antitrypsin
More informationSupplemental Information:
SupplementalInformation: Content: FigureS1.AccessibilityoftheL.interrogansproteomebyLC MSanalysis. FigureS2.Functionalannotationoftheidentifiedproteins. FigureS3.DistributionofMS1 featureintensities. FigureS4.ComparisonoftheDDA
More informationGenetics. Environment. You Are Only 10% Human. Pathogenesis of IBD. Advances in the Pathogenesis of IBD: Genetics Leads to Function IBD
Advances in the Pathogenesis of IBD: Genetics Leads to Function Pathogenesis of IBD Environmental Factors Microbes Scott Plevy, MD Associate Professor of Medicine, Microbiology & Immunology UNC School
More informationOxidative Phosphorylation
Electron Transport Chain (overview) The NADH and FADH 2, formed during glycolysis, β- oxidation and the TCA cycle, give up their electrons to reduce molecular O 2 to H 2 O. Electron transfer occurs through
More informationGlycolysis - Plasmodium
Apicomplexan Biochemistry Basics Toxoplasma Good cell biology model Genome sequencing not completed Virtual pathways Cryptosporidium The strange one Genome sequence completed Virtual pathways Plasmodium
More informationFigure 1 Original Advantages of biological reactions being catalyzed by enzymes:
Enzyme basic concepts, Enzyme Regulation I III Carmen Sato Bigbee, Ph.D. Objectives: 1) To understand the bases of enzyme catalysis and the mechanisms of enzyme regulation. 2) To understand the role of
More informationEnzyme Regulation I. Dr. Kevin Ahern
Enzyme Regulation I Dr. Kevin Ahern Enzyme Regulation Mechanisms Enzyme Regulation Mechanisms 1. Allosterism Enzyme Regulation Mechanisms 1. Allosterism 2. Covalent Modification Enzyme Regulation Mechanisms
More informationcollected for biochemical and molecular microbiological analyses at baseline, week 4 and
SUPPLEMENTARY FIGURE LEGENDS Figure S1 Study design. Figure was adapted from Paramsothy et al. 5 Blood and stool samples were collected for biochemical and molecular microbiological analyses at baseline,
More informationBiological Sciences 4087 Exam I 9/20/11
Name: Biological Sciences 4087 Exam I 9/20/11 Total: 100 points Be sure to include units where appropriate. Show all calculations. There are 5 pages and 11 questions. 1.(20pts)A. If ph = 4.6, [H + ] =
More informationCell-Derived Inflammatory Mediators
Cell-Derived Inflammatory Mediators Introduction about chemical mediators in inflammation Mediators may be Cellular mediators cell-produced or cell-secreted derived from circulating inactive precursors,
More informationMALDI mass spectrometry based molecular phenotyping of CNS glial cells for prediction in mammalian brain tissue
Analytical and Bioanalytical Chemistry Electronic Supplementary Material MALDI mass spectrometry based molecular phenotyping of CNS glial cells for prediction in mammalian brain tissue Jörg Hanrieder,
More informationGenes behind good bovine embryo quality
Genes behind good bovine embryo quality Kati Korhonen, A. Pasternack, E. Ketoja, M. Räty, M. Laitinen, O. Ritvos, J. Vilkki, J. Peippo MTT Agrifood Research Finland 4 th SABRE Conference / 60 th Annual
More informationVITAMINS, MINERALS AND THE GUT
VITAMINS, MINERALS AND THE GUT Nutrients Looking at individual nutrients that are involved with gut health can be misleading This is not about taking individual nutrients It supports more a whole food
More informationElectron Transport Chain and Oxidative phosphorylation
Electron Transport Chain and Oxidative phosphorylation So far we have discussed the catabolism involving oxidation of 6 carbons of glucose to CO 2 via glycolysis and CAC without any oxygen molecule directly
More informationFigure S3 Differentially expressed fungal and plant genes organised by catalytic activity ontology Organisation of E. festucae (A) and L.
sak WT Number of branches 3 WT sak Figure S1 Vasculature of plants infected with the E. festucae sak mutant. Light micrographs of perennial ryegrass blade tissue showing branching between the vasculature
More informationImmuno_BeadChip_ (Illumina Inc., San Diego, CA, USA) according to the
Supplementary Methods Genotyping of the Milwaukee cohort DNA samples were genotyped for 196,524 markers using the Human Immuno_BeadChip_1149691 (Illumina Inc., San Diego, CA, USA) according to the manufacture's
More informationPCB 3023 Exam 4 - Form A First and Last Name
PCB 3023 Exam 4 - Form A First and Last Name Student ID # (U Number) A Before beginning this exam, please complete the following instructions: 1) Write your name and U number on the first page of this
More informationDietary Zinc Alters the Microbiota and Decreases Resistance to Clostridium difficile Infection
1 Dietary Zinc Alters the Microbiota and Decreases Resistance to Clostridium difficile Infection 2 3 4 5 Joseph P. Zackular 1, Jessica L. Moore 2,3, Ashley T. Jordan 1, Lillian J. Juttukonda 1, Michael
More informationSupplementary Figure 1
Supplementary Figure 1 Full inter-omic cross-sectional correlation network Statistically-significant inter-omic cross-sectional Spearman correlations (p adj
More informationProtein carbonylation: a marker of oxidative stress damage
Protein carbonylation: a marker of oxidative stress damage ITN-TREATMENT Metabolic Dysfunctions associated with Pharmacological Treatment of Schizophrenia TREATMENT Protein carbonyl formation: Metal-Catalyzed
More informationBiochem sheet (5) done by: razan krishan corrected by: Shatha Khtoum DATE :4/10/2016
Biochem sheet (5) done by: razan krishan corrected by: Shatha Khtoum DATE :4/10/2016 Note about the last lecture: you must know the classification of enzyme Sequentially. * We know that a substrate binds
More informationSupplementary Figures and Tables
Supplementary Figures and Tables Supplementary Figure 1. Intestinal epithelial MyD88 deletion decreases fat mass under HFD. (a) Final fat mass expressed as a percentage of final body weight (n=25). (b)
More informationSignificance of the MHC
CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
More informationChapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level. From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D.
Chapter 9: Biochemical Mechanisms for Information Storage at the Cellular Level From Mechanisms of Memory, second edition By J. David Sweatt, Ph.D. Chapter 9: Dendritic Spine Figure 1 Summary: Three Primary
More informationConsistent and Reproducible Production of a Microbiota-based Drug for Recurrent C. difficile
Consistent and Reproducible Production of a Microbiota-based Drug for Recurrent C. difficile Infection: Application of a Novel Diagnostic for Dysbiosis Courtney Jones, BS Rebiotix Inc. Roseville, MN USA
More informationGut Microbiomes of Malawian Twin Pairs Discordant for Kwashiorkor
Gut Microbiomes of Malawian Twin Pairs Discordant for Kwashiorkor Michelle I. Smith et al. Science 339, 548 (2013) Dept Meeting, 28 May 2013, M. UMEZAKI ABSTRACT. Kwashiorkor, an enigmatic form of severe
More informationIntroduction! Introduction! Introduction! Chem Lecture 10 Signal Transduction & Sensory Systems Part 2
Chem 452 - Lecture 10 Signal Transduction & Sensory Systems Part 2 Questions of the Day: How does the hormone insulin trigger the uptake of glucose in the cells that it targets. Introduction! Signal transduction
More informationThe enteric microbiota: Implications for IBD. Eugene B. Chang, M.D. University of Chicago
The enteric microbiota: Implications for IBD Eugene B. Chang, M.D. University of Chicago On a per cell basis, humans are mostly prokaryote 100 90 80 70 60 50 40 30 20 10 0 EuK ProK The microbial flora
More informationThe Major Histocompatibility Complex (MHC)
The Major Histocompatibility Complex (MHC) An introduction to adaptive immune system before we discuss MHC B cells The main cells of adaptive immune system are: -B cells -T cells B cells: Recognize antigens
More informationWeek 3 The Pancreas: Pancreatic ph buffering:
Week 3 The Pancreas: A gland with both endocrine (secretion of substances into the bloodstream) & exocrine (secretion of substances to the outside of the body or another surface within the body) functions
More informationProtein Homeostasis in Mitochondria: Chaperones and Proteases of the Mitochondrial Matrix Prof. Wolfgang Voos
Protein Homeostasis in Mitochondria: Chaperones and Proteases of the Mitochondrial Matrix Institute for Biochemistry and Molecular Biology (IBMB) University of Bonn, Germany wolfgang.voos@uni-bonn.de 1
More informationEssential Biology 3.2 Carbohydrates, Lipids, Proteins. 1. Define organic molecule.
1. Define organic molecule. An organic molecule is a molecule that contains carbon and is found in living things. There are many organic molecules in living things. The same (or very similar) molecules
More information4/17/2019 DISCLOSURES OBJECTIVES GI MICROBIOME & HEALTH: A REVIEW. Nancy C. Kois, MD, FCAP Contemporary Pathology Services. There are no disclosures
GI MICROBIOME & HEALTH: A REVIEW Nancy C. Kois, MD, FCAP Contemporary Pathology Services DISCLOSURES There are no disclosures OBJECTIVES Definitions: GI microbiota, GI microbiome, probiotic, prebiotic
More informationCELL BIOLOGY - CLUTCH CH AEROBIC RESPIRATION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF AEROBIC RESPIRATION Cellular respiration is a series of reactions involving electron transfers to breakdown molecules for (ATP) 1. Glycolytic pathway: Glycolysis
More informationChapter 14. Energy conversion: Energy & Behavior
Chapter 14 Energy conversion: Energy & Behavior Why do you Eat and Breath? To generate ATP Foods, Oxygen, and Mitochodria Cells Obtain Energy by the Oxidation of Organic Molecules Food making ATP making
More information1- Which of the following statements is TRUE in regards to eukaryotic and prokaryotic cells?
Name: NetID: Exam 3 - Version 1 October 23, 2017 Dr. A. Pimentel Each question has a value of 4 points and there are a total of 160 points in the exam. However, the maximum score of this exam will be capped
More informationNAME KEY ID # EXAM 3a BIOC 460. Wednesday April 10, Please include your name and ID# on each page. Limit your answers to the space provided!
EXAM 3a BIOC 460 Wednesday April 10, 2002 Please include your name and ID# on each page. Limit your answers to the space provided! 1 1. (5 pts.) Define the term energy charge: Energy charge refers to the
More informationSupplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
More informationRho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
More informationProtein name Location Family MW (kda)
Supplementary Information, Table S1. Proteomic results from LC-MS/MS analysis of MC/9 exosomes. Proteins of MC/9 exosomes were collected in the stacking parts of an SDS-PAGE, cut out, trypsinated and analysed
More informationProtein Name. IFLENVIR,DSVTYTEHAK,TV TALDVVYALK,KTVTALDVV YALK,TVTALDVVYALKR,IF LENVIRDSVTYTEHAK gi Histone H2B
Table 1. A functional category list of proteins (Lentinula edodes) identified by 1-DGE and nesi-lc-ms/ms. The table lists indicated fraction numbers, matching peptides, scores, accession numbers, protein
More informationImmunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells
Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard
More informationHSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)
Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis
More informationGMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS
GMI STUDY. COMPARATIVE PROTEOMIC STUDY BETWEEN GMI and STRAUMANN DENTAL IMPLANTS 2 Hypothesis. Proteomic study of first protein layer Post-implantation, the biomaterial becomes in contact with the blood,
More informationT Lymphocyte Activation and Costimulation. FOCiS. Lecture outline
1 T Lymphocyte Activation and Costimulation Abul K. Abbas, MD UCSF FOCiS 2 Lecture outline T cell activation Costimulation, the B7:CD28 family Inhibitory receptors of T cells Targeting costimulators for
More informationT H E J O U R N A L O F C E L L B I O L O G Y
T H E J O U R N A L O F C E L L B I O L O G Y Supplemental material Amelio et al., http://www.jcb.org/cgi/content/full/jcb.201203134/dc1 Figure S1. mir-24 regulates proliferation and by itself induces
More information