U118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
|
|
|
- Martin Bailey
- 5 years ago
- Views:
Transcription
1 A172 CCF-SSTG T98G U373MG U178MG TP365MG U118MG U251MG - U118MG Supplementary Figure 1
2 Supplementary Table 1. Patient characteristics of astrocytic glioma samples on the tissue microarrays (TMAs) TMA AJAP1 TMA EMP3 TMA PDPN Age (y) Mean Minimum Maximum Gender Male 128 (64%) 131 (66%) 36 (57%) Female 72 (36%) 69 (34%) 27 (43%) WHO grade II 20 (10%) 21 (1%) 9 (14.3%) III 8 (4%) 10 (5%) 11 (17.5%) IV 172 (86%) 169 (84.5%) 42 (66.7%) unknown 1(%) Chemotherapy Yes 11 (6%) 10 (5%) 25 (39.7%) No 189 (94%) 190 (95%) 15 (23.8%) Unknown 23 (36.5%) Radiotherapy Yes 158 (79%) 158 (79%) 44 (69.8%) No 42 (21%) 42 (21%) 1 (1.6%) Unknown 18 (28.6%) Total
3 Supplementary Table 2. Primers used for quantitative RT-PCR Target gene Forward primer Reverse primer METTL7B 5 -GCTCCATGGATGTGGTGGTC-3 5 -AAAGAGCACACCTCCCGGTC-3 CDKN1A 5 -GGCAGACCAGCATGACAGATT-3 5 -GCGGATTAGGGCTTCCTCTT-3 EMP3 5 -TGCACGTGGAACAACGACAC-3 5 -CTCGTCGCATGGTGTAGAGC-3 PDPN 5 -ACGATGTGGAAGGTGTCAGCT-3 5 -AGCCAGACTTATAGCGGTCTTCG-3 CENPF 5 -ACCAGAAGCGGGCGAATTGG-3 5 -GAGCTCTTGTAGGCAGCCCT-3 UHRF1 5 -GACTCGCTGTCCAGGCTGAC-3 5 -GTGTCATTCAGGCGGACCTC-3 NUP GCAGCCAACTTTGGTTGTGTG-3 5 -CTGTTTCCGTGCAGTCCGTG-3 CCNB2 5 -AGTTGGCTCCAAAGGGTCCT-3 5 -CGTAGTCACTGCAGAGCTGAGG-3 AJAP1 5 -TCCCTCATCATGGTCATAGCTGC- 5 -TGCAGGGTCTCGTTATAGGCCGTG-3 RTN1 5 -GCATCGTGTTTGGGAGTTTCCTGC- 5 -AGGAAGAGCCTCCTCAGTTCC-3 GABBR1 5 -TCCACAACCCTACCCGCGTGAA-3 5 -TTTGACGGGCACAGCTGGATCTG-3
4 Supplementary Table 3. Amplifications and putative homozygous deletions detected by array-cgh in 20 GBM spheroid cultures High-level amplifications Localization Start clone End clone Size (Mb) Candidate gene (s) (%) 1p21.1 RP5-936J12 RP5-936J COL11A1 5 1p34.3-1p34.2 RP4-615P17 RP11-72N PABPC4, ZMPSTE24 5 1q31.1 RP11-201A3 RP11-201A No annotated gene 5 1q32.1 RP11-203F10 RP11-430C MDM4 10 2p23.3 RP11-558C24 RP11-558C RAB10 5 4q12 RP11-317M11 RP11-463H12 3 PDGFRA 20 5q35.1 RP11-117L6 RP11-779O NPM1 5 6p22.3 RP1-177P22 RP11-33I E2F3 5 7p11.2 RP11-449G3 RP11-339F EGFR 15 7q31.1-7q31.32 RP11-45K3 RP11-384A PTPRZ1 5 8q24.21 RP11-351C8 RP1-80K MYC 20 11p13 RP5-1083G3 RP11-48O WT1 5 12p13.32 RP11-543P15 RP11-264f CCND2 5 12q14.1 RP11-571M6 RP11-155I CDK q15 RP11-611O2 RP11-611O MDM2 35 Putative homozygous deletions 1p36 RP5-1096P7 RP3-410I AJAP1 5 1p35.2 RP4-742P4 RP11-336O p34 RP11-100H21 RP5-848E p33 RP4-697E16 RP11-20F q35.1 RP11-13N11 CTC-963K p15.2 CTC-485I21 RP3-502L p21.2 RP11-299D14 RP11-263C q21.13 RP11-86O7 RP11-216N p21.3 RP11-15P13 RP11-495L19 3,38 CDKN2A. CDKN2B 35 10q23.31 RP11-165M8 RP11-186O PTEN 5
5 11q24.3 RP11-122H4 RP11-469N q12 RP11-210N13 RP11-474P q13.2 RP11-330O19 RP11-561B
6 Supplementary Table 4. Top ranked highly expressed genes in spheroid cultures (n=10) Gene symbol FC to nonneoplastic brain Description FC to nonneoplastic spheroid culture* ACTG Actin, gamma HNRPA Heterogeneous nuclear ribonucleoprotein A CDK Cyclin-dependent kinase IGFBP Insulin-like growth factor binding protein 2, 2.31 NUSAP Nucleolar and spindle associated protein VIM 3.04 Vimentin 0.06 PTPRZ Protein tyrosine phosphatase, receptor-type, Z polypeptide UBE2C 2.88 Ubiquitin-conjugating enzyme E2C 1.16 CDKN1A 2.82 Cyclin-dependent kinase inhibitor 1A 1.34 PDGFRA 2.81 Platelet-derived growth factor receptor, alpha polypeptide CCNB Cyclin B TSPAN3 2.7 Tetraspanin ANXA Annexin A CDK Cyclin-dependent kinase NUP Nucleoporin Nup KIAA KIAA KCNQ2 9 Potassium voltage-gated channel, KQT-like subfamily, member FAM119B 8 Family with sequence similarity 119, member B 0.31 HNRPK 8 Heterogeneous nuclear ribonucleoprotein K 5.14 UHRF1 6 Ubiquitin-like, containing PHD and RING finger domains, TUBA6 4 Tubulin, alpha 1c 1.63 NES 4 Nestin 2.25 METTL7B 3 Methyltransferase like 7B 2.34 TMSL8 2 Thymosin-like CBX2 1 Chromobox homolog TNC Tenascin C 4.77 CDCA Cell division cycle associated GAS Growth arrest-specific TYMS 2.41 Thymidylate synthetase 1.32
7 PBK 2.4 PDZ binding kinase 1.11 FAM60A 2.37 Family with sequence similarity 60, member A 1.76 TNFRSF Tumor necrosis factor receptor superfamily, member 19 6 PTTG Pituitary tumor-transforming SOX SRY (sex determining region Y)-box H H19, imprinted maternally expressed transcript HOXA Homeobox A CENPF 2.3 Centromere protein F, 350/400ka (mitosin) 0.85 MYC 2.29 V-myc myelocytomatosis viral oncogene homolog (avian) 1.73 EMP Epithelial membrane protein 3 19 RPL Ribosomal protein L NPM Nucleophosmin S100A S100 calcium binding protein A CD CD44 molecule PDPN 2.22 Podoplanin 9.02 median fold change compared to non-neoplastic brain (n = 5, pooled) expressed as log-2 ratio * median fold change compared to spheroid culture isolated from non-neoplastic brain expressed as log-2 ratio
8 Supplementary Table 5. Relationship between expression of candidate genes and WHO grade WHO grades sgbm pgbm II-III low AJAP1 expression 8 (28%) 2 (100%) 93 (55%) high AJAP1 expression 20 (72%) 0 (0%) 77 (45%) low EMP3 expression 26 (84%) 2 (67%) 73 (44%) high EMP3 expression 5 (16%) 1 (33%) 93 (56%) low PDPN expression 17 (85%) 3 (100%) 6 (15%) high PDPN expression 3 (15%) 0 (0%) 33 (85%) Abbreviations: sgbm, secondary glioblastoma; pgbm, primary glioblastoma
SUPPLEMENTARY FIGURES AND TABLES
PD 0332991, a selective cyclin D kinase 4/6 inhibitor, sensitizes lung cancer cells to treatment with epidermal growth factor receptor tyrosine kinase inhibitors SUPPLEMENTARY FIGURES AND TABLES Supplementary
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion
Probe Set ID RefSeq Transcript ID Gene Title Gene Symbol 205980_s_at NM_001017526 /// NM_181334 /// NM_181335 Rho GTPase activating protein 8 /// PRR5- ARHGAP8 fusion ARHGAP8 /// LOC553158 FC ALK shrna
SUPPLEMENTARY DATA. Assessment of cell survival (MTT) Assessment of early apoptosis and cell death
Overexpression of a functional calcium-sensing receptor dramatically increases osteolytic potential of MDA-MB-231 cells in a mouse model of bone metastasis through epiregulinmediated osteoprotegerin downregulation
gliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
Table S1 Differentially expressed genes showing > 2 fold changes and p <0.01 for 0.01 mm NS-398, 0.1mM ibuprofen and COX-2 RNAi.
Table S1 Differentially expressed genes showing > 2 fold changes and p
Supplemental Table 1 Age and gender-specific cut-points used for MHO.
Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123
Supplementary Information
Supplementary Information Temozolomide suppresses MYC via activation of TAp63 to inhibit progression of human glioblastoma Tomohiro Yamaki, Yusuke Suenaga, Toshihiko Iuchi, Jennifer Alagu, Atsushi Takatori,
Genomic Analyses across Six Cancer Types Identify Basal-like Breast Cancer as a Unique Molecular Entity
Genomic Analyses across Six Cancer Types Identify Basal-like Breast Cancer as a Unique Molecular Entity Aleix Prat, Barbara Adamo, Cheng Fan, Vicente Peg, Maria Vidal, Patricia Galván, Ana Vivancos, Paolo
Genomic analysis of childhood High grade glial (HGG) brain tumors
Genomic analysis of childhood High grade glial (HGG) brain tumors Linda D Cooley Children s Mercy, Kansas City The Children s Mercy Hospital, 2017 Genomic analysis of childhood High grade glial (HGG) brain
RT 2 Profiler PCR Array:
RT 2 Profiler PCR Array: Rat Cell Cycle Catalog Number For Real-Time Instruments: PARN-020A ABI Standard Blocks; Bio-Rad icycler, MyiQ, and (MJ Research) Chromo 4; and Stratagene Mx3005p, Mx3000p PARN-020C
Prof. R. V. Skibbens. Cell Cycle, Cell Division and Cancer (Part 2)
Prof. R. V. Skibbens November 22, 2010 BIOS 10: BioScience in the 21 st Century Cell Cycle, Cell Division and Cancer (Part 2) Directionality - clocks go in only one direction G1 doesn t have replication-inducing
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/364/ra18/dc1 Supplementary Materials for The tyrosine phosphatase (Pez) inhibits metastasis by altering protein trafficking Leila Belle, Naveid Ali, Ana Lonic,
Numerous hypothesis tests were performed in this study. To reduce the false positive due to
Two alternative data-splitting Numerous hypothesis tests were performed in this study. To reduce the false positive due to multiple testing, we are not only seeking the results with extremely small p values
CPT Codes for Pharmacogenomic Tests
CPT s for Pharmacogenomic Tests The table below lists CPT codes and lab fee information for pharmacogenomic tests as established by the Centers for Medicare and Medicaid Services. It was compiled by the
Supplementary Information
Scientific Reports Supplementary Information Upregulated expression of FGF13/FHF2 mediates resistance to platinum drugs in cervical cancer cells Tomoko Okada, Kazuhiro Murata, Ryoma Hirose, Chie Matsuda,
Oncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber
Oncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber jweber@dom.wustl.edu Oncogenes & Cancer DNA Tumor Viruses Simian Virus 40 p300 prb p53 Large T Antigen Human Adenovirus p300 E1A
Supplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
PI3-Kinase Signaling. Rational Incorporation of Novel Agents into Multimodality Therapy. PI3-kinase. PI3-kinase 5/2/2010
Rational Incorporation of Novel Agents into Multimodality Therapy I3-Kinase Signaling EGF IRS1 I3K EGFR I2 I3 TEN Rictor GßL AKT RAS40 Survival Raptor GßL Daphne Haas-Kogan UCSF Annual Course April 30-May
Cell cycle and Apoptosis. Chalermchai Mitrpant
Cell cycle and Apoptosis 2556 Chalermchai Mitrpant Overview of the cell cycle Outline Regulatory mechanisms controlling cell cycle Progression of the cell cycle Checkpoint of the cell cycle Phases of the
Supplementary Figure 1. Copy Number Alterations TP53 Mutation Type. C-class TP53 WT. TP53 mut. Nature Genetics: doi: /ng.
Supplementary Figure a Copy Number Alterations in M-class b TP53 Mutation Type Recurrent Copy Number Alterations 8 6 4 2 TP53 WT TP53 mut TP53-mutated samples (%) 7 6 5 4 3 2 Missense Truncating M-class
Prof. R. V. Skibbens
Prof. R. V. Skibbens December 2, 2011 BIOS 10: BioScience in the 21 st Century Cell Cycle, Cell Division and Cancer (Part 2) Directionality The Cell Cycle clock goes in only one direction S-phase cells
SIRT6 histone deacetylase functions as a potential oncogene in human melanoma -
SIRT6 histone deacetylase functions as a potential oncogene in human melanoma - Garcia-Peterson et al Supplementary Figure S:Tissue microarray (TMA) staining and organization. A) Diagram of the TMA indicating
Diagnostic test Suggested website label Description Hospitals available
Diagnostic test Suggested website label Description Hospitals available Abbott Molecular Inc, PATHVYSION HER-2 DNA Probe Kit (FISH) PathVysion kit A diagnostic tool used to determine whether a particular
Targeting voltage-gated K + channels in cancer reveal new biochemical pathways and therapeutic opportunities
July 7 th, 2015 Structure, Function and Engineering of Ion Channels Targeting voltage-gated K + channels in cancer reveal new biochemical pathways and therapeutic opportunities Saverio Gentile, Ph.D. Department
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Figure S1. Clinical significance of ZNF322A overexpression in Caucasian lung cancer patients. (A) Representative immunohistochemistry images of ZNF322A protein expression in tissue
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice
Supplementary Figure 1: Fn14 is upregulated in the epidermis and dermis of mice undergoing AD- and psoriasis-like disease. Immunofluorescence staining for Fn14 (green) and DAPI (blue) in skin of naïve
Maturity-onset diabetes of the young (MODY) is a heterogeneous group
Over the years, different forms of maturity-onset diabetes of the young (MODY) have been identified, with mutations in a number of different genes associated with a MODY-like phenotype. Depending on the
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
Supplementary Data. Reference
Supplementary Data Supplementary Methods Cloning of the mir-155 and mir-221/222 genes Genomic DNA was isolated from hmsc-tert20 cells using the High Pure PCR Template Preparation Kit (Roche Applied Science,
Supplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from
A 16-Gene Signature Distinguishes Anaplastic Astrocytoma from Glioblastoma
A 16-Gene Signature Distinguishes Anaplastic Astrocytoma from Glioblastoma Soumya Alige Mahabala Rao 1, Sujaya Srinivasan 1, Irene Rosita Pia Patric 1, Alangar Sathyaranjandas Hegde 3, Bangalore Ashwathnarayanara
IDENTIFICATION OF BIOMARKERS FOR EARLY DIAGNOSIS OF BREAST CANCER"
IDENTIFICATION OF BIOMARKERS FOR EARLY DIAGNOSIS OF BREAST CANCER" Edmond Marzbani, MD December 2, 2008 Early diagnosis of cancer Many solid tumors are potentially curable if diagnosed at an early stage
Cancer genetics
Cancer genetics General information about tumorogenesis. Cancer induced by viruses. The role of somatic mutations in cancer production. Oncogenes and Tumor Suppressor Genes (TSG). Hereditary cancer. 1
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature14122 Supplementary Table 1: EZH2 Co-Expression Gene Signature Top 116 genes co-expressed with EZH2 across 9 Oncomine studies Gene Description Symbol ALS2CR4
Numerous hypothesis tests were performed in this study. To reduce the false positive due to
Two alternative data-splitting Numerous hypothesis tests were performed in this study. To reduce the false positive due to multiple testing, we are not only seeking the results with extremely small p values
Is genomic grading killing histological grading?
Is genomic grading killing histological grading? Christos Sotiriou MD PhD Fonds National de Recherche Scientifique (FNRS) Université Libre de Bruxelles (ULB) Institut Jules Bordet Histological Grade and
Molecular biology :- Cancer genetics lecture 11
Molecular biology :- Cancer genetics lecture 11 -We have talked about 2 group of genes that is involved in cellular transformation : proto-oncogenes and tumour suppressor genes, and it isn t enough to
High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis
High expression of cellular retinol binding protein-1 in lung adenocarcinoma is associated with poor prognosis Supplementary Material Supplementary Figure S1. Representative CRBP-1 immunostaining of non-neoplastic
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Designer Affinity Reagents. Brian Kay
Designer Affinity Reagents Brian Kay bkay@uic.edu Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold M13 Bacteriophage 900 nm x 10
* Kyoto Encyclopedia of Genes and Genomes.
Supplemental Material Complete gene expression data using Affymetrix 3PRIME IVT ID Chip (54,614 genes) and human immature dendritic cells stimulated with rbmasnrs, IL-8 and control (media) has been deposited
Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis
Cell cycle, signaling to cell cycle, and molecular basis of oncogenesis MUDr. Jiří Vachtenheim, CSc. CELL CYCLE - SUMMARY Basic terminology: Cyclins conserved proteins with homologous regions; their cellular
Genomic instability. Amin Mahpour
Genomic instability Amin Mahpour 1 Some questions to ponder What is Genomic instability? What factors contribute to the genomic integrity? How we identify these aberrations? 2 PART I: MOLECULAR BIOLOGY
p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
BIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
Supplementary information. Dual targeting of ANGPT1 and TGFBR2 genes by mir-204 controls
Supplementary information Dual targeting of ANGPT1 and TGFBR2 genes by mir-204 controls angiogenesis in breast cancer Ali Flores-Pérez, Laurence A. Marchat, Sergio Rodríguez-Cuevas, Verónica Bautista-Piña,
Supplementary Material. Table S1. Summary of mapping results
Supplementary Material Table S1. Summary of mapping results Sample Total reads Mapped (%) HNE0-1 99687516 80786083 (81.0%) HNE0-2 94318720 77047792 (81.7%) HNE0-3 104033900 84348102 (81.1%) HNE15-1 94426598
2015 EUROPEAN CANCER CONGRESS
2015 EUROPEAN CANCER CONGRESS 25-29 September 2015 Vienna, Austria SUMMARY The European Cancer Congress (ECC 2015) combined the 40th European Society for Medical Oncology (ESMO) congress with the 18th
Nature Genetics: doi: /ng Supplementary Figure 1. Depths and coverages in whole-exome and targeted deep sequencing data.
Supplementary Figure 1 Depths and coverages in whole-exome and targeted deep sequencing data. Depth (top) and coverage (bottom) of whole-exome sequencing for 38 independent JPN cases (mean depth = 130)
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
RAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
Designer Affinity Reagents. Reagents. Types of Affinity. M13 Bacteriophage. 900 nm x 10 nm. Brian Kay Src SH3 domain.
Designer Affinity Reagents Brian Kay bkay@uic.edu Types of Affinity Reagents Src SH3 domain Lysozyme Src SH3 domain FN3 monobody Peptide Ligand Antibody Fragment Scaffold M13 Bacteriophage 900 nm 10 nm
Oligodendroglioma: Toward Molecular Definitions in Diagnostic Neuro-Oncology
Journal of Neuropathology and Experimental Neurology Vol. 62, No. 2 Copyright 2003 by the American Association of Neuropathologists February, 2003 pp. 111 126 Oligodendroglioma: Toward Molecular Definitions
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bredel M, Scholtens DM, Yadav AK, et al. NFKBIA deletion in
BIO360 Quiz #1. September 14, Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points)
Name: BIO360 Quiz #1 September 14, 2012 1. Name five of the six Hallmarks of Cancer (not emerging hallmarks or enabling characteristics ): (5 points) 2. The controversial hypothesis that only a small subset
Nature Genetics: doi: /ng.2995
Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation
a" b" 2N c" d" e" f" !!Aurora!A!!!CP110!
DLD1/Reference a" 2N 2N 2N/DLD1 2N/ /DLD1 c" d" e" f" TargetID 2N.AVG_Sig 2N.Det Pval.AVG_Sig.Det Pval Diff Pval DiffScore SYMBOL ILMN_26396 18.35238 0.0080058 44.81118 0.0021834 0.000323 34.90542 KRTHA4
Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters
Supplementary Data: Extensive and coordinated transcription of noncoding RNAs within cell cycle promoters Tiffany Hung 1,2, Yulei Wang 3, Michael F. Lin 4,5, Ashley K. Koegel 1,2, Yojiro Kotake 6-8, Gavin
Enterprise Interest None
Enterprise Interest None Heterogeneous chromosomal profiles in a unique series of DIPG in children and young adults European Congress of Pathology Amsterdam, 6 th September 2017 Charlotte Dufour, Romain
Supplementary Data Cyclophilin B Supports Myc and Mutant p53 Dependent Survival of Glioblastoma Multiforme Cells
Supplementary Data Cyclophilin B Supports Myc and Mutant p53 Dependent Survival of Glioblastoma Multiforme Cells Jae Won Choi, Mark A. Schroeder, Jann N. Sarkaria, and Richard J. Bram 1 Figure S1. Pharmacological
CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS
CELL CYCLE MOLECULAR BASIS OF ONCOGENESIS Summary of the regulation of cyclin/cdk complexes during celll cycle Cell cycle phase Cyclin-cdk complex inhibitor activation Substrate(s) G1 Cyclin D/cdk 4,6
Supplementary Figure 1: Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points
A. B. 8 4 Supplementary Figure : Func8onal Network Analysis of Kinases Significantly Modulated by MERS CoV Infec8on and Conserved Across All Time Points Examined. A) Venn diagram analysis of kinases significantly
Supplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway
Supplemental Data Macrophage Migration Inhibitory Factor MIF Interferes with the Rb-E2F Pathway S1 Oleksi Petrenko and Ute M. Moll Figure S1. MIF-Deficient Cells Have Reduced Transforming Ability (A) Soft
Molecular Cell Biology (Bio 5068) Cell Cycle I. Ron Bose, MD PhD November 14, 2017
Molecular Cell Biology (Bio 5068) Cell Cycle I Ron Bose, MD PhD November 14, 2017 CELL DIVISION CYCLE M G2 S G1 DISCOVERY AND NAMING OF CYCLINS A protein (called cyclin ) was observed to increase as cells
Supplementary Figure 1 Cell line TRIB2 status. Supplementary Figure 2 TRIB2 status has no impact on the cell cycle after PI3K inhibition. a. b.
Supplementary Figure 1 Cell line TRIB2 status. TRIB2 protein expression to determine endogenous expression and to determine the effectiveness of each of our TRIB2 knockdown constructs. Supplementary Figure
Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors
Wang et al LEGENDS TO SUPPLEMENTARY INFORMATION Supplementary Figure 1. IHC and proliferation analysis of pten-deficient mammary tumors A. Induced expression of estrogen receptor α (ERα) in AME vs PDA
SUPPLEMENTARY INFORMATION
doi:10.1038/nature13173 Supplementary Table 1. List of genes commonly expressed in all single cells. Name Actb Actin, beta, cytoplasmic Actg1 Actin, gamma, cytoplasmic 1 Atp5e ATP synthase, H+ transporting,
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables. File Name: Peer Review File Description:
File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables File Name: Peer Review File Description: Primer Name Sequence (5'-3') AT ( C) RT-PCR USP21 F 5'-TTCCCATGGCTCCTTCCACATGAT-3'
SALSA MLPA Probemix P014-B1 Chromosome 8 Lot B and B
SALSA MLPA Probemix P014-B1 Chromosome 8 Lot B1-0916 and B1-0713. Copy number changes of the human chromosome 8 are common in many types of tumours. In most cases, losses of 8p sequences and gains of 8q
Plasma-Seq conducted with blood from male individuals without cancer.
Supplementary Figures Supplementary Figure 1 Plasma-Seq conducted with blood from male individuals without cancer. Copy number patterns established from plasma samples of male individuals without cancer
Supplementary Information
Supplementary Information mediates STAT3 activation at retromer-positive structures to promote colitis and colitis-associated carcinogenesis Zhang et al. a b d e g h Rel. Luc. Act. Rel. mrna Rel. mrna
Determination Differentiation. determinated precursor specialized cell
Biology of Cancer -Developmental Biology: Determination and Differentiation -Cell Cycle Regulation -Tumor genes: Proto-Oncogenes, Tumor supressor genes -Tumor-Progression -Example for Tumor-Progression:
OncoMir Library Cancer Type Target Gene
OncoMir Library Cancer Type Target Gene hsa-let-7a-1 Breast Cancer, Lung Cancer H RAS, HMGA2, CDK6, NRAS hsa-let-7a-2 Breast Cancer, Lung Cancer H RAS, HMGA2, CDK6, NRAS hsa-let-7a-3 Breast Cancer, Lung
iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
Figure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET
Supplemental Figure Legends Figure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET Multiple unsupervised analyses were performed on human HT-1v4 expression array (Illumina) data from
Thanks to: Signal Transduction. BCB 570 "Signal Transduction" 4/8/08. Drena Dobbs, ISU 1. An Aging Biologist s. One Biologist s Perspective
BCB 570 "" Thanks to: One Biologist s Perspective Drena Dobbs BCB & GDCB Iowa State University Howard Booth Biology Eastern Michigan University for Slides modified from his lecture Cell-Cell Communication
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler
Supplementary data Table S3. GO terms, pathways and networks enriched among the significantly correlating genes using Tox-Profiler DR CALUX Boys Girls Database Systemic lupus erythematosus 4.4 0.0021 6.7
Lecture #27 Lecturer A. N. Koval
Lecture #27 Lecturer A. N. Koval Hormones Transduce Signals to Affect Homeostatic Mechanisms Koval A. (C), 2011 2 Lipophilic hormones Classifying hormones into hydrophilic and lipophilic molecules indicates
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
Jennifer Hauenstein Oncology Cytogenetics Emory University Hospital Atlanta, GA
Comparison of Genomic Coverage using Affymetrix OncoScan Array and Illumina TruSight Tumor 170 NGS Panel for Detection of Copy Number Abnormalities in Clinical GBM Specimens Jennifer Hauenstein Oncology
Identificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada?
Identificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada? Alberto Ocana Albacete University Hospital Salamanca May 19th, 2016 WHAT IS PERSONALIZED MEDICINE? Molecular
Assessment performed on Friday, September 18, 2015, at Vancouver General Hospital
Assessors report for ciqc Run 49: ATRX (June 2015) Assessors: S Yip and J Won (recorder) Assessment performed on Friday, September 18, 2015, at Vancouver General Hospital Background The combined application
Original Article Olea europaea leaf extract improves the treatment response of GBM stem cells by modulating mirna expression
Am J Cancer Res 2014;4(5):572-590 www.ajcr.us /ISSN:2156-6976/ajcr0000546 Original Article Olea europaea leaf extract improves the treatment response of GBM stem cells by modulating mirna expression Gulcin
Supplementary Information. PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small
Sato T, et al. Supplementary Information PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small cell lung cancer Teruyuki Sato 1,2, Atsushi Kaneda 1,3,4 *, Shingo Tsuji
Antibody-Drug Conjugates in Glioblastoma Multiforme: Finding Ways Forward
Transcript Details This is a transcript of a continuing medical education (CME) activity accessible on the ReachMD network. Additional media formats for the activity and full activity details (including
New Insights Into Molecular Basis of Glioblastoma Multiforme and Associated Immunosuppression
ACTA FACULTATIS MEDICAE NAISSENSIS DOI: 10.2478/afmnai-2013-0009 UDC: 616.831-006-097 Scientific Journal of the Faculty of Medicine in Niš 2013;30(4):165-184 Review article New Insights Into Molecular
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
number Done by Corrected by Doctor Maha Shomaf
number 19 Done by Waseem Abo-Obeida Corrected by Abdullah Zreiqat Doctor Maha Shomaf Carcinogenesis: the molecular basis of cancer. Non-lethal genetic damage lies at the heart of carcinogenesis and leads
Cell Cycle and Cancer
142 8. Cell Cycle and Cancer NOTES CELL CYCLE G 0 state o Resting cells may re-enter the cell cycle Nondividing cells (skeletal and cardiac muscle, neurons) o Have left the cell cycle and cannot undergo
Chapter 11 Guided Reading: Cell Communication
Name Chapter 11 Guided Reading: Cell Communication The special challenge in Chapter 11 is not that the material is so difficult, but that most of the material will be completely new to you. Cell communication
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Eckel-Passow JE, Lachance DH, Molinaro AM, et al. Glioma groups
BL 424 Test pts name Multiple choice have one choice each and are worth 3 points.
BL 424 Test 3 2010 150 pts name Multiple choice have one choice each and are worth 3 points. 1. The plasma membrane functions as a a. selective barrier to the passage of molecules. b. sensor through which
Genetics and Cancer Ch 20
Genetics and Cancer Ch 20 Cancer is genetic Hereditary cancers Predisposition genes Ex. some forms of colon cancer Sporadic cancers ~90% of cancers Descendants of cancerous cells all cancerous (clonal)
Identifying Causal Genes and Dysregulated Pathways in Complex Diseases
Identifying Causal Genes and Dysregulated Pathways in Complex Diseases Yoo-Ah Kim, Stefan Wuchty, Teresa M. Przytycka* National Center for Biotechnology Information, National Library of Medicine, National
Hs LOC Hs.7100 T Hs YARS Tyrosyl-tRNA synthetase 0.24
Supplementary Table S1 Genes differently expressed between LNM35 and N15 UniGene ID Gene symbol Description Ratio Genes up-regulated in LNM35 Hs.535012 LOC441052 6.14 Hs.182885 SLC35B2 Solute carrier family