The Role of MicroRNAs in NEC Misty Good, MD
|
|
|
- Jordan Henderson
- 5 years ago
- Views:
Transcription
1 The Role of MicroRNAs in NEC Misty Good, MD Neonatologist, Assistant Professor of Pediatrics Division of Newborn Medicine, Children s Hospital of Pittsburgh Department of Pediatrics, University of Pittsburgh School of Medicine September 26, 2016
2 Objectives Review the pathogenesis of NEC. Describe the mechanism by which breast milk is protective against NEC. Discuss the role of micrornas in NEC.
3 Introduction Necrotizing enterocolitis is the leading cause of death from GI disease in the premature infant Etiology remains incompletely understood Premature infant with NEC Intraoperative
4 How does NEC happen? Hypoxia Hackam et al. Clin Dev Immunol
5 Background TLR4 activation within intestinal epithelium leads to mucosal injury Through accelerated enterocyte apoptosis Impaired mucosal proliferation Since TLR4 is important in NEC development, strategies to limit TLR4 signaling may offer a preventative approach
6 Background NEC is up to 6x more common in infants fed formula vs. breast milk The specific protective agent and mechanism mediating protection is unclear
7 Background EGF is involved in intestinal development present in breast milk and amniotic fluid EGF enhances proliferation of epithelial cells and heals damaged mucosa EGF is involved in regulation of cell replication, cell movement and cell survival Harris et al, EGF receptor ligands. Exp Cell Res 2003;284:2-13. Duh et al. EGF regulates early embryonic mouse development in chemically defined organ culture. Pediatr Res 2000;48:
8 Hypothesis We hypothesized that breast milk inhibits TLR4 signaling within the neonatal intestinal epithelium via EGFR activation, and attenuates the severity of experimental NEC.
9 Induction of mouse experimental NEC Neonatal mouse pups Breast fed controls Gavage NEC formula every 3 hours for 12hrs Hypoxia (5% O2, 95% N2) twice daily NEC in 4 days Free air
10 Decreased intestinal EGFR expression is associated with NEC development in mice BF NEC Good et al, PNAS, 2012
11 Decreased intestinal EGFR expression is associated with NEC development in humans Good et al, PNAS, 2012
12 Breast Milk Extraction
13 Breast milk inhibits TLR4 signaling in vivo i Control LPS LPS+ LPS++Cetux ii iii iv v Total Flux (photons/sec) x 10 4 Normalized to control 8 0 Saline LPS LPS LPS Cetux vi IL-6 qrt-pcr 22 0 Saline LPS LPS LPS Cetux vii TLR4 qrt-pcr 5 0 Saline LPS LPS LPS Cetux Good et al, Mucosal Immunology, 2015
14 Breast milk attenuates NEC via EGFR activation Wild-type Control NEC NEC+ i ii iii NEC++Cetux NEC+I iv v vi NEC+I+EGF 30 inos qrt-pcr 0 i Ctrl NEC NEC NEC Cetux NEC I ii NEC I EGF 3 NEC Severity Score 0 Ctrl NEC NEC NEC Cetux NEC I NEC I EGF Good et al, Mucosal Immunology, 2015
15 Breast milk attenuates NEC severity via EGFR EGFR IEC Control NEC NEC+ i ii iii i inos qrt-pcr 8 ii NEC Severity Score 3 0 Ctrl NEC NEC 0 Ctrl NEC NEC Good et al, Mucosal Immunology, 2015
16 A Breast milk inhibits NEC-mediated apoptosis and enhances crypt proliferation via EGF Wild-type i Control ii NEC iii NEC+ TUNEL 3NT Dapi iv NEC+ v NEC+ vi + I Cetux NEC+ I+ EGF C i 8 Wild-type TUNEL+ cells/villus 0 Ctrl NEC NEC NEC NEC I Cetux NEC I EGF B TUNEL 3NT Dapi i Control ii NEC iii PCNA Dapi iv NEC+ + Cetux v NEC+ I vi PCNA Dapi NEC+ NEC+ I+ EGF ii Wild-type PCNA + cells/crypt 12 0 Ctrl NEC NEC NEC NEC Cetux I NEC I EGF Good et al, Mucosal Immunology, 2015
17 Breast milk inhibits NEC-mediated apoptosis and enhances crypt proliferation via EGFR C EGFR IEC i Control ii NEC iii NEC+ D TUNEL 3NT Dapi i Control ii NEC iii NEC+ PCNA Dapi E i EGFR IEC TUNEL+ cells/villus 8 0 Ctrl NEC NEC ii EGFR IEC 0 PCNA + cells/crypt 12 Ctrl NEC NEC Good et al, Mucosal Immunology, 2015
18 Breast milk inhibits TLR4 signaling in intestinal epithelial cells via EGFR activation i Control LPS LPS+ ii iii iv LPS+I LPS+I+EGF LPS+B v vi EGFR-kd IEC-6 NF-κB i ii iii iv v NF-κB i Wild-type IEC-6 ii Wild-type IEC-6 iii EGFR-kd IEC IL-6 qrt-pcr TLR4 qrt-pcr IL-6 qrt-pcr 0 Ctrl LPS LPS 0 Ctrl LPS LPS 0 Ctrl LPS LPS Good et al, Mucosal Immunology, 2015
19 Interim Summary We have shown that breast milk is protective against NEC by inhibiting TLR4 with the activation of EGFR. EGFR signaling protected against TLR4- mediated enterocyte apoptosis and enhanced enterocyte proliferation in NEC. Thus, it is particularly important to study the gene regulation of EGFR in NEC as a therapeutic or preventative target in NEC.
20 MicroRNA Background Noncoding RNA about 22 nucleotides long Functions in RNA silencing and therefore post-transcriptional regulation of gene expression Initially expressed as pri-mirnas in clusters that undergo post-transcriptional processing to produce mature mirnas
21 mirna Background MiRNAs are differentially expressed in the intestine. Implicated in IBD, intestinal inflammation, gut barrier function.
22 Observation: mirnas are known to be differentially expressed in intestinal inflammatory states Hypothesis: mirnas are differentially expressed in premature infants with NEC
23 Methods Univ. of Pittsburgh approved IRB protocol Inclusion/Exclusion Criteria Premature infants admitted to NICU NEC patients with Bell s Stage II or greater Excluded patients with congenital anomalies Samples Intestinal resections: At NEC diagnosis or at stoma closure (Resolved NEC) Serum: At time of NEC diagnosis or age-matched controls
24 NEC is Associated with Differential Expression of mirnas
25 mirna-17~92 Background MiR17~92 cluster made up of mirna-17, 18a, 19a, 19b, 20a, and 92a These mirnas are known to be differentially expressed in intestinal inflammatory states. Components of the mir-17~92 cluster have increased intestinal and serum expression in inflammatory states of IBD.
26 Embryonic small intestine of mir-17~92ko mice display blunted villiform structures Control mir-17~92ko
27 MicroRNAs Previously our lab has shown that EGFR expression is decreased in NEC Protective effects seen in NEC with EGFR activation mirna-17 is predicted to target EGFR Good et al, PNAS, 2012 Betel et al, Nucleic Acids Res 2008 Good et al, Mucosal Immunology, 2015
28 Expression of Intestinal mirna-17 Increased in NEC mir-17 qpcr expression P<0.002 Pompa et al, in preparation
29 Serum mirna-17 is Increased in NEC serum mir-17 qpcr P<0.05 Pompa et al, in preparation
30 Serum MiR-17 is increased in medical and surgical NEC Control Medical NEC Surgical NEC Relative mirna-17 Expression P<0.05 Pompa et al, in preparation
31 Observation: mirna-17 is increased in the intestine and blood of infants with NEC Hypothesis: Infants with increased mirna-17 have increased intestinal barrier dysfunction and decreased cellular proliferation
32 mirna-17 expression is increased in surgical NEC NEC Resolved NEC mir-17 LNA-ISH Pompa et al, in preparation
33 Increased mir-17, decreased proliferation, tight junctions and EGFR in NEC NEC Resolved NEC ZO-1 PCNA DAPI EGFR Pompa et al, in preparation
34 MiR-17 targets EGFR Relative Luciferase (%) 0 Egfr + Tomato Egfr + mir17 Pompa et al, in preparation
35 Conclusions The mirna-17~92 cluster is upregulated in the intestines of infants with NEC mirna-17 is upregulated in the intestine and serum of infants with medical and surgical NEC. MiR-17 targets EGFR mirna-17 may play an important role in the maintenance of the gut barrier in NEC pathogenesis
36 Future Directions Characterize the intestinal cell populations that express mirnas with flow cytometry. Evaluate susceptibility of intestinal specific mirna-17~92ko mice NEC model. Determine the effects of Mir-17~92 cluster on intestinal development in the mouse.
37 Future Directions Neonatal mouse enteroids Determine the effect of overexpressing Mir-17 in neonatal mouse enteroids with and without NEC. Ecad Muc2 Lysozyme DAPI
38 Good Lab Anthony Pompa, MD (Pediatric Resident) Congrong Ma (Technician) Alexa Bolock (Technician) Zerina Hodzic (Medical Student) Olivia Parks (Undergraduate Student) Kara Touscany (Undergraduate Student) Onome Oghifobibi, MD (Pediatric Resident) Sonali Agrawal (Undergraduate Student) Tyler McCullough (Undergraduate Student) David Hackam Lab, Hopkins Acknowledgements Chhinder Sodhi, PhD Hongpeng Jia, MD Charlotte Egan, PhD Yuki Yamaguchi, PhD Peng Lu, PhD Amin Afrazi, MD, PhD Maria Branca Tom Prindle Samantha Weyandt Funding Sources National Institutes of Health K08DK CHP Department of Pediatrics UPMC Competitive Medical Research Fund Jay Kolls Lab, Pitt Pawan Kumar, PhD Kara Kracinovsky Gary Silverman Lab, Wash U Cliff Luke, PhD Jackie Ho Lab, Pitt Yu Leng Phua John Ozolek, MD, Pitt
39 Thank you! Questions? The Good Lab is relocating to Washington University in St. Louis, MO, USA and is hiring if interested please
Toll-like receptor 4 mediated lymphocyte influx induces neonatal necrotizing enterocolitis
The Journal of Clinical Investigation Toll-like receptor 4 mediated lymphocyte influx induces neonatal necrotizing enterocolitis Charlotte E. Egan, 1,2 Chhinder P. Sodhi, 3,4 Misty Good, 5 Joyce Lin, 1,6
Necrotizing Enterocolitis: The Role of the Immune System
Necrotizing Enterocolitis: The Role of the Immune System Patricia Denning, M.D. Associate Professor in Pediatrics Division of Neonatology Emory University School of Medicine What is NEC? What is NEC? Necrotizing
RECENT ADVANCES IN OUR UNDERSTANDING & MANAGEMENT OF NEC
RECENT ADVANCES IN OUR UNDERSTANDING & MANAGEMENT OF NEC Prof. Minesh Khashu @mkrettiwt Minesh Khashu Consultant Neonatologist & Prof. of Perinatal Health @mkrettiwt 1 Plan Aim & Learning outcomes Introduction
BACTERIAL TRANSLOCATION AND INTESTINAL PERMEABILITY IN PRETERM INFANTS
BACTERIAL TRANSLOCATION AND INTESTINAL PERMEABILITY IN PRETERM INFANTS Dr Paul Fleming Consultant Neonatal Medicine Homerton University Hospital Honorary Research Fellow Barts and the London School of
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna)
Animal Industry Report AS 664 ASL R3235 2018 Profiling of the Exosomal Cargo of Bovine Milk Reveals the Presence of Immune- and Growthmodulatory Non-coding RNAs (ncrna) Eric D. Testroet Washington State
FIELD OF STUDY (if applicable) Georgetown University, Washington, DC B.S. 05/02 Biology
BIOGRAPHICAL SKETCH Provide the following information for the Senior/key personnel and other significant contributors in the order listed on Form Page 2. Follow this format for each person. DO NOT EXCEED
SCFA in gut health. Kristin Verbeke. On behalf of the Prebiotic Task Force of ILSI Europe
SCFA in gut health Kristin Verbeke Translational Research in Gastrointestinal Disorders KU Leuven On behalf of the Prebiotic Task Force of ILSI Europe Acetic acid Major anions in the large intestine Propionic
IL-12 family members in experimental colitis. Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany
IL-12 family members in experimental colitis Markus F. Neurath I. Medical Clinic Johannes Gutenberg-University Mainz, Germany IBD - Pathogenesis Genetic Predisposition Bacterial Antigens Activation of
SUMMARY Coeliac disease is a common food intolerance in Western populations, in which it has a prevalence of about 1%. In early infancy, when the transition is made to a gluten-containing diet (particularly
Milk micro-rna information and lactation
Christophe Lefèvre, BioDeakin,. Deakin University, Geelong VIC Australia Milk micro-rna information and lactation New Signals in milk? - Markers of milk and lactation status? - Signal infant development?
Our Journey Toward Elimination of. Necrotizing Enterocolitis 4/16/2018. Disclosure. Presentation Outline. Clinical Presentation of NEC
Our Journey Toward Elimination of Necrotizing Enterocolitis RAY SATO, M.D. TACOMA GENERAL HOSPITAL NICU APRIL 2018 Disclosure Ray Sato, MD has no financial relationship to disclose or conflicts of interest
Alcoholic hepatitis is a drug-induced disorder
Alcoholic hepatitis is a drug-induced disorder Gyongyi Szabo, MD, PhD Professor of Medicine University of Massachusetts Medical School Source: 2 Sobernation.com Clinical Progression of ALD Mortality Acute
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation
MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation Tao Li 1 *, Michael J. Morgan 1 *, Swati Choksi 1, Yan Zhang 1, You-Sun Kim 2#, Zheng-gang
Innate immunity as a therapeutic target in IBD. Elke Cario Division of Gastroenterology & Hepatology University Hospital of Essen Essen, Germany
Innate immunity as a therapeutic target in IBD Elke Cario Division of Gastroenterology & Hepatology University Hospital of Essen Essen, Germany The intestinal mucosa must rapidly recognize luminal pathogens
Commensal Bacteria, Toll-like Receptors and Intestinal Injury. Journal Club December 16, 2004
Commensal Bacteria, Toll-like Receptors and Intestinal Injury Journal Club December 16, 2004 Gut-Commensal Interactions Nutrient metabolism Tissue development Resistance to colonization with pathogens
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
PepT1 Expression Helps Maintain Intestinal Homeostasis by Mediating the Differential. Expression of mirnas along the Crypt-Villus Axis
PepT Expression Helps Maintain Intestinal Homeostasis by Mediating the Differential Expression of mirnas along the Crypt-Villus Axis Yuchen Zhang,*, Emilie Viennois, Mingzhen Zhang, Bo Xiao, 3, Moon Kwon
Enteral Nutrition in the Critically Ill Child: Challenges and Current Guidelines
Enteral Nutrition in the Critically Ill Child: Challenges and Current Guidelines 1 Presented on January 24, 2017 Jorge A. Coss-Bu, MD Associate Professor of Pediatrics Section of Critical Care Baylor College
Relevant Disclosures
6/18/215 Therapeutic developments for autoimmune demyelinating diseases: Musings from a MD (Mouse Doctor) Michael K. Racke, M.D. May 28, 215 Relevant Disclosures Editorial Boards for Journal of Neuroimmunology,
Differential responses of human colonic ILCs to gut commensal bacteria altered during HIV infection
Differential responses of human colonic ILCs to gut commensal bacteria altered during HIV infection Moriah J. Castleman, Ph.D. Laboratory of Dr. Cara Wilson University of Colorado Anschutz Medical Campus
GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
Intestinal Microbiota in Health and Disease
Intestinal Microbiota in Health and Disease February 27, 2015 Master s Course in Gastroenterology Prof. Kathy McCoy 1 Overview Overview of Gut Microbiota Microbiota in Health Microbiota in Disease 2 Gut
10th International Rotavirus Symposium Bangkok, Thailand
Rotavirus Host Range Restriction and Innate Immunity: Mechanisms of Vaccine Attenuation Harry Greenberg MD Stanford University 10th International Rotavirus Symposium Bangkok, Thailand 09/19/12 B dsrna
MicroRNA expression profiling and functional analysis in prostate cancer. Marco Folini s.c. Ricerca Traslazionale DOSL
MicroRNA expression profiling and functional analysis in prostate cancer Marco Folini s.c. Ricerca Traslazionale DOSL What are micrornas? For almost three decades, the alteration of protein-coding genes
HEMATOPOIETIC GROWTH FACTORS IN NEONATAL MEDICINE
HEMATOPOIETIC GROWTH FACTORS IN NEONATAL MEDICINE Preface Robert D. Christensen xiii Evaluation and Treatment of Severe and Prolonged Thrombocytopenia in Neonates 1 Martha C. Sola Thrombocytopenia is one
Caffeine Modulates Hyperoxia - Induced Angiogenesis in Newborn Mice
Caffeine Modulates Hyperoxia - Induced Angiogenesis in Newborn Mice Vikramaditya Dumpa, MD Lori C Nielsen, MS Huamei Wang, MD Vasanth HS Kumar, MD Supported by AAP Marshall Klaus Perinatal Research Grant
GRANT RECIPIENT! Congratulations! 2017 We Care Fund Grant Recipient. Amanda L. Kong, MD, MS. Associate Professor, Division of Surgical Oncology
Congratulations! 2017 We Care Fund Grant Recipient GRANT Amanda L. Kong, MD, MS Associate Professor, Division of Surgical Oncology GRANT GRANT Prevention of Side Effects in Use of Chemotherapy in Breast
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
microrna Presented for: Presented by: Date:
microrna Presented for: Presented by: Date: 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions
Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation
Intracellular MHC class II molecules promote TLR-triggered innate immune responses by maintaining Btk activation Xingguang Liu, Zhenzhen Zhan, Dong Li, Li Xu, Feng Ma, Peng Zhang, Hangping Yao and Xuetao
NEC. cathy e. shin childrens hospital los angeles department of surgery university of southern california keck school of medicine
NEC cathy e. shin childrens hospital los angeles department of surgery university of southern california keck school of medicine Necrotizing enterocolitis (NEC) the most common and most lethal disease
Gut Microbiota and IBD. Vahedi. H M.D Associate Professor of Medicine DDRI
Gut Microbiota and IBD Vahedi. H M.D Associate Professor of Medicine DDRI 1393.3.1 2 GUT MICROBIOTA 100 Trillion Microbes - 10 times more than cells in our body Collective weight of about 1kg in human
Is NEC requiring surgery precipitated by a change in feeds? Observations from 50 consecutive cases. David Burge SIGNEC September 2015
Is NEC requiring surgery precipitated by a change in feeds? Observations from 50 consecutive cases. David Burge SIGNEC September 2015 Clinical series Specific cases Other scenarios Published experience
Innate immune regulation of T-helper (Th) cell homeostasis in the intestine
Innate immune regulation of T-helper (Th) cell homeostasis in the intestine Masayuki Fukata, MD, Ph.D. Research Scientist II Division of Gastroenterology, Department of Medicine, F. Widjaja Foundation,
Supplementary Figure 1
Supplementary Figure 1 Asymmetrical function of 5p and 3p arms of mir-181 and mir-30 families and mir-142 and mir-154. (a) Control experiments using mirna sensor vector and empty pri-mirna overexpression
Bringing Synbiotic Interventions in Cancer to Practice: from bench to bedside The UC Davis Foods for Health Institute
Bringing Synbiotic Interventions in Cancer to Practice: from bench to bedside The UC Davis Foods for Health Institute Jennifer T. Smilowitz, PhD Associate Director, Human Studies Research jensm@ucdavis.edu
Osteopontin a bioactive milk protein with immunological properties
Osteopontin a bioactive milk protein with immunological properties Esben S. Sørensen Section for Molecular Nutrition Department of Molecular Biology and Genetics Aarhus University, Denmark Proteins in
Perinatal Nutrition. Disclosure Statement. Annual Meeting of the NASPGHAN. Keynote Lecture: Nutrients in the Perinatal Environment: Lessons Learned
Annual Meeting of the NASPGHAN Chicago, ILL October 10-13, 2013 Keynote Lecture: Nutrients in the Perinatal Environment: Lessons Learned Allan Walker, M.D. Boston, MA Disclosure Statement Dr. Allan Walker
micro-rnas as biomarkers in children who underwent surgery for CHD
micro-rnas as biomarkers in children who underwent surgery for CHD mentors: Dr. Yael Nevo-Caspi & Prof. Gidi Paret Or Bercovich Liat Mor What will we talk about Congenital heart defects (CHD) Scientific
MicroRNAs: novel regulators in skin research
MicroRNAs: novel regulators in skin research Eniko Sonkoly, Andor Pivarcsi KI, Department of Medicine, Unit of Dermatology and Venerology What are micrornas? Small, ~21-mer RNAs 1993: The first mirna discovered,
Genetics. Environment. You Are Only 10% Human. Pathogenesis of IBD. Advances in the Pathogenesis of IBD: Genetics Leads to Function IBD
Advances in the Pathogenesis of IBD: Genetics Leads to Function Pathogenesis of IBD Environmental Factors Microbes Scott Plevy, MD Associate Professor of Medicine, Microbiology & Immunology UNC School
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways
Gut microbiota, metabolic syndrome, obesity and the nutrient sensor pathways Department of Gastroenterology, Endocrinology & Metabolism Medical University Innsbruck Herbert Tilg Nothing to disclose Fig.
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Intestinal epithelial vitamin D receptor signaling inhibits experimental colitis
Research article Intestinal epithelial vitamin D receptor signaling inhibits experimental colitis Weicheng Liu, 1 Yunzi Chen, 1,2 Maya Aharoni Golan, 1 Maria L. Annunziata, 1 Jie Du, 2 Urszula Dougherty,
PRACTICE GUIDELINES WOMEN S HEALTH PROGRAM
C Title: NEWBORN: HYPOGLYCEMIA IN NEONATES BORN AT 35+0 WEEKS GESTATION AND GREATER: DIAGNOSIS AND MANAGEMENT IN THE FIRST 72 HOURS Authorization Section Head, Neonatology, Program Director, Women s Health
MicroRNA in Cancer Karen Dybkær 2013
MicroRNA in Cancer Karen Dybkær RNA Ribonucleic acid Types -Coding: messenger RNA (mrna) coding for proteins -Non-coding regulating protein formation Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
Dysbiosis & Inflammation
MASTERING THE MICROBIOME: Dysbiosis & Inflammation 2017 Tom Fabian, PhD It is reasonable to propose that the composition of the microbiome and its activities are involved in most, if not all, of the biological
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
12/10/2009. Department of Pathology, Case Western Reserve University. Mucosal Cytokine Network in IBD
Cytokine-Mediated Inflammation in IBD Theresa T. Pizarro Department of Pathology, Case Western Reserve University Mucosal Cytokine Network in IBD Andoh, et al., 2008 1 Interleukin-1 (IL-1) Family Cytokine
Human intestinal microbiology and probiotics
Human intestinal microbiology and probiotics Michiel Kleerebezem Wageningen Centre for Food Sciences Wageningen University NIZO food research P.O. Box 20 6710 BA Ede The Netherlands phone: +31-(0)318-659629
Parenteral Nutrition. Outline. Potential Biomarkers for Use in Intestinal Adaptation. Jejunum is primary site of digestion and absorption
Outline Potential Biomarkers for Use in Intestinal Adaptation Kelly A. Tappenden, Ph.D., R.D. Professor of Nutrition and GI Physiology 1. Intestinal Adaptation potential regulators 2. Intestinal mucosal
MicroRNA dysregulation in cancer. Systems Plant Microbiology Hyun-Hee Lee
MicroRNA dysregulation in cancer Systems Plant Microbiology Hyun-Hee Lee Contents 1 What is MicroRNA? 2 mirna dysregulation in cancer 3 Summary What is MicroRNA? What is MicroRNA? MicroRNAs (mirnas) -
Airway macrophages in health and disease Tracy Hussell
Prof. Airway Macrophages in Health and Disease Director, Manchester Collaborative Centre for Inflammation Research (MCCIR), Professor of Inflammatory Disease University of Manchester Manchester, M13 9PT
Effect of Bifidobacterium on the mrna expression levels of TRAF6, GSK-3β, and microrna-146a in LPS-stimulated rat intestinal epithelial cells
Effect of Bifidobacterium on the mrna expression levels of TRAF6, GSK-3β, and microrna-146a in LPS-stimulated rat intestinal epithelial cells W. Zhou, Y. Yuan, J. Li, W.M. Yuan, L.G. Huang and S.W. Zheng
Therapeutic options to modulate intestinal barrier
15 + 5 min J.D. Schulzke Dept. of General Medicine Therapeutic options to modulate intestinal barrier What makes up epithelial barrier function? ions/h 2 O antigens/bacteria tight junction apoptoses erosions
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures
Type of file: PDF Size of file: 0 KB Title of file for HTML: Supplementary Information Description: Supplementary Figures Supplementary Figure 1 mir-128-3p is highly expressed in chemoresistant, metastatic
Probiotic bacteria: mechanisms of action?
Probiotic bacteria: mechanisms of action? Probiotic derived antibacterial substances (microcins) Competitive inhibition of pathogens Modulation of inflammatory responses: Increasing antiinflammatory cytokine
Anything You Can Do I Can Do Better: Divergent Mechanisms to Metabolize Milk Oligosaccharides by Two Bifidobacterial Species. David A.
Anything You Can Do I Can Do Better: Divergent Mechanisms to Metabolize Milk Oligosaccharides by Two Bifidobacterial Species David A. Sela IMGC 2013 This is not our planet Bacteria present by 3.9 bya Archaea
Studies on probiotics effects on innate immune functions in the gastrointestinal tract of broiler chicks (SUMMARY)
Doctoral Thesis Studies on probiotics effects on innate immune functions in the gastrointestinal tract of broiler chicks (SUMMARY) ELSAYED SEDDEK IBRAHEM MOHAMMED Department of Bioresource Science Graduate
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained
Supplementary Figure 1. Confocal immunofluorescence showing mitochondrial translocation of Drp1. Cardiomyocytes treated with H 2 O 2 were prestained with MitoTracker (red), then were immunostained with
High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22
Supplementary Information High Fat Diets Induce Colonic Epithelial Cell Stress and Inflammation that is Reversed by IL-22 Max Gulhane 1, Lydia Murray 1, Rohan Lourie 1, Hui Tong 1, Yong H. Sheng 1, Ran
Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
Supplementary Figure 1
Supplementary Figure 1 a Location of GUUUCA motif relative to RNA position 4e+05 3e+05 Reads 2e+05 1e+05 0e+00 35 40 45 50 55 60 65 Distance upstream b 1: Egg 2: L3 3: Adult 4: HES 4e+05 3e+05 2e+05 start
Pathogenesis of lupus apoptosis clearance and regulation of self tolerance. Durga Prasanna Misra
Pathogenesis of lupus apoptosis clearance and regulation of self tolerance Durga Prasanna Misra Format Apoptosis Apoptosis in SLE Decreased apoptosis of autoreactive cells Increased apoptosis Defective
Minimal Enteral Nutrition
Abstract Minimal Enteral Nutrition Although parenteral nutrition has been used widely in the management of sick very low birth weight infants, a smooth transition to the enteral route is most desirable.
VIRAL AGENTS CAUSING GASTROENTERITIS
VIRAL AGENTS CAUSING GASTROENTERITIS VIRAL AGENTS CAUSING GASTROENTERITIS Pathogens discussed in our lectures 1. Rotavirus 2. Enteric adenoviruses 3. Caliciviruses 4. Astroviruses 5. Toroviruses Viruses
TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer
AWARD NUMBER: W81XWH-14-1-0387 TITLE: MiR-146-SIAH2-AR Signaling in Castration-Resistant Prostate Cancer PRINCIPAL INVESTIGATOR: Dr. Goberdhan Dimri, PhD CONTRACTING ORGANIZATION: George Washington University,
Susceptibility to Rotavirus Infections. Mary K. Estes, PhD Baylor College of Medicine
13 th International Rotavirus Symposium Session V: Advances in rotavirus immunology and virology Minsk, Belarus August 30, 2018 Susceptibility to Rotavirus Infections Mary K. Estes, PhD Baylor College
Mucosal immunity Reddy April Deveshni Reddy Allergy Meeting 13 April 2012
Deveshni Reddy Allergy Meeting 13 April First recorded by Hippocrates over 2000 years ago. 1921: Prausnitz and Kustner demonstrated that substance responsible for Kustner s fish allergy was present in
Involvement of TLR4/STAT3 signaling in the antimelanoma effects of atractylenolide II. Fu Xiuqiong
Involvement of TLR4/STAT3 signaling in the antimelanoma effects of atractylenolide II Fu Xiuqiong Melanoma fact Skin cancers Skin cancer deaths 2.3% 75% Melanoma Non-melanoma skin cancers ----American
Genetic and mechanistic Determinants of Rotavirus Host Range Restriction
Genetic and mechanistic Determinants of Rotavirus Host Range Restriction Harry Greenberg MD and the Greenberg Lab Stanford University School of Medicine Eleventh International Rotavirus Symposium New Delhi,
Supplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
The impact of the microbiome on brain and cognitive development
The Gut-Brain Axis The impact of the microbiome on brain and cognitive development Diane Stadler, PhD, RD Oregon Health & Sciences University, Portland, Oregon Lao-American Nutrition Institute With acknowledgements
Supplemental Figure 1: Lrig1-Apple expression in small intestine. Lrig1-Apple is observed at the crypt base and in insterstial cells of Cajal, but is
Supplemental Figure 1: Lrig1-Apple expression in small intestine. Lrig1-Apple is observed at the crypt base and in insterstial cells of Cajal, but is not co-expressed in DCLK1-positive tuft cells. Scale
Gastric Residuals in Preterm Infants
Neonatal Nursing Education Brief: Gastric Residuals in the Preterm Infant https://www.seattlechildrens.org/healthcareprofessionals/education/continuing-medical-nursing-education/neonatalnursing-education-briefs/
Innate immunity. Abul K. Abbas University of California San Francisco. FOCiS
1 Innate immunity Abul K. Abbas University of California San Francisco FOCiS 2 Lecture outline Components of innate immunity Recognition of microbes and dead cells Toll Like Receptors NOD Like Receptors/Inflammasome
GROUP 5. Jerrold R. Turner Nathalie Delzenne Wenke Feng Reuben Wong Thierry Piche Yehuda Ringel Irina Kirpich Brant Johnson
GROUP 5 Jerrold R. Turner Nathalie Delzenne Wenke Feng Reuben Wong Thierry Piche Yehuda Ringel Irina Kirpich Brant Johnson Todd Klaenhammer Eamonn Quigley A. The Intestinal Epithelial Cell Barrier B. IEC
An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration
An unconventional role for mirna: let-7 activates Toll-like receptor 7 and causes neurodegeneration Sabrina M. Lehmann, Christina Krüger, Boyoun Park, Katja Derkow, Karen Rosenberger, Jan Baumgart, Thorsten
Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v)
SUPPLEMENTARY MATERIAL AND METHODS Soft Agar Assay. For each cell pool, 100,000 cells were resuspended in 0.35% (w/v) top agar (LONZA, SeaKem LE Agarose cat.5004) and plated onto 0.5% (w/v) basal agar.
ALLERGY AND AUTOIMMUNITY
ALLERGY AND AUTOIMMUNITY Allergies and Autoimmunity Allergies and autoimmunity can be prevented It all starts in the gut It is more than preventing leaky gut IgE allergies do not necessarily involve leaky
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
Research in IBD at University of Colorado Denver
Research in IBD at University of Colorado Denver Blair Fennimore, MD Assistant Professor of Medicine Division of Gastroenterology and Hepatology UCH Crohn s and Colitis Center Mucosal Inflammation Program
Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update
NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update 1 Overview The natural growth factor IGF-1 is broken down in the body to IGF-1[1-3] NNZ-2566 is an analogue of IGF-1[1-3] developed
mirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
The enteric microbiota: Implications for IBD. Eugene B. Chang, M.D. University of Chicago
The enteric microbiota: Implications for IBD Eugene B. Chang, M.D. University of Chicago On a per cell basis, humans are mostly prokaryote 100 90 80 70 60 50 40 30 20 10 0 EuK ProK The microbial flora
INTRODUCING YOUR GUT BACTERIA
INTRODUCING YOUR GUT BACTERIA Microflora Intestinal flora 1.5 kg We would die with 5 years of birth if we did not have them as we would not develop a proper immune system 1000 species and 5000 strains
Nutrition Management in GI Diseases
Nutrition Management in GI Diseases Aryono Hendarto MD Nutrition & Metabolic Diseases Division Department of Child Health Cipto Mangunkusumo Hospital University of Indonesia 1 Patient s Care 1. Drugs 2.
Introduction Dendritic Cells (DC)
mirna-181 Promotes Graft Prolongation by Plasmacytoid Dendritic Cells by increasing T Regulatory cells and Decreasing B cells as Revealed by Mass Cytometry (CyTOF) Audrey H. Lau, MD, PhD Fellow @ UCSF
Supplementary Figure 1:
Supplementary Figure 1: (A) Whole aortic cross-sections stained with Hematoxylin and Eosin (H&E), 7 days after porcine-pancreatic-elastase (PPE)-induced AAA compared to untreated, healthy control aortas
Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases
Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,
The gut kidney axis in IgA nephropathy. Rosanna Coppo. Fondazione Ricerca Molinette Torino
The gut kidney axis in IgA nephropathy Rosanna Coppo Turin, Italy Fondazione Ricerca Molinette Torino IgA nephropathy (IgAN): a disease originated from mucosal immunity dysregulation IgA: most prevalent
Probiotics and prevention of NEC
Probiotics and prevention of NEC Indirect evidence Innate recognition of of bacteria in in human milk is is mediated by by a milk-derived highly expressed pattern recognition receptor, soluble CD14C MO
X P. Supplementary Figure 1. Nature Medicine: doi: /nm Nilotinib LSK LT-HSC. Cytoplasm. Cytoplasm. Nucleus. Nucleus
a b c Supplementary Figure 1 c-kit-apc-eflu780 Lin-FITC Flt3-Linc-Kit-APC-eflu780 LSK Sca-1-PE-Cy7 d e f CD48-APC LT-HSC CD150-PerCP-cy5.5 g h i j Cytoplasm RCC1 X Exp 5 mir 126 SPRED1 SPRED1 RAN P SPRED1
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer. Application Note
Analysis of small RNAs from Drosophila Schneider cells using the Small RNA assay on the Agilent 2100 bioanalyzer Application Note Odile Sismeiro, Jean-Yves Coppée, Christophe Antoniewski, and Hélène Thomassin
EGFR kinase activity is required for TLR4 signaling and the septic shock response
Manuscript EMBOR-2015-40337 EGFR kinase activity is required for TLR4 signaling and the septic shock response Saurabh Chattopadhyay, Manoj Veleeparambil, Darshana Poddar, Samar Abdulkhalek, Sudip K. Bandyopadhyay,
2015 Prolacta Bioscience
Housekeeping Items 1 Presentation will be available on-demand http://www.prolacta.com/webinars/feeding-protocols 2 Turn up your speaker volume 3 Use the Ask a Question feature 4 Use the full screen feature
Understanding pathogenesis to develop treatments for respiratory diseases
Understanding pathogenesis to develop treatments for respiratory diseases Phil Hansbro Research Centre for Healthy Lungs Univ of Newcastle & Hunter Medical Research Institute NSW, Australia 1 Aims Aim